A method for detecting the sex gene of parrot by PCR and primer thereof

Abstract

The application discloses a PCR method for parrot gender gene detection and primers thereof. In view of the problems that existing CHD1 gene primers are invalid or have a high error rate in psittacine species, and a new PCR product marker targeting the 15th intron (intron-15) region of the CHD1 gene is lacked, the application provides a PCR primer pair for parrot gender identification, which comprises an upstream primer (SEQ ID NO: 1) and a downstream primer (SEQ ID NO: 2) and targets the 15th intron region of the CHD1 gene. The amplification product can distinguish parrot Z / W chromosomes: 478 bp and 347 bp fragments are generated in females, and 478 bp fragments are generated in males. The primer of the application targets the intron-15 region which is not covered by existing universal primers, provides a new PCR product marker for gender identification of psittacine species, is verified to be conservative in various psittacine species, has an accuracy of 100%, and is simple to operate.

Description

Technical Field

[0001] This application relates to a PCR method and primers for detecting sex genes in parrots, belonging to the field of molecular biology technology. Background Technology

[0002] Parrots, as important ornamental birds and companion animals, play a vital role in artificial breeding, population conservation, and biodiversity research. Most parrots are hermaphroditic, making accurate sex determination difficult through physical observation. In avian sex determination, the sex chromosomes are ZW type, with males having the ZZ type and females the ZW type. The Chromo-helicase-DNA-binding protein 1 (CHD1) gene, since its application in avian sex identification in 1995, has become the most important molecular marker for sex identification in non-rabbit birds. This gene exists in two highly conserved homologous copies in most non-rabbit birds: the CHD-Z gene located on the Z chromosome and the CHD-W gene located on the W chromosome (present only in females). The CHD1 gene consists of alternating exons (coding regions) and introns (non-coding spacers). A few of its intron regions exhibit significant sequence and length polymorphisms between CHD-Z and CHD-W, which can be used to design PCR (polymerase chain reaction) primers for sex identification.

[0003] Currently, five pairs of universal primers for the CHD gene are widely reported in the literature for sex determination in birds, including P2 / P8, 2550F / 2718R, CHD1F / CHD1R, sex1 / sex-mix, and IntP2 / IntP8. Su Chang et al. (“Experimental evaluation of the effectiveness of five CHD gene-based sex determination methods in passerine birds”, Acta Wildlife Sinica, 2019, 40(3)) used the above five pairs of primers to determine the sex of 214 birds of 6 species captured in the wild, and found that the five pairs of primers had different degrees of error rate or no amplification. Çakmak E et al. (“Comparison of three different primer sets for sexing birds”, J Vet Diagn Invest, 2017, 29(1):59-63) conducted sex determination on 230 samples from 77 bird species and found that some birds even had a 100% failure rate, and pointed out that primer comparison and verification should be performed before selecting primers. Kroczak A et al. (“New Bird Sexing Strategy Developed in the OrderPsittaciformes Involves Multiple Markers to Avoid Sex Misidentification”, Genes, 2021, 12(6)) screened 135 parrot species and pointed out that no truly universal single PCR product marker has yet been found, and suggested using multiple PCR product markers for joint verification.

[0004] Several patents have been reported in the existing technology for sex identification of specific bird species.

[0005] A Chinese patent with publication number CN102134600A discloses a PCR method for sex identification of crested ibises. It uses the length difference of CHD gene introns on the Z / W chromosome to design trans-intron primers for sex identification of crested ibises (Ciconiiformes). However, the primer sequences in this scheme do not match the conserved region of the CHD1 gene in Psittaciformes species and are not suitable for sex identification of parrots.

[0006] A Chinese patent with publication number CN105543221A discloses a LAMP kit for identifying the sex of birds and its dedicated primers, which uses loop-mediated isothermal amplification (LAMP) technology; however, this method differs from the conventional PCR technology route and has higher equipment requirements.

