Primers and methods for duck gender identification

Abstract

The application provides a primer and a method for gender identification of ducks. A highly conserved candidate sequence is found on the intergenic region of the sex chromosome of the duck, and a primer with a nucleotide sequence as shown in SEQ ID NO: 3-5 is designed according to the candidate sequence. The primer of the application shows good amplification efficiency for various ducks, and the gender identification result is accurate, overcoming the defect that the amplification effect of the existing universal primer is unstable in the duck. Meanwhile, the primer of the application can take the feather and the embryonic tissue of the newly born duckling and the adult duck as the sample source, and is suitable for various development stages from the embryonic period to the adult period. In addition, the gender identification method of the application is simple in operation, short in detection time and low in detection cost, and has a wide application prospect in the duck gender identification in the primary laboratory and the breeding site.

Description

Technical Field

[0001] This invention relates to the technical field of biological detection, specifically to a primer and method for sex determination in ducks. Background Technology

[0002] Ducks are an important waterfowl breed in my country, holding a significant position in the meat duck, egg duck, and breeding duck industries. Early sex determination is crucial for improving breeding efficiency and optimizing population structure in duck farming. For example, in meat duck production, there are significant differences in growth rate and feed conversion ratio between male and female ducks; early separation allows for precise nutritional regulation. In breeding duck selection, timely sex identification of ducklings helps shorten the selection cycle and improve the efficiency of core flock establishment. In molecular breeding, accurate sex information is a prerequisite for conducting genetic analysis of sex-related traits. Therefore, establishing a rapid, accurate, low-cost, and widely applicable duck sex determination technology is of great significance for promoting the modernization of the duck industry.

[0003] Currently, duck sex determination mainly relies on the traditional manual cloacal examination method and the molecular biology-based PCR detection method. The traditional cloacal examination method primarily determines sex by observing the morphological characteristics of the duckling's cloaca. While this method does not require special equipment, it has significant drawbacks: First, it demands a high level of skill and experience from the operator, and the accuracy is greatly affected by human factors, resulting in a high error rate in large-scale production and potentially leading to serious economic losses. Second, the procedure can easily cause stress and mechanical damage to ducklings, affecting their subsequent growth and development. Third, it is only applicable to ducklings within a short period after hatching and cannot be used for sex determination in adult ducks, thus limiting its application.

[0004] With the development of molecular biology techniques, PCR-based sex determination methods based on sex chromosome differences have gradually become a research hotspot. The sex determination system in birds is ZW-type, with females being ZW and males ZZ. The chromosome helicase-DNA-binding protein 1 (CHD1) gene is located on both the Z and W sex chromosomes. Due to the length polymorphism of the CHD1 gene in the intron regions on the Z and W chromosomes, sex determination can be performed by PCR amplification combined with agarose gel electrophoresis. Female individuals (ZW) can simultaneously amplify both the CHD1-Z and CHD1-W bands, while male individuals (ZZ) only amplify the single CHD1-Z band. Due to its high conservation, the CHD1 gene has been widely used for molecular sex determination in various bird species.

[0005] However, existing PCR sex determination techniques based on the CHD1 gene still have the following problems in practical applications with ducks: (1) The applicability of existing universal primers to ducks needs to be improved. Although commonly used bird sex identification primers (such as P2 / P8, 2550F / 2718R, etc.) are universal in a variety of birds, their amplification effect in ducks is unstable. Studies have found that the classic primers P2 / P8, 1237L / 1272H and 2550F / 2718R have defects in duck sex identification. For this reason, HPF / HPR primers were specially designed for duck sex identification (PMID: 25895514); Liu Hongxiang et al. also designed gCHD universal primers for sex identification of major birds (Liu Hongxiang, Hu Yan, Ji Gaige, et al. A new pair of universal primers for rapid identification of sex of major birds [J]. Journal of Agricultural Biotechnology, 2014, 22(12):1567-1574.). However, there is still room for improvement in the amplification efficiency and specificity of these primers in different duck breeds, which may lead to low amplification efficiency, unclear bands, or non-specific amplification, affecting the accuracy of the identification results.

[0006] (2) Existing methods are limited to targets of known genes. Since Ellegren first located the CHD1 gene on the W chromosome in 1996, for nearly 30 years, the targets of molecular sex determination methods for birds have always been concentrated on the coding regions or intron sequences of known genes (such as CHD1, SPIN, NIPBL, RASA1, etc.). When Kroczak et al. proposed a multi-marker strategy, all the markers used were still intragenic sequences. However, the intron length polymorphism of known genes varies greatly among different bird groups, and the length difference between Z and W chromosomes is small in some species (usually 120-180 bp), making electrophoretic interpretation difficult. In addition, gene coding regions are constrained by function, and the space for sequence variation is limited. In contrast, the intergenic regions on sex chromosomes are not constrained by coding function, and their evolutionary rate is different from that of gene introns. They may have a wider range of length polymorphisms, providing an untapped sequence space for the development of new sex-specific markers. However, intergenic regions have long been regarded as non-functional "junk DNA," and researchers have rarely been able to screen out molecular markers suitable for sex identification from them.

