A reagent for detecting progressive familial intrahepatic cholestasis and use thereof

Abstract

The application discloses a reagent for detecting progressive familial intrahepatic cholestasis and application thereof, and belongs to the technical field of biological medicine. The reagent comprises a primer group for detecting a TNS1 gene mutation, the TNS1 mutant gene has a c.2575C>T mutation, and the wild type TNS1 gene sequence corresponding to the TNS1 mutant gene is shown in GenBank accession number NM_022648.7. It is found for the first time that the TNS1 mutant gene or the mutant protein coded by the TNS1 mutant gene can cause the progressive familial intrahepatic cholestasis, and is closely related to the onset of the progressive familial intrahepatic cholestasis. By detecting whether the biological sample carries the TNS1 mutant gene, whether a subject carries the TNS1 mutant gene can be effectively detected, and a carrier or a patient of a pathogenic gene mutation causing the progressive familial intrahepatic cholestasis can be screened or diagnosed.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a reagent for detecting progressive familial intrahepatic cholestasis and its application. Background Technology

[0002] Progressive familial intrahepatic cholestasis (PFIC) is a rare group of autosomal recessive inherited liver diseases, primarily caused by dysfunction of bile acid transport proteins on the capillary lateral membrane of hepatocytes or abnormalities in bile composition. Typical clinical manifestations of PFIC include jaundice onset in infancy, severe pruritus, significantly elevated serum total bile acids (TBA), steatorrhea, and growth retardation. Without timely intervention, the disease often rapidly progresses to liver fibrosis and even end-stage liver disease, seriously threatening the life and health of affected children. Currently, the internationally identified pathogenic genes for PFIC are mainly located at ATP8B1, ABCB11, and ABCB4, which encode transmembrane proteins involved in phospholipid transport and bile acid secretion, respectively. Targeted sequencing or panel sequencing based on these genes has become a major molecular tool for the clinical auxiliary diagnosis of PFIC. However, epidemiological statistics and clinical genetic studies show that a considerable proportion of patients with typical clinical manifestations still cannot obtain a clear molecular diagnosis, indicating that the current technology does not fully understand the pathogenic gene spectrum of PFIC.

[0003] In recent years, research on the TNS1 gene has mainly focused on areas such as tumor invasion and metastasis, embryonic development, and maintenance of cardiomyocyte structure. Current technologies do not report any function of the TNS1 gene in hepatic bile acid metabolism, maintenance of capillary bile duct structural integrity, or establishment of hepatocyte polarity, nor are there any records of linking TNS1 gene mutations to hepatobiliary hereditary diseases such as PFIC. Summary of the Invention

[0004] The purpose of this invention is to provide a reagent for detecting progressive familial intrahepatic cholestasis of disease and its application. This invention discovers a novel TNS1 mutant gene, which can be used as a screening and diagnostic site for progressive familial intrahepatic cholestasis of disease, distinguishing patients, carriers and normal populations, guiding precise treatment for patients and eugenics for patients and carriers.

[0005] To achieve the above objectives, the present invention provides the following solution: A reagent for diagnosing and / or screening progressive familial intrahepatic cholestasis, the reagent comprising a primer set for detecting TNS1 gene mutations having a c.2575C>T mutation, the wild-type TNS1 gene sequence corresponding to the TNS1 mutation being available in GenBank accession number NM_022648.7.

[0006] Preferably, the primer set for detecting TNS1 gene mutations includes a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.4; and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5.

[0007] The present invention also provides the application of the reagents described herein in the preparation of a molecular genetic testing kit for progressive familial intrahepatic cholestasis.

[0008] The present invention also provides the application of the reagents in the preparation of a prenatal diagnostic kit for progressive familial intrahepatic cholestasis.

[0009] The present invention also provides the use of the reagents described herein in the preparation of a kit for prognostic assessment of progressive familial intrahepatic cholestasis.

[0010] The present invention also provides a kit for diagnosing and / or screening progressive familial intrahepatic cholestasis, comprising the aforementioned reagent.

[0011] This invention also provides a method for detecting TNS1 mutations in progressive familial intrahepatic cholestasis for non-diagnostic purposes, comprising the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the genomic DNA extracted in S1 as a template, perform PCR amplification and purification to obtain the purified PCR product. S3. Using the purified product obtained in S2 as a template, a sequencing reaction was performed using sequencing primers. The sequencing results were compared with the wild-type TNS1 gene sequence to determine whether a mutation exists.

[0012] This invention also provides a method for constructing an animal model of progressive familial intrahepatic cholestasis, comprising the following steps: Animals were administered an AAV8 virus carrying the TNS1 mutant gene; the animals were induced to develop a progressive familial intrahepatic cholestasis phenotype by feeding them a bile acid diet.

[0013] Preferably, the TNS1 mutant gene has a c.2575C>T mutation, and the wild-type TNS1 gene sequence corresponding to the TNS1 mutant gene can be found in GenBank accession number NM_022648.7.

[0014] The present invention also provides the application of animal models constructed using the method in screening drugs for the treatment of progressive familial intrahepatic cholestasis.

[0015] The present invention discloses the following technical effects: This invention discloses a reagent for detecting progressive familial intrahepatic cholestasis of disease (PCC) and its application. The TNS1 mutant gene, in the nucleotide sequence coding region of GenBank accession number NM_022648.7, has a base position 2575 changed from C to T. This is a missense mutation, resulting in the amino acid position 859 of the encoded protein changing from arginine (Arg, R) to tryptophan (Trp, W), denoted as p.R859W. This invention is the first to discover that the TNS1 mutant gene or its encoded mutant protein can cause PCC and is closely related to its pathogenesis. By detecting whether a biological sample carries the TNS1 mutant gene, it is possible to effectively detect whether a subject carries the above mutation, which can be used to screen or diagnose carriers or patients of the pathogenic gene mutation leading to PCC, providing a basis for eugenics and early treatment intervention. Furthermore, this invention provides potential directions for exploring drug targets for this disease and lays an important foundation for in-depth research on its pathogenesis. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 A family pedigree of progressive familial intrahepatic cholestasis type II; Figure 2 The image shows the results of Sanger sequencing of the TNS1:NM_022648.7 gene c.2575C>T genotype in the family. In the image, the father and mother of the affected child are both heterozygous for the c.2575C>T mutation, while the child is homozygous for the c.2575C>T mutation (the arrows in the sequencing image indicate the location of the mutation). Figure 3 For cells to overexpress TNS1 R859W The effect on bile acid excretion is shown in Figure A, where A represents the bile acid excretion index (BEI) and B represents TNS1. WT Cells were stained with Tauro-nor-THCA-24-DBD, with C representing TNS1. R859WTauro-nor-THCA-24-DBD staining of cells, where D represents the quantification of the area of ​​the immunofluorescence signal; Figure 4 TNS1 overexpression in the liver R859W The effect on intrahepatic cholestasis in mice was investigated. In this study, A represents the appearance of the liver and its histological staining with HE Sirius red, while B represents the biochemical indicators of serum and liver tissue. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] The specific sources of the experimental materials are as follows: 1. Cells and Animals: Six-week-old SPF-grade C57BL / 6 mice were purchased from Chengdu Yaokang Biotechnology Co., Ltd. (Chengdu, China) and housed in the SPF-grade housing of the Experimental Animal Center of Chongqing Medical University; PHH mice were purchased from Liver Biotech (Shenzhen, China).

[0024] 2. Main Reagents and Kits: Total bile acid (TBA) kit