[0007] A Chinese patent with publication number CN118186067A discloses a RAA primer set and probe for sex identification in non-platycodont birds, employing recombinase-assisted amplification (RAA) technology; however, this approach also differs from the PCR technique. None of the aforementioned existing technologies provide PCR primer pairs targeting the 15th intron of the CHD1 gene in psittaciformes species, nor do they serve as novel PCR product markers for sex identification in psittaciformes species. The multi-marker validation system requires further development.

[0008] None of the aforementioned existing technologies provide PCR primer pairs targeting the CHD1 gene intron-15 (intron 15) for Psittaciformes species, nor can they serve as novel PCR product markers for sex identification in Psittaciformes species. Therefore, there is an urgent need to develop novel PCR primers for Psittaciformes species to enrich multi-marker validation systems and improve the accuracy and reliability of identification. Summary of the Invention

[0009] The purpose of this application is to provide a PCR primer pair for sex identification of parrots and its application, in order to solve the technical problems in the prior art where the CHD1 gene primers for parrot species have failure or high error rates in some species, and lack new PCR product markers targeting the 15th intron region of the CHD1 gene.

[0010] According to one aspect of this application, a PCR primer pair for sex identification of parrots is provided, the primer pair comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer being shown in SEQ ID NO:2; the primer pair targets the 15th intron region of the CHD1 gene, and its amplification product is capable of distinguishing between the parrot's Z chromosome and W chromosome.

[0011] The upstream primer sequence shown in SEQ ID NO:1 is 5'-TCAARAAGCCTGAGGTACTGC-3' (21 bases), where R is a degenerate base representing A (adenine) or G (guanine) to accommodate the base polymorphism at this position in different species of Psittaciformes. The degenerate base R in the upstream primer SEQ ID NO:1 is incorporated into the chemical synthesis using a 1:1 molar mixture of dATP and dGTP to accommodate base polymorphisms at this site in different species of Psittaciformes. For species where the base at this site is known to be A (such as budgerigars, cockatiels, and lovebirds), a non-degenerate upstream primer (sequence 5'-TCAAAAAGCCTGAGGTACTGC-3', SEQ ID NO:5) can be used directly instead of SEQ ID NO:1 to improve amplification specificity and reduce synthesis costs; for species where the base at this site is G, a non-degenerate upstream primer (sequence 5'-TCAAAGAGCCTGAGGTACTGC-3', SEQ ID NO:6) can be used instead. Both SEQ ID NO:5 and SEQ ID NO:6 are within the scope of protection of this invention.

[0012] The downstream primer sequence shown in SEQ ID NO:2 is 5'-ACCATTTCTGCTGAGAAGAGTTA-3' (23 bases).

[0013] The upstream primer is located on exon-15 (exon 15) of the CHD1 gene, and the downstream primer is located on exon-16 (exon 16). Both primers work together to amplify across intron-15, using the length difference between the Z chromosome and the W chromosome at intron-15 to distinguish sex.

[0014] Furthermore, when the aforementioned primer pair was used to amplify the parrot genomic DNA by PCR, female individuals produced two amplification fragments with sizes of approximately 478 bp (base pair, a unit of measurement for the length of a nucleic acid fragment, where 1 bp represents the length of one base pair) and 347 bp, respectively, while male individuals produced one amplification fragment with a size of approximately 478 bp. Optionally, the size difference between the two amplified fragments is 120~140bp.

[0015] Optionally, the size difference between the two amplified fragments is selected from any value of 120bp, 125bp, 130bp, 135bp, 140bp, or any range of two. Of these, approximately 478 bp of amplified fragments originated from the Z chromosome (CHD-Z), and approximately 347 bp of amplified fragments originated from the W chromosome (CHD-W), which are female-specific.

[0016] Preferably, the parrot is selected from at least one of the following: budgerigar, cockatiel, lovebird, sun conure, monk parakeet, blue-and-gold macaw, and Amazon parrot.

[0017] Analysis using NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) confirmed that highly conserved binding sites of the primers of this invention exist on the CHD-Z genes of the above seven Psittaciformes species.

[0018] This application also provides a kit containing the above-described PCR primer pairs. The kit contains the PCR primer pairs described in this invention and may further include at least one of the following: PCR reaction buffer, dNTPs (deoxynucleoside triphosphates, which are substrates for PCR amplification), DNA polymerase, and double-distilled water.

