A molecular marker for identifying genetic sex of anglewinds

Abstract

The present application relates to the technical field of aquatic animal molecular breeding and molecular detection, and specifically discloses a molecular marker for identifying the genetic sex of Onchidium struma, the nucleotide sequence of the molecular marker is shown as SEQ ID NO:1, and the molecular marker is stably present only in the genome of female Onchidium struma. The present application further provides a specific primer pair F1 / R1 for amplifying the marker, and a primer combination comprising the primer pair and CO1 internal reference primer FCO / RCO. The present application amplifies the two primer pairs in the same reaction system by multiplex PCR, and can accurately determine the genetic sex of the individual under test according to whether 364 bp female-specific bands and 557 bp internal reference bands are amplified. The molecular marker and detection method provided by the present application can be used to identify the sex of live Onchidium struma at any development stage, without killing the individual, and are simple to operate, accurate, and suitable for the breeding of Onchidium struma seedlings, the selection of parents, and the sex management of breeding populations.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding and molecular detection technology for aquatic animals, specifically a molecular marker for identifying the genetic sex of the horned slug snail. Background Technology

[0002] The horned salamander (Turbo cornutus) belongs to the phylum Mollusca, class Gastropoda, order Protogastropoda, and family Turbopodidae. It is one of the important economic shellfish in southeastern coastal my country, with high edible value and market recognition. With the decline of natural resources and the continuous growth of market demand, the artificial breeding scale of horned salamanders is constantly expanding, and its seedling propagation and genetic breeding work are receiving increasing attention.

[0003] Sex is one of the important factors to be considered in the trait management of aquaculture. During the parent selection and mating stage, the ratio of different sexes directly affects fertilization efficiency and seedling yield. In the production stage, there are often differences in growth rate, meat quality, and market size between male and female individuals, and the regulation of the sex ratio has a direct impact on aquaculture efficiency. In genetic breeding, the analysis of sex determination mechanisms and the discovery of sex-specific genetic markers are the foundation for conducting sex-controlled breeding.

[0004] However, male and female horned trevally lack stable and distinguishable differences in external morphology, and sex cannot be determined by appearance alone before the gonads mature. Currently, sex determination in horned trevally mainly relies on visual observation or tissue section identification of the gonads after dissection. This method not only requires the euthanasia of the examined individuals but also requires the samples to reach a certain level of sexual maturity, limiting its application in live parent selection and juvenile sex determination.

[0005] Currently, there are no reports of DNA molecular markers and related detection methods that can be used for sex identification in live horned trevally. Therefore, obtaining sex-specific DNA molecular markers for horned trevally and establishing a method that can identify the sex of live individuals at any developmental stage without relying on gonadal morphology observation is of great practical significance for promoting the development of the horned trevally farming industry and genetic breeding research. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a molecular marker for identifying the genetic sex of horned slugs. This addresses the issue in the prior art where the lack of stable and identifiable external morphological differences between male and female horned slugs means that sex identification can only be performed by dissecting gonads or tissue sections, making it impossible to perform sex identification on individuals at any developmental stage in a living organism.

[0007] This invention provides a molecular marker for identifying the genetic sex of a horned salamander, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0008] The present invention also provides a primer pair for amplifying the above-mentioned molecular marker, the primer pair comprising an upstream primer F1 and a downstream primer R1, the nucleotide sequence of the upstream primer F1 being shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer R1 being shown in SEQ ID NO:3.

[0009] The present invention also provides a primer combination for identifying the genetic sex of the horned salamander, the primer combination comprising the above-mentioned primer pair and an internal reference primer pair, wherein the internal reference primer pair is a primer pair for amplifying the CO1 gene fragment of the horned salamander, comprising an upstream primer FCO and a downstream primer RCO, the nucleotide sequence of the upstream primer FCO is shown in SEQ ID NO:4, and the nucleotide sequence of the downstream primer RCO is shown in SEQ ID NO:5.

[0010] The present invention also provides a multiplex PCR system for identifying the genetic sex of horned salvia, the multiplex PCR system comprising the above-mentioned primer combination, 2×PCR premix and nuclease-free water.