[0007] Therefore, there is an urgent need to develop a duck sex identification method that has high primer specificity, simple sample pretreatment, low detection cost, and is suitable for grassroots promotion, so as to meet the actual needs of early duck sex identification, breeding duck selection and molecular breeding. Summary of the Invention

[0008] To overcome the aforementioned defects and shortcomings in the existing technology, the present invention provides a primer and method for sex identification in ducks.

[0009] The first objective of this invention is to provide a primer set for sex identification in ducks.

[0010] A second objective of this invention is to provide a kit for sex determination in ducks.

[0011] A third objective of this invention is to provide the application of the above-described primer set and / or kit in duck sex identification or in the preparation of products for duck sex identification.

[0012] A fourth objective of this invention is to provide the application of the above-described primer sets and / or kits in the selection and / or molecular-assisted breeding of ducks.

[0013] The fifth objective of this invention is to provide a method for sex determination in ducks.

[0014] A sixth objective of this invention is to provide the application of the above-described method in the selection and / or molecular-assisted breeding of ducks.

[0015] This invention claims protection for the following: A primer set for sex determination in ducks, the primer set comprising primers with nucleotide sequences as shown in SEQ ID NO: 3-5.

[0016] A kit for sex determination in ducks, comprising the primer set described above.

[0017] Preferably, the kit further includes DNA extraction reagents and / or PCR amplification reagents.

[0018] As one possible approach, the DNA extraction reagent includes sodium hydroxide lysis buffer and / or TE buffer.

[0019] As one possible approach, the PCR amplification reagents include PCR premix and / or ddH2O.

[0020] The application of the above-mentioned primer sets and / or kits in duck sex identification or in the preparation of duck sex identification products.

[0021] Preferably, the duck is a domestic duck.

[0022] More preferably, the duck includes Shaoxing duck, Fenghua water duck and / or Jinyun Ma duck.

[0023] Preferably, the duck sex identification is performed by using a primer set or kit to perform PCR amplification on the duck sample to be tested. If the PCR amplification product shows only one 446 bp band after electrophoresis, it is determined to be a male duck. The PCR amplification product showed two bands of 446 bp and 237 bp, or only one band of 237 bp, when detected by electrophoresis, and was identified as a female duck.

[0024] As one possible approach, the duck sample to be tested includes tissue or feathers containing pith.

[0025] The application of the above-mentioned primer sets and / or kits in duck breeding and / or duck molecular-assisted breeding.

[0026] Preferably, the molecular-assisted breeding is sex-based molecular-assisted breeding.

[0027] A method for sex determination in ducks includes the following steps: Using the genomic DNA of the duck to be tested as a template, PCR amplification was performed using the above-mentioned primer set. The PCR amplification product was detected by electrophoresis and showed only one 446 bp band, which indicated that it was a male duck. The PCR amplification product showed two bands of 446 bp and 237 bp, or only one band of 237 bp, when detected by electrophoresis, and was identified as a female duck.

[0028] Preferably, the PCR amplification system comprises 6–6.5 μL of PCR premix, 0.3–0.7 μL of primers with nucleotide sequences as shown in SEQ ID NO: 3, 0.2–0.3 μL each of primers with nucleotide sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5, 0.5–1.5 μL of genomic DNA of the duck to be tested, and 4–4.5 μL of ultrapure water.

[0029] More preferably, the PCR amplification system comprises 6.25 μL of PCR premix, 0.5 μL of primers with nucleotide sequences as shown in SEQ ID NO: 3, 0.25 μL each of primers with nucleotide sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5, 1 μL of genomic DNA of the duck to be tested, and 4.25 μL of ultrapure water.

[0030] Preferably, the PCR amplification program is as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0031] The above methods are applied in the selection and / or molecular-assisted breeding of ducks.

[0032] Preferably, the molecular-assisted breeding is sex-based molecular-assisted breeding.