[0019] According to another aspect of this application, the application of the above-described PCR primer pairs in the sex determination of parrots for non-disease diagnostic purposes is provided.

[0020] This application also provides a method for assisting in the detection of the sex of a parrot, comprising the following steps: extracting genomic DNA from the parrot; performing PCR amplification on the genomic DNA using the PCR primer pair described in this invention to obtain PCR amplification products; detecting the PCR amplification products, and determining that the parrot is female if it contains two fragments of approximately 478 bp and 347 bp in size, respectively; and determining that the parrot is male if it contains only one fragment of approximately 478 bp and does not contain a fragment of approximately 347 bp.

[0021] Optionally, the annealing temperature for the PCR amplification is 45~60℃.

[0022] Optionally, the annealing temperature is selected from any value or a range of any two of 45°C, 48°C, 50°C, 52°C, 55°C, 58°C, and 60°C. Optionally, the number of PCR amplification cycles is 25 to 40.

[0023] Optionally, the number of cycles is selected from any value of 25, 28, 30, 32, 35, 38, or 40 cycles, or a range of values ​​consisting of any two of them; Optionally, the PCR amplification reaction system is 20-30 μL.

[0024] Optionally, the volume of the reaction system is selected from any value of 20 μL, 22 μL, 25 μL, 28 μL, 30 μL, or a range of any combination of both. Optionally, the method for detecting PCR amplification products is agarose gel electrophoresis or sequencing; Preferably, 2% (by mass / volume) agarose gel electrophoresis is used, and the images are visualized using an ultraviolet transilluminator.

[0025] Optionally, the sample of the parrot to be tested is a feather with a follicle, and the genomic DNA is extracted using a rapid lysis method, which includes placing the base of the feather in a commercially available rapid lysis buffer and heating it at 95-100°C for 5-15 minutes.

[0026] Optionally, the heating temperature is selected from any value of 95°C, 97°C, 98°C, and 100°C, or a range of any two of them; Optionally, the heating time is selected from any value of 5 min, 8 min, 10 min, 12 min, 15 min, or a range of any combination of both.

[0027] The purity of the extracted genomic DNA was determined by spectrophotometry. The OD260 / 280 ratio (the ratio of absorbance at 260 nm and 280 nm wavelengths, used to assess DNA purity; a ratio of approximately 1.8 to 2.0 indicates relatively pure DNA) was approximately 1.8 to 2.0, which was suitable for subsequent PCR amplification.

[0028] In this application, "SEQ ID NO:1 and SEQ ID NO:2" refer to the nucleotide sequences of the upstream and downstream primers, respectively; the nucleotide sequences of the Z chromosome amplification fragment (478 bp) and the W chromosome amplification fragment (347 bp) are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0029] The beneficial effects that this application can produce include: 1) This invention utilizes the length difference of the CHD1 gene intron-15 on the Z and W chromosomes to design a specific trans-intron PCR primer pair. This primer pair targets the intron-15 region that is not covered by the five existing universal primer pairs, providing a new PCR product marker for sex determination in Psittaciformes species. It can be used in conjunction with existing primers to form a multi-marker verification system, effectively compensating for the ineffectiveness of existing primers in some Psittaciformes species and improving the reliability of identification.

[0030] 2) This invention has been validated in wet experiments on three non-protected model species: budgerigars, cockatiels, and lovebirds, with a total of 10 individuals of known sex and an accuracy rate of 100%. Based on the high conservation of the exon-15 / exon-16 region of the CHD1 gene in parrots and the stability of the intron-15 length difference, NCBI BLAST analysis reasonably predicts that it can be applied to four national second-class protected species: sun conures, monk parakeets, blue-and-gold macaws, and Amazon parrots. It can provide a reliable multi-marker validation tool for sex identification of rare and endangered parrot populations.

[0031] 3) This invention requires no special instruments. Identification can be completed simply by mastering conventional PCR techniques and agarose gel electrophoresis. It is easy to operate, highly reproducible, and has an accuracy rate of up to 100%, making it suitable for widespread application under conventional laboratory conditions.