[0011] This invention also provides a method for identifying the genetic sex of a horned trevally, comprising the following steps:

[0012] (1) Extract genomic DNA from the snail to be tested;

[0013] (2) Using the genomic DNA extracted in step (1) as a template, perform multiplex PCR amplification using the primer combination described above;

[0014] (3) The amplification products from step (2) were detected by agarose gel electrophoresis;

[0015] (4) Determine the sex based on the electrophoresis results: If a 364 bp female-specific band and a 557 bp CO1 internal reference band are present, the sex is determined to be female; if only a 557 bp CO1 internal reference band is present and no 364 bp female-specific band is present, the sex is determined to be male; if no 557 bp CO1 internal reference band is present, the test is determined to be invalid.

[0016] Preferably, the genomic DNA described in step (1) is extracted from the mantle tissue of the horned salamander.

[0017] Preferably, the amount of the mantle tissue used is 5 mg.

[0018] Preferably, the reaction system for multiplex PCR amplification in step (2) is as follows: total reaction volume 20 μL, including 1 μL DNA template, 10 μL 2×PCR premix, 0.2 μL of 10 μM upstream primer F1, 0.2 μL of 10 μM downstream primer R1, 0.2 μL of 5 μM upstream primer FCO, 0.2 μL of 5 μM downstream primer RCO, and 8.2 μL nuclease-free water.

[0019] Preferably, the multiplex PCR amplification program in step (2) is as follows: pre-denaturation at 95℃ for 4 min; denaturation at 95℃ for 30 s, annealing at 54℃ for 15 s, extension at 72℃ for 10 s, for a total of 36 cycles; and finally extension at 72℃ for 4 min.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] By screening for female-specific DNA molecular markers in horned trevally and designing specific amplification primers, direct determination of genetic sex at the DNA level was achieved, eliminating the reliance on external morphological characteristics and gonadal development levels found in traditional methods. This method can be implemented at any stage of individual development, and is particularly suitable for juvenile samples that have not yet reached sexual maturity and whose sex cannot be determined by gonadal observation, providing a reliable technical means for early sex identification in horned trevally.

[0022] This invention utilizes a female-specific marker primer and a CO1 internal control primer in the same reaction system for multiplex PCR amplification. This enables effective monitoring of sample processing and amplification by the internal control, avoiding false negative results caused by poor DNA quality or amplification failure. Furthermore, this method requires only a small amount of living tissue for detection, allowing the sampled individuals to continue surviving and being cultured without affecting subsequent breeding and production. Compared to traditional gonadal dissection or tissue sectioning methods, this significantly reduces damage to the tested individuals.

[0023] The detection method established in this invention is based on conventional multiplex PCR and agarose gel electrophoresis techniques. The instruments and reagents involved are standard equipment found in molecular biology laboratories, requiring no special instruments or expensive consumables, making it easy to promote and apply in research institutions and seedling production stations at all levels. This method has a simple operation procedure and intuitive result interpretation, and can be used for sex screening in seedling cultivation, sex confirmation during parent selection, and the regulation and management of sex ratios in aquaculture populations, demonstrating good prospects for practical application and promotion. Attached Figure Description

[0024] Figure 1 This is a flowchart illustrating the genetic sex identification method for horned trevally provided in an embodiment of the present invention.

[0025] Figure 2 This is an electrophoresis image of multiplex PCR verification of sex molecular markers in the horned salvia in an embodiment of the present invention. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Example 1: Screening of female-specific DNA molecular markers in horned salamanders and establishment of a multiplex PCR detection system.

[0028] This embodiment illustrates the process of obtaining female-specific DNA molecular markers from horned salamanders and the establishment and optimization of a multiplex PCR sex identification system based on these markers.

[0029] 1.1: Sample Collection and Gender Confirmation

[0030] The samples of the horned turbo snail (Turbo cornutus) were collected from the nearshore waters surrounding Huizhou City, Guangdong Province and Fuzhou City, Fujian Province.

[0031] The collected live samples were temporarily housed in a recirculating seawater aquaculture system, with the water temperature controlled at 24±2℃ and the salinity at 30‰. They were fed natural food such as sea lettuce daily.

[0032] Each individual was individually numbered and its external morphological parameters, such as shell height and width, were recorded. To confirm the true sex, a subset of individuals were examined for gonadal tissue sections using the method described in the reference.