[0033] Compared with the prior art, the present invention has the following beneficial effects: This invention provides primers and a method for sex determination in ducks. The invention identifies a highly conserved candidate sequence in the intergenic region of the duck's sex chromosomes and designs primers with nucleotide sequences as shown in SEQ ID NO: 3-5 targeting this candidate sequence. The primers of this invention exhibit good amplification efficiency for various duck species, providing accurate sex determination results and overcoming the instability of existing universal primers in ducks. Furthermore, the primers of this invention can utilize feathers from newborn ducklings and adult ducks, as well as embryonic tissue, making them suitable for all developmental stages from embryonic to adulthood. In addition, the sex determination method of this invention is simple to operate, has a short detection time, and low detection cost, showing broad application prospects in duck sex determination in grassroots laboratories and breeding fields. Attached Figure Description

[0034] Figure 1 The sequence alignment results are for multiple candidate sites in the intergenic region of the duck W chromosome.

[0035] Figure 2 Electrophoretic pattern of PCR amplification products of feathers from Shaoxing female ducks.

[0036] Figure 3 Electrophoretic pattern of PCR amplification products of Fenghua duck feathers.

[0037] Figure 4 Electrophoretic pattern of PCR amplification products of Shaoxing duckling feathers.

[0038] Figure 5 Electrophoretic pattern of PCR amplification products from the kidney tissue of Jinyun Ma duck embryos.

[0039] Figure 6 Electrophoretic pattern of PCR amplification products of Shaoxing duck feathers. Detailed Implementation

[0040] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0041] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0042] Example 1: A primer for sex determination in ducks Integrating high-precision T2T genomic data of duck W chromosome (IASCAAS_PekinDuck_T2T, NCBI accession number GCF_047663525.1) and W chromosome-related gene annotation information, through sequence alignment and phylogenetic analysis, a highly conserved candidate sequence was identified in the intergenic region between the LOC119714316 gene (NC_092620.1: 14815754 bp~14817581 bp) and the LOC101799270 gene (NC_092620.1: 14868142 bp~14928248 bp, complementary strand) on the W chromosome. Figure 1 ).

[0043] The intergenic region is located on chromosome W, between approximately 14,817,581 bp and 14,868,142 bp, with a total length of approximately 50.6 kb. The candidate sequence is 237 bp long on chromosome W (SEQ ID NO: 1), and a homologous sequence of 446 bp long exists on chromosome Z (SEQ ID NO: 2), showing a length difference of 209 bp between the two.

[0044] AAGTTACTTCCTTGATCAGAGTCAACATTTCAATGATTACATACCTGGAAATTATCTGTTCTGGAATTACCTTAGCTACCACACTCACAGTAGCATATACCGAAGGGAAAACTTTCACCCACCATGACAAGTGATGGACTTTAAACTTTAATTAAACTTTAATCTTGCTTATCATAAGCAGGGTTTTTCTGGAGATAAACTCTTTTCTATGGCACTATAGCTAGTACTTCCTTTT (SEQ ID NO: 1); AAGTGACTTCCTTGATCAGAGTCAATATTTTCAATGATCCTGGAGCTGGGAATTATCTGCTCTAGAATTACCTTAGCTACTGTGCTCACAGTAGCAGATACAGAATGGCAAACTTTCACCTGCCCCGAGACATGATCGACCAAGACTAATAAGTATGTAAATCTACCTACTCTAGGGAGTTCTGCAAAAACTACCCATACGCTTTGGAAGGGTTGAATTCCTGGG TATTGCCTCCCTTTAGGATGTCTGTGGATAATTTTCCTATTTACCTTTTGACATACTACACAACTCCTGCATACTTGTTTAGCCAGATACGTATTTCCATAGCACAATGTGTGGATCACACATTGCTTGAACTCCCCAGTGACTCCCTCGATATAAAATAGTTCATATCAGTGCTTTATTTGGCATTTAAGAGACAACCAGTTTGTCTTCTGAGCATATGC (SEQ ID NO: 2).

[0045] Further analysis revealed a difference in the 5th base position (G on chromosome Z, T on chromosome W) between the homologous sequence on chromosomes Z and W. Based on this, a degenerate upstream primer (PF) and two specific downstream primers (PRW and PRZ) were designed. The specific primer sequences are as follows: Merged upstream primer (PF): 5'-AAGTKACTTCCTTGATCAGAGTCAA-3' (SEQ ID NO: 3), where K is G or T; W chromosome downstream primer (PRW): 5'-AAAAGGAAGTACTAGCTATAGTGCC-3' (SEQ ID NO: 4); Z chromosome downstream primer (PRZ): 5'-GCATATGCTCAGAAGACAAACTGG-3' (SEQ ID NO: 5).