[0032] 4) This invention uses feathers with follicles as samples and combines rapid lysis to extract genomic DNA. It is a non-destructive sampling method that does not harm parrots and is especially suitable for sex identification of rare and endangered parrot species. Attached Figure Description

[0033] Figure 1 This is a schematic diagram showing the alignment location of the primer pair amplified fragment in the parrot CHD-Z gene. Detailed Implementation

[0034] The present application is described in detail below with reference to the embodiments, but the present application is not limited to these embodiments.

[0035] Unless otherwise specified, the raw materials and reagents used in the embodiments of this application were purchased commercially, and the experimental methods in the following embodiments are conventional experimental methods in the art unless otherwise specified.

[0036] Example 1 The primer sequences of this invention were analyzed using NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) to verify their specificity. The results are shown in Table 1.

[0037] Table 1. Specificity Validation Results of Primer Sequences by NCBI BLAST

[0038] The NCBI BLAST analysis results above indicate that the primer pairs (SEQ ID NO:1 and SEQ ID NO:2) of this invention possess highly conserved binding sites in the CHD-Z and CHD-W genome sequences of Sun Conures, Monk Conures, Blue-and-Gold Macaws, and Amazon Parrots, and are expected to produce amplified fragments of the same size as those of Budgerigars, Cockatiels, and Lovebirds. NCBI BLAST is an internationally recognized sequence homology alignment tool widely used for primer specificity prediction and amplification site verification. Its analysis results show a high degree of consistency with wet-lab results and have been extensively used in the literature for predicting and verifying primer conservation. This invention underwent wet-lab verification on Budgerigars, Cockatiels, and Lovebirds (see Example 2), and the results were completely consistent with BLAST predictions, achieving an accuracy of 100%, further supporting the reliability of BLAST analysis results for other species.

[0039] In addition, the primer pairs of this invention also amplified other birds such as chickens, ducks, pigeons, sparrows, and black-legged gulls, but the band size differed from that of parrots, as shown in Table 2.

[0040] Table 2. Specificity of primer sequences to other species

[0041] Example 2 Select 10 parrots of known sex (including budgies, cockatiels, and lovebirds), and collect 3-5 fresh feathers (with follicles) from each parrot.

[0042] The location of the novel marker for the PCR product of this invention on the CHD-Z gene in budgerigars is shown in the figure below. Figure 1 The PCR product spans intron-15 (intron 15), with the upstream primer (SEQ ID NO:1, CHD1-F) located on exon-15 (exon 15) and the downstream primer (SEQ ID NO:2, CHD1-R) located on exon-16 (exon 16). This novel marker for the PCR product is conserved in the CHD-Z gene of the multiple parrot species described in Table 1.

[0043] Cut 3-5 mm of the feather root and place it in a PCR reaction tube. Extract genomic DNA using a rapid lysis method: Add 150 μL of a self-prepared rapid feather lysis buffer, which consists of 50 mM NaOH, 1 mM EDTA, and 0.5% (v / v) Tween-20 at pH 8.0. This lysis buffer breaks down cell membranes through NaOH alkali lysis, EDTA chelates metal ions to inhibit nuclease activity, and Tween-20 helps dissolve keratin. It can efficiently release genomic DNA from feather follicles under heating conditions of 95-100℃ without the need for organic solvent extraction and column purification.

[0044] DNA concentration and purity were detected using a spectrophotometer. OD260 / 280 (the ratio of absorbance at 260 nm to 280 nm wavelengths, used to assess DNA purity; a ratio of approximately 1.8–2.0 indicates relatively pure DNA) ≈ 1.8–2.0, indicating that the extracted DNA is relatively pure and can be used for subsequent PCR amplification.

[0045] Primer sequences are shown in Table 3.

[0046]

[0047] Table 3 Primer pair sequences The PCR amplification system used was a 25 μL system, which included 12.5 μL of 2X PCR Master Mix (a premixed reagent containing DNA polymerase, dNTPs, PCR buffer and other components required for PCR amplification), 1.0 μL of upstream primer (SEQ ID NO:1), 1.0 μL of downstream primer (SEQ ID NO:2), 1.0 μL of parrot genomic DNA, and 9.5 μL of double-distilled water.