[0033] The specific procedure is as follows: the gonadal tissue is removed from the dissected individual, fixed with Bouin's fixative for 24 hours, dehydrated by gradient ethanol, cleared with xylene, embedded in paraffin, and then sectioned with a thickness of 5μm using a microtome. After hematoxylin-eosin staining, it is observed under an optical microscope.

[0034] Sex is determined by the type of reproductive cells in the gonads: those with predominantly oocytes are female, while those with predominantly sperm cells and sperm are male.

[0035] Based on this, 30 male and 30 female individuals were selected for subsequent whole-genome resequencing.

[0036] 1.2: Genomic DNA Extraction and Whole Genome Resequencing

[0037] Take about 30 mg of foot muscle tissue, cut it into small pieces, and add STE buffer (10 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA) and proteinase K to a final concentration of 200 μg / mL. Digest overnight at 55°C.

[0038] DNA was extracted using the conventional phenol-chloroform method: equal volumes of Tris-saturated phenol, phenol:chloroform:isoamyl alcohol (25:24:1), and chloroform:isoamyl alcohol (24:1) were extracted sequentially. The supernatant was precipitated with 2 volumes of anhydrous ethanol, washed with 70% ethanol, and then dissolved in TE buffer.

[0039] The concentration of the extracted DNA was determined by NanoDrop 2000, with an A260 / A280 ratio between 1.8 and 2.0. Agarose gel electrophoresis showed that the DNA bands were intact and showed no significant degradation.

[0040] Thirty DNA samples from each of the aforementioned male and female individuals were sent to a sequencing company for whole-genome resequencing. Paired-end sequencing was performed using the Illumina NovaSeq 6000 platform, with read lengths of 150 bp and an average sequencing depth of at least 10×.

[0041] After removing adapters and low-quality bases from the raw data, the effective reads were aligned to the reference genome of the horned salamander assembled by the research group using BWA software.

[0042] The comparison results were sorted and PCR duplicates were removed using SAMtools software, and SNP and InDel variants were detected using GATK software.

[0043] Variants were filtered (deletion rate <10%, minimum allele frequency >5%, Hardy-Weinberg equilibrium P-value). After that, approximately 2.8 million high-quality SNP loci were obtained for subsequent analysis.

[0044] 1.3: GWAS screening for female-specific association markers

[0045] Genome-wide association analysis was performed using sex as the phenotype (female is coded as 1, male as 0) with GAPIT software.

[0046] A mixed linear model was adopted, incorporating the population structure matrix Q and kinship matrix K as covariates to control for the interference of population stratification on the association analysis results.

[0047] After Bonferroni correction, with ( () is used as a significant association threshold.

[0048] GWAS analysis revealed multiple SNP sites in a specific region of the genome that were significantly associated with sex. By extracting and comparing differentially expressed sequences from males and females in this region, a DNA sequence was found that was stable only in females and completely absent in males.

[0049] The sequence was verified by Sanger sequencing. It was 364 bp in length and could be amplified in all female individuals tested, but could not be detected in male individuals.

[0050] This 364 bp sequence is a female-specific DNA marker for the horned salamander, and its nucleotide sequence is shown in SEQ ID NO:1.

[0051] The sequence list of the present invention is shown below.

[0052] SEQ ID NO:1 (Female-specific DNA marker of the horned slug):

[0053] TCGTATGCATTCGAGTAGGGAAAGAGTATTCAAAGAAATATTTCTACCCGAAAATGCGACTGTCGGTAAGGTGACAGTTGACGATTTAAAGTAACGTTACCATGACATCATGTGACATATTGGAACATAGTGGACCCGGCACACTGTAATAACGTTAAAGTCATGGAGAAAAATTATTCAC AAAGCAATGGTTGCGTCAGAAATTATAGGACAATGACAACACATACTGTTTTGAAATCTGCTTTTCCATGCCCTTTTGAATATGTGTATCACATACACATTAGTAGTATTTGAAATTTTCAAAAAAACGAACTAGGTCACTTTAAATAGAAACTCTAAGACCAACATAGGTGAAATGCAGTG

[0054] SEQ ID NO:2 (Upstream primer F1):

[0055] TCGTATGCATTCGAGTAGGGA

[0056] SEQ ID NO:3 (downstream primer R1):

[0057] CACTGCATTTCACCTATGTTGGTCT

[0058] SEQ ID NO:4 (Upstream primer FCO):

[0059] TGGATGTTGACACTCGTGCT

[0060] SEQ ID NO:5 (Downstream primer RCO):

[0061] TACGCCACGTTGAGAAACGA

[0062] 1.4: Primer Design and Synthesis

[0063] Based on the female-specific marker sequence (SEQ ID NO:1) obtained above, specific amplification primers were designed using Primer Premier 5.0 software.