[0046] After amplification using the combined upstream primer (PF) and two specific downstream primers (PRW and PRZ), the PCR amplification product of male ducks showed only one 446 bp band when detected by electrophoresis; the PCR amplification product of female ducks showed two bands of 446 bp and 237 bp, or only one 237 bp band when detected by electrophoresis.

[0047] Example 2: Identification of Shaoxing ducks of known sex I. Experimental Methods Feathers were collected from the wings of eight adult female Shaoxing ducks. 120 μL of 50 mM sodium hydroxide lysis buffer was added to the root tissue of the feathers, and the mixture was digested at 95 °C for 25 min. Then, 30 μL of TE buffer (pH 8.0) was added for neutralization. The mixture was centrifuged at 13,000 rpm for 1 min, and the supernatant was collected to obtain the crude genomic DNA extract.

[0048] PCR reaction system (12.5 μL): 6.25 μL of 2×PCR premix (Nanjing Novizan Biotechnology Co., Ltd.), 0.5 μL of 10 μmol / L upstream primer (SEQ ID NO: 3), 0.25 μL each of two 10 μmol / L downstream primers (SEQ ID NO: 4 and SEQ ID NO: 5), 1 μL of crude genomic DNA extract, and 4.25 μL of ultrapure water.

[0049] PCR reaction program: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0050] After the PCR reaction was completed, the PCR products were detected by 1.5% agarose gel electrophoresis (w / v).

[0051] II. Experimental Results The results are as follows Figure 2 As shown, the three primers produced two bands after PCR amplification. One band, with a length of 237 bp, was obtained by amplification using the degenerate upstream primer (PF) shown in SEQ ID NO:3 and the W chromosome downstream primer (PRW) shown in SEQ ID NO:4. The other band, with a length of 446 bp, was obtained by amplification using the degenerate upstream primer (PF) shown in SEQ ID NO:3 and the Z chromosome downstream primer (PRZ) shown in SEQ ID NO:5.

[0052] The PCR identification results were consistent with the individual sex records, all indicating that the ducks were female.

[0053] Example 3: Identification of the sex of Fenghua ducks I. Experimental Methods Feathers were collected from 11 adult Fenghua ducks, numbered 1-5 as males and 6-11 as females. PCR amplification was performed using primers designed in Example 1 (SEQ ID NO: 3-5).

[0054] Meanwhile, the primers in Chinese invention patent CN102618659A were used as a control group for PCR amplification, and their primer sequences are shown in SEQ ID NO: 6 and SEQ ID NO: 7: Upstream primer: 5'-AGTGCATTGCAGAAGCAATATT-3' (SEQ ID NO: 6); Downstream primer: 5'-GCCTCCTGTTTATTATAGAATTCAT-3' (SEQ ID NO: 7); After amplification using the primers shown in SEQ ID NO: 6-7, the PCR amplification product of male ducks showed only one 495 bp band when detected by electrophoresis; the PCR amplification product of female ducks showed two bands of 495 bp and 351 bp when detected by electrophoresis.

[0055] The preparation of crude genomic DNA extract, PCR amplification, and electrophoresis detection were all performed according to Example 2.

[0056] II. Experimental Results The results are as follows Figure 3 As shown, the results of identification using primers (SEQ ID NO: 3-5) designed in Example 1 were completely consistent with the individual sex records, with numbers 1-5 being male ducks and 6-11 being female ducks.

[0057] In the control group, only samples 6-11 amplified a single band, and this band was close to the 500 bp DNA standard band, making it difficult to accurately determine its fragment size; samples 1-5 did not amplify any bands. These results indicate that the primers shown in SEQ ID NO: 6-7 have unsatisfactory amplification effects in Fenghua ducks and cannot achieve effective sex identification.

[0058] Example 4: Identification of newborn Shaoxing ducklings of unknown sex I. Experimental Methods Tail feathers were collected from 11 newly hatched Shaoxing ducklings (sex unknown), and PCR amplification was performed using primers (SEQ ID NO: 3-5) designed in Example 1.

[0059] Meanwhile, control group 1 and control group 2 were set up. The primers for control group 1 were those in Chinese invention patent CN121852525A, and their primer sequences are shown in SEQ ID NO: 8 and SEQ ID NO: 9. Upstream primer: 5'-TCCTGGGAAGATTTTGA-3' (SEQ ID NO: 8); Downstream primer: 5'-GTTAAAATCCACCTATG-3' (SEQ ID NO: 9); After amplification using the primers shown in SEQ ID NO: 8-9, the PCR amplification product of male ducks showed only one 507 bp band when detected by electrophoresis; the PCR amplification product of female ducks showed two bands of 507 bp and 363 bp when detected by electrophoresis.