[0048] Amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 48~55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; 72℃ annealing for 5 min; store at 4℃.

[0049] PCR amplification products were separated by 2% (w / v) agarose gel electrophoresis and visualized using a UV transilluminator.

[0050] The test results are shown in Table 4. Samples 1-5 (females) contained two fragments in their amplification products: 478 bp (base pair, a unit of measurement for nucleic acid fragment length, 1 bp representing the length of one base pair) and 347 bp, respectively. Samples 6-10 (males) contained only one 478 bp fragment in their amplification products. The consistency of the test results with the known sex was 100%.

[0051] Table 4 Results of the parrot sex experiment

[0052] sequence list <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing1.3 / / EN" "ST26SequenceListing_V1_3.dtd"> <ST26SequenceListingdtdVersion="V1_3" fileName="DD260130I Sequence Listing.xml" softwareName="WIPO Sequence" softwareVersion="3.1.2" productionDate="2026-07-22"> <applicationidentification> <ipofficecode>< / ipofficecode> <applicationnumbertext>< / applicationnumbertext> <filingdate> 2026-07-22< / filingdate> < / applicationidentification> <applicantfilereference> 12350000MB1C15336E< / applicantfilereference> <applicantname languagecode="zh"> Mindu Innovation Laboratory< / applicantname> <applicantnamelatin> 12350000MB1C15336E< / applicantnamelatin> <inventiontitle languagecode="zh"> A PCR method for sex gene detection in parrots and its primers< / inventiontitle> <sequencetotalquantity> 6< / sequencetotalquantity> <sequencedata sequenceidnumber="1"> <insdseq> <INSDSeq_length> 21< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q2"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> <insdfeature> <INSDFeature_key>misc_feature< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier id="q1"> <INSDQualifier_name>note< / INSDQualifier_name> <INSDQualifier_value>CHD1-FR ; r represents A / G< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> tcaaraagcctgaggtactgc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="2"> <insdseq> <INSDSeq_length> 23< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..23< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q4"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> <insdfeature> <INSDFeature_key>misc_feature< / INSDFeature_key> <INSDFeature_location>1..23< / INSDFeature_location> <INSDFeature_quals> <insdqualifier id="q3"> <INSDQualifier_name>note< / INSDQualifier_name> <INSDQualifier_value>CHD1-R< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> accattctgctgagaagagtta< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="3"> <insdseq> <INSDSeq_length> 478< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..478< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q6"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Melopsittacus undulatus< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> <insdfeature> <INSDFeature_key>misc_feature< / INSDFeature_key> <INSDFeature_location>1..478< / INSDFeature_location> <INSDFeature_quals> <insdqualifier id="q5"> <INSDQualifier_name>note< / INSDQualifier_name> <INSDQualifier_value>Z; CHD-Z gene fragment< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> caaaaagcctgaggtactgccttttgaacctttactgagggctttataattcctcgttaaaatccacctatagtgtaagatgtaccatgtaagtaatttctaatcatatgtgaaagcaaaacagatgtaagctctcacaatataatcaagctaaagaaaaaagcagatccgccccaaaatgtacaaccatcccaaacaaaagctacatgacattagaccaatgtaagtcttgagcccttgcttcaagaattttagtgctgtgaaatcctagaagcctgaagttcaaactgtattataaaaactattatatttcagtaaattgcttgtagatataccactgaaagagctcaacttaaaaagtgttgttacttgtaatactgcttctgtaatgcactcatttccatcctcagaatttgctcaactttagcaggtaaagacttttctacatcttttttaactcttctcagcagaaatggtt< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="4"> <insdseq> <INSDSeq_length> 347< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..347< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q8"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Melopsittacus undulatus< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> <insdfeature> <INSDFeature_key>misc_feature< / INSDFeature_key> <INSDFeature_location>1..347< / INSDFeature_location> < / insdfeature> <insdfeature> <INSDFeature_key>misc_feature< / INSDFeature_key> <INSDFeature_location>1..347< / INSDFeature_location> <INSDFeature_quals> <insdqualifier id="q7"> <INSDQualifier_name>note< / INSDQualifier_name> <INSDQualifier_value>W; CHD-W gene fragment< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ccatttctactcagaagagttaaaaaagatgtagaaaaatctttacctgccaaggttgaacagattttgaggatggaaatgagtgcattacagaagcaatattacaagtaagcaatgacactttttaattccagcaattttaatgatatatctatatgaaaatttctgaagtgtaatagttctcataatgcaatttgaactggtattttgagagcttacatccttcatatttccacaaacggttagaaattactttcattgcatattctatgtcataggtggattttacccaggaattataaagccctgagtaaaggttcaaaaggcagtacctcaggatttttgaa< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="5"> <insdseq> <INSDSeq_length> 21< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q10"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> <insdfeature> <INSDFeature_key>misc_feature< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier id="q9"> <INSDQualifier_name>note< / INSDQualifier_name> <INSDQualifier_value>A< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> tcaaaaagcctgaggtactgc< / INSDSeq_sequence> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="6"> <insdseq> <INSDSeq_length> 21< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q12"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> <insdfeature> <INSDFeature_key>misc_feature< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier id="q11"> <INSDQualifier_name>note< / INSDQualifier_name> <INSDQualifier_value>GG< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> tcaaagagcctgaggtactgc< / INSDSeq_sequence> < / insdseq> < / sequencedata> The foregoing are merely several embodiments of the present application, and are not intended to limit the present application in any form. Although the present application is disclosed above with reference to preferred embodiments, it is not intended to limit the present application. Any person skilled in the art, without departing from the scope of the technical solution of the present application, may make several variations or modifications using the technical content disclosed above, which are equivalent to equivalent embodiments and all fall within the scope of the technical solution.