[0064] The following principles should be followed when designing primers: primer length 18-25bp, GC content 40%-60%, annealing temperature 50-60℃, Tm value difference between upstream and downstream primers not exceeding 3℃, and avoid the formation of secondary structures inside and between primers.

[0065] Finally, upstream primer F1 and downstream primer R1 were obtained, with nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. The expected amplification product length is 364 bp.

[0066] Meanwhile, to avoid false negative results and monitor PCR amplification efficiency, the mitochondrial CO1 gene was selected as an internal reference.

[0067] Based on the CO1 gene sequence of the horned salamander, internal reference primers FCO and RCO were designed, with nucleotide sequences shown in SEQ ID NO:4 and SEQ ID NO:5, respectively. The expected amplification product length is 557 bp.

[0068] Preliminary experiments have verified that this primer pair can stably amplify DNA within a template DNA concentration range of 10-100 ng / μL, with good amplification efficiency.

[0069] 1.5: Establishment of Multiplex PCR System and Optimization of Reaction Conditions

[0070] To establish a multiplex PCR system capable of simultaneously detecting female-specific markers and CO1 internal controls, the reaction conditions were systematically optimized.

[0071] Primer concentration optimization: With other components of the PCR system fixed, the addition amounts of F1 / R1 (10 μM) were set to 0.1, 0.2, 0.3, and 0.4 μL, and the addition amounts of FCO / RCO (5 μM) were set to 0.1, 0.2, 0.3, and 0.4 μL, and cross-combination experiments were conducted.

[0072] The optimal primer amounts were determined to be 0.2 μL each of F1 and R1 (final concentration 0.1 μM) and 0.2 μL each of FCO and RCO (final concentration 0.05 μM), based on the evaluation criteria that both primer pairs could effectively amplify without non-specific products.

[0073] Annealing temperature optimization: Amplification comparisons were performed at four temperatures: 52℃, 54℃, 56℃, and 58℃.

[0074] The results showed that the amplification efficiency of the two primer pairs was balanced at an annealing temperature of 54℃, and the bands were clear and of moderate brightness.

[0075] Non-specific amplification occurs when the annealing temperature is too low (52℃), while the amplification efficiency decreases significantly when the annealing temperature is too high (56-58℃).

[0076] Cycle number optimization: The amplification effect was tested at 28, 32, 36, and 40 cycles. At 32 cycles, the bands were discernible but insufficiently bright; at 36 cycles, the bands were bright and clear with no non-specific bands; and at 40 cycles, some samples showed non-specific amplification. Therefore, 36 cycles were determined to be the optimal number of cycles.

[0077] The optimized multiplex PCR reaction system is as follows: total volume 20 μL, containing 1 μL DNA template, 10 μL 2×PCR premix, 0.2 μL 10 μM upstream primer F1, 0.2 μL 10 μM downstream primer R1, 0.2 μL 5 μM upstream primer FCO, 0.2 μL 5 μM downstream primer RCO, and nuclease-free water to a final volume of 20 μL.

[0078] The 2×PCR premix was purchased from Beyotime Biotechnology Co., Ltd. (this premix is ​​a component of the D7281M animal tissue direct PCR kit) and contains Taq DNA polymerase, dNTPs, and reaction buffer.

[0079] The amplification program was as follows: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 30 s, 54℃ annealing for 15 s, 72℃ extension for 10 s, for a total of 36 cycles; and finally 72℃ extension for 4 min.

[0080] The amplification reaction was performed on a Bio-Rad T100 gradient PCR instrument.

[0081] 1.6: Detection of PCR products and sex determination

[0082] Take 5 μL of PCR product, add 1 μL of 6× loading buffer, and electrophoresis at 120V for 30 min on a 1.5% agarose gel containing GoldView nucleic acid dye.