[0060] The primers for control group 2 are those in Chinese invention patent CN112662787A, and their primer sequences are shown in SEQ ID NO: 10 and SEQ ID NO: 11: Upstream primer: 5'-ATGAAAGAGTTTCAGCACTTGA-3' (SEQ ID NO: 10); Downstream primer: 5'-TTCATAATAGGAGCTCGAGCCA-3' (SEQ ID NO: 11); After amplification using the primers shown in SEQ ID NO: 10-11, the PCR amplification product of male ducks showed only one 1147 bp band when detected by electrophoresis; the PCR amplification product of female ducks showed two bands of 1147 bp and 851 bp when detected by electrophoresis.

[0061] The preparation of crude genomic DNA extract, PCR amplification, and electrophoresis detection were all performed according to Example 2.

[0062] II. Experimental Results The results are as follows Figure 4 As shown, using primers designed in Example 1 (SEQ ID NO: 3-5) for identification, ducks 1, 7, 8, 10, and 11 were identified as male ducks, while ducks 2-6 and 9 were identified as female ducks. Verification through anatomical observation of the gonadal organs confirmed that the above sex identification results were completely consistent with the true sex, achieving an accuracy rate of 100%.

[0063] In both control groups 1 and 2, no specific bands were observed in the PCR amplification products upon electrophoresis.

[0064] The above results indicate that the primers designed in Example 1 (SEQ ID NO: 3-5) have high amplification efficiency for crude templates extracted by alkaline lysis and can effectively identify the sex of ducklings, while the primers shown in SEQ ID NO: 8-11 cannot effectively identify the sex of ducklings.

[0065] Example 5: Identification of kidney tissue from Jinyun Ma duck embryos of unknown sex I. Experimental Methods Kidney tissues from Jinyun Ma duck embryos of unknown sex were collected for sex identification. A total of 16 samples were tested, and PCR amplification was performed using primers designed in Example 1 (SEQ ID NO: 3-5).

[0066] The preparation of crude genomic DNA extract, PCR amplification, and electrophoresis detection were all performed according to Example 2.

[0067] II. Experimental Results The results are as follows Figure 5 As shown, ducks numbered 1, 2, 7, 14, 15, and 16 are male ducks, while ducks numbered 3-6 and 8-13 are female ducks.

[0068] Example 6 Accuracy Test I. Experimental Methods Feathers were collected from 38 adult Shaoxing ducks, numbered 1-20 as males and 21-38 as females. PCR amplification was performed using primers designed in Example 1 (SEQ ID NO: 3-5). The preparation of crude genomic DNA extract, PCR amplification, and electrophoresis detection were all performed according to Example 2.

[0069] II. Experimental Results The results are as follows Figure 6 As shown, ducks numbered 1-20 are male, and ducks numbered 21-38 are female. The PCR identification results are consistent with the individual sex records, further demonstrating the high reliability of the sex detection primers.

[0070] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A primer set for sex determination in ducks, characterized in that, The primer set includes primers with nucleotide sequences as shown in SEQ ID NO: 3-5.

2. A reagent kit for sex determination in ducks, characterized in that, Includes the primer set as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, The kit also includes DNA extraction reagents and / or PCR amplification reagents.

4. The use of the primer set according to claim 1 and / or the kit according to any one of claims 2 to 3 in duck sex identification or in the preparation of products for duck sex identification.

5. The application according to claim 4, characterized in that, The duck in question is a domestic duck.

6. The application according to claim 4, characterized in that, The duck sex determination method is as follows: PCR amplification is performed on the duck sample to be tested using primer sets or kits. If the PCR amplification product shows only one 446 bp band after electrophoresis, it is determined to be a male duck. The PCR amplification product showed two bands of 446 bp and 237 bp, or only one band of 237 bp, when detected by electrophoresis, and was identified as a female duck.

7. The application according to claim 6, characterized in that, The duck samples to be tested include tissue or feathers containing pith.

8. The application of the primer set according to claim 1 and / or the kit according to any one of claims 2 to 3 in the breeding of ducks and / or molecular-assisted breeding of ducks.

9. A method for determining the sex of ducks, characterized in that, Includes the following steps: Using the genomic DNA of the duck to be tested as a template, PCR amplification was performed using the primer set described in claim 1. The PCR amplification product was detected by electrophoresis and showed only one 446 bp band, which indicated that it was a male duck. The PCR amplification product showed two bands of 446 bp and 237 bp, or only one band of 237 bp, when detected by electrophoresis, and was identified as a female duck.

10. The application of the method of claim 9 in the selection and / or molecular-assisted breeding of ducks.

Images