Claims

1. A PCR primer pair for sex determination in parrots, characterized in that, The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2; The primer pair targets the 15th intron region of the CHD1 gene, and its amplification product can distinguish between the parrot Z chromosome and the W chromosome.

2. The PCR primer pair according to claim 1, characterized in that, When the primer pair was used to amplify the parrot genomic DNA by PCR, female individuals produced two amplified fragments of 478 bp and 347 bp in size, respectively, while male individuals produced one amplified fragment of 478 bp in size. The two amplified fragments differ in size by 120~140bp.

3. The PCR primer pair according to claim 1, characterized in that, The parrot is selected from at least one of the following: budgerigar, cockatiel, lovebird, sun conure, monk parakeet, blue-and-gold macaw, and Amazon parrot.

4. A kit comprising the PCR primer pair of claim 1, characterized in that, It also includes at least one of PCR reaction buffer, dNTPs, DNA polymerase, and double-distilled water.

5. The use of the PCR primer pair according to claim 1 in sex determination of parrots for non-disease diagnostic purposes.

6. A method for assisting in the detection of the sex of a parrot, characterized in that, The procedure includes the following steps: extracting genomic DNA from the parrot to be tested; performing PCR amplification on the genomic DNA using the PCR primers described in claim 1 to obtain PCR amplification products; detecting the PCR amplification products, and determining that the parrot to be tested is female if it contains two fragments of 478 bp and 347 bp in size, respectively; and determining that the parrot to be tested is male if it contains only one fragment of 478 bp in size and does not contain a fragment of 347 bp in size.

7. The method according to claim 6, characterized in that, The annealing temperature for the PCR amplification is 45~60℃.

8. The method according to claim 6, characterized in that, The number of PCR amplification cycles is 25 to 40.

9. The method according to claim 6, characterized in that, The PCR amplification reaction system is 20-30 μL, including 2X PCR Master Mix, upstream and downstream primers, parrot genomic DNA, and double-distilled water.

10. The method according to claim 6, characterized in that, The method for detecting PCR amplification products is agarose gel electrophoresis or sequencing. The sample of the parrot to be tested is a feather with a follicle. The genomic DNA is extracted using a rapid lysis method, which includes placing the base of the feather in a lysis buffer and heating it at 95-100°C for 5-15 minutes.

Images