[0083] After electrophoresis, the samples were observed and photographed using a gel imaging system. The DL2000 DNA molecular weight standard was used as a reference for fragment size.

[0084] Based on the above test results, the criteria for gender determination are as follows:

[0085] (1) A female-specific band appeared at approximately 364 bp, and a CO1 internal reference band appeared at approximately 557 bp, indicating female;

[0086] (2) The CO1 internal reference band only appeared at about 557 bp, and there was no band at about 364 bp, which was determined to be male;

[0087] (3) If there is no internal control band at approximately 557bp, it indicates that the template DNA quality is unqualified or the PCR amplification has failed. The test result is invalid and a new sample needs to be taken for testing.

[0088] 1.7: Preliminary verification of the method's accuracy

[0089] Using the established multiplex PCR method, a blinded PCR test was performed on 30 horned salamanders of known sex (15 females and 15 males). The testers were unaware of the sample sex information beforehand. The results showed that all 15 female samples amplified two target bands simultaneously (364 bp and 557 bp), while all 15 male samples amplified only a single 557 bp band, perfectly consistent with the true sex confirmed by tissue sections, with a preliminary accuracy rate of 100%.

[0090] Figure 1 This is a schematic flowchart illustrating the genetic sex identification method for horned trevally provided in an embodiment of the present invention. Figure 1 As shown, this method first involves cutting a small amount of tissue from the mantle of the snail to be tested, preparing a DNA template by direct lysis using a kit, and then using multiplex PCR to simultaneously amplify the female-specific marker and the CO1 internal reference gene. The amplified products are then interpreted after agarose gel electrophoresis: the presence of both a 364 bp female-specific band and a 557 bp internal reference band indicates a female, the presence of only the 557 bp internal reference band indicates a male, and if the internal reference band is missing, the test needs to be repeated.

[0091] Example 2: Validation and application of genetic sex identification methods for horned trevally in different geographical populations.

[0092] This embodiment is used to verify the stability and reliability of the method established in Example 1 in different geographical populations, and to further confirm the feasibility of non-lethal testing using mantle tissue sampling.

[0093] 2.1: Sample Collection and Mantle Tissue Sampling

[0094] Live specimens of horned trevally were collected from a population of 135 individuals in Huizhou, Guangdong and a population of 65 individuals in Fuzhou, Fujian, for a total of 200 individuals. All individuals remained alive during the sampling and processing.

[0095] For each individual to be tested, approximately 5 mg of tissue (about the size of a grain of rice) was taken from the edge of the mantle using sterile surgical scissors. After sampling, the individual was immediately returned to the aquaculture water and observed for 24 hours to confirm the absence of death and abnormal behavior.

[0096] The tissue samples were processed using the Beyotime Animal Tissue Direct PCR Kit (catalog number D7281M) to prepare DNA templates: the tissues were placed in PCR tubes containing 50 μL of digestion buffer, incubated at 55°C for 15 min, heated at 95°C for 5 min to inactivate protease, and the resulting lysate was used directly as a PCR template.

[0097] This method avoids the cumbersome operation of traditional phenol-chloroform extraction, and the processing time for a single sample can be controlled within 20 minutes.

[0098] 2.2: Multiplex PCR detection

[0099] The multiplex PCR system and amplification procedure optimized in Example 1 were used for detection. Each batch of amplification included a positive control (with a known female template), a negative control (with a known male template), and a blank control (with water without nuclease instead of template).

[0100] Electrophoresis results as follows Figure 2 As shown, the female sample showed clear double bands of 364 bp and 557 bp, while the male sample showed only a single band of 557 bp. The band size was exactly as expected.

[0101] 2.3: Statistical and Histological Verification of Detection Results

[0102] The testing results of 135 individuals from the Huizhou group were as follows: 55 individuals showed a double band pattern at 364 bp and 557 bp, and were identified as females; 80 individuals showed only a single band pattern at 557 bp, and were identified as males. The testing results of 65 individuals from the Fuzhou group were as follows: 26 individuals showed a double band pattern (females), and 39 individuals showed a single band pattern (males). A total of 81 females and 119 males were detected in both groups.

[0103] To confirm the accuracy of the PCR identification results, the gonads of the 200 individuals were dissected and tissue sections were prepared. The true sex was then confirmed using the method described in Example 1. In the Huizhou population, 55 individuals identified as female by PCR showed abundant oocytes in their gonads, while 80 individuals identified as male by PCR showed sperm cells and mature sperm. The histological results of the Fuzhou population were also completely consistent with the PCR identification results. The PCR identification results of all 200 individuals matched the gonadal histological sex determination, achieving an overall accuracy of 100% (Table 1).

[0104] Table 1: Results of multiplex PCR validation of sex markers in horned salvia.

[0105]

[0106] The above results demonstrate that the sex determination method of the present invention has good applicability and stability in populations from different geographical origins and is not significantly affected by differences in population genetic background.

[0107] 2.4: Advantages of Non-Lethal Sampling

[0108] Using the mantle tissue sampling method described in this embodiment, all 200 individuals survived after sampling, and the sampling sites healed rapidly without infection or death. Compared to the traditional gonadal tissue section method, this method can complete sex determination without euthanizing the individual, making it particularly suitable for parental screening and early determination of the sex of offspring. For individuals that have not yet reached sexual maturity, the gonadal tissue section method cannot be performed, while this method, based on the detection of genetic DNA markers, is not limited by the individual's developmental stage.

[0109] Example 3: Alternative Implementation Scheme for Genetic Sex Identification Method in Horned Salamander

[0110] This embodiment is used to illustrate various alternative implementation schemes that can be adopted in practical applications of the method of the present invention, including different situations such as using alternative detection technologies and alternative sample types.

[0111] 3.1: Detection protocol based on real-time PCR

[0112] The conventional PCR and gel electrophoresis detection in Example 1 were replaced with quantitative real-time PCR (qPCR). A TaqMan probe was designed targeting a 364bp female-specific fragment with the sequence 5′-FAM-AAAGAGTATTCAAAGAAATATTTCTACCCCGAAAATGCG-BHQ1-3′, and a VIC-labeled probe was designed targeting the CO1 internal reference fragment with the sequence 5′-VIC-TGGATGTTGACACTCGTGCT-BHQ1-3′.

[0113] In a qPCR reaction system containing the aforementioned probes and primers, real-time fluorescence detection was performed using the same amplification procedure. Sex was determined by monitoring the fluorescence signal growth in both the FAM and VIC channels: amplification curves in both FAM and VIC channels indicated females, while amplification curves in only the VIC channel indicated males. This method eliminates the electrophoresis step, reduces detection time by approximately 40%, and offers higher sensitivity, making it suitable for high-throughput detection of large-scale samples.

[0114] 3.2: Detection protocols using alternative internal reference genes

[0115] Besides the mitochondrial CO1 gene, the 18S rRNA gene from the horned salvia can also be selected as an internal control for amplification. Specific amplification primers 18S-F and 18S-R (sequences omitted) were designed, with an expected amplification product length of 400 bp. Multiplex PCR was performed using this internal control primer pair in combination with the female-specific primers F1 / R1. After optimization with an annealing temperature gradient (52-58℃), the amplification efficiency of the two primer pairs reached equilibrium at annealing at 56℃. The results showed that female samples amplified double bands of 364 bp and 400 bp, while male samples only amplified a single band of 400 bp, consistent with the results when using the CO1 internal control. In practical applications, suitable internal control genes can be flexibly selected based on the available reagents and instruments in the laboratory.

[0116] 3.3: Detection protocols using different tissue sources

[0117] Without compromising DNA quality, tissues other than the mantle can also be used as test samples. Antennae (approximately 2-3 mg), foot muscle (approximately 5 mg), and mantle (approximately 5 mg) from the horned salamander were collected and processed using the Beyotime Animal Tissue Direct PCR Kit as templates for multiplex PCR amplification. Results showed that the target bands were successfully amplified from templates from all three tissue sources, with consistent sex determination results. The mantle tissue was the preferred sampling site due to its exposed location, ease of handling, and minimal damage to the individual. In special circumstances (such as mantle damage), antennae or foot tissue can be used as effective substitutes; however, it should be noted that foot muscle contains a significant amount of pigment and mucus, and it is recommended to appropriately increase the digestion time or use purified DNA as a template to obtain more stable amplification results.

[0118] 3.4: Detection scheme using alternative primers

[0119] Around the 364 bp female-specific DNA marker region shown in SEQ ID NO:1, alternative primers located inside the original primers F1 / R1 can be designed to achieve specific amplification of this female-specific fragment. For example, using Primer Premier 5.0 software, primer pairs F1-inner (5′-AAAGAGTATTCAAAGAAATATTTCT-3′) and R1-inner (5′-TGTGTCATGTTGTCATATTTC-3′) were redesigned within this marker sequence, with an expected amplification product length of 280 bp. Multiplex PCR was performed using this alternative primer pair in combination with the CO1 internal control primers FCO / RCO. Under the same amplification program (annealing temperature of 52℃), a female-specific 280 bp band and a 557 bp internal control band were also obtained, and the sex determination results were consistent with Example 1. This approach can be used as an alternative when the amplification effect of the original primers is unsatisfactory.

[0120] The above alternative implementation schemes do not depart from the core concept of this invention, which uses the female-specific DNA region shown in SEQ ID NO:1 to identify the genetic sex of horned slugs. After reading the technical solutions disclosed in this invention, those skilled in the art can choose different implementation schemes according to actual conditions without creative labor, and all of them should fall within the protection scope of this invention.

Claims

1. A molecular marker for identifying the genetic sex of a horned salamander, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1.

2. A primer pair for amplifying the molecular marker of claim 1, characterized in that, The primer pair includes an upstream primer F1 and a downstream primer R1, the nucleotide sequence of the upstream primer F1 is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer R1 is shown in SEQ ID NO:

3.

3. A primer combination for identifying the genetic sex of a horned slug snail, characterized in that, The primer combination includes the primer pair and internal reference primer pair as described in claim 2. The internal reference primer pair is a primer pair for amplifying the CO1 gene fragment of the horned salamander, including an upstream primer FCO and a downstream primer RCO. The nucleotide sequence of the upstream primer FCO is shown in SEQ ID NO:4, and the nucleotide sequence of the downstream primer RCO is shown in SEQ ID NO:

5.

4. A multiplex PCR system for identifying the genetic sex of a horned salamander, characterized in that, The multiplex PCR system includes the primer combination described in claim 3, 2×PCR premix, and nuclease-free water.

5. A method for identifying the genetic sex of a horned trevally, characterized in that, Includes the following steps: (1) Extract genomic DNA from the snail to be tested; (2) Using the genomic DNA extracted in step (1) as a template, multiplex PCR amplification was performed using the primer combination described in claim 3; (3) The amplification products from step (2) were detected by agarose gel electrophoresis; (4) Determine the sex based on the electrophoresis results: If a 364 bp female-specific band and a 557 bp CO1 internal reference band are present, the sex is determined to be female; if only a 557 bp CO1 internal reference band is present and no 364 bp female-specific band is present, the sex is determined to be male; if no 557 bp CO1 internal reference band is present, the test is determined to be invalid.

6. The method according to claim 5, characterized in that, The genomic DNA described in step (1) was extracted from the mantle tissue of the horned salvia.

7. The method according to claim 6, characterized in that, The amount of the mantle tissue used was 5 mg.

8. The method according to claim 5, characterized in that, The reaction system for multiplex PCR amplification in step (2) is as follows: total reaction volume 20 μL, including 1 μL DNA template, 10 μL 2×PCR premix, 0.2 μL of 10 μM upstream primer F1, 0.2 μL of 10 μM downstream primer R1, 0.2 μL of 5 μM upstream primer FCO, 0.2 μL of 5 μM downstream primer RCO, and 8.2 μL nuclease-free water.

9. The method according to claim 5, characterized in that, The procedure for multiplex PCR amplification in step (2) is as follows: pre-denaturation at 95℃ for 4 min; denaturation at 95℃ for 30 s, annealing at 54℃ for 15 s, extension at 72℃ for 10 s, for a total of 36 cycles; and finally extension at 72℃ for 4 min.

10. The application of the molecular marker of claim 1, the primer pair of claim 2, the primer combination of claim 3, or the multiplex PCR system of claim 4 in the genetic sex identification of the horned salamander.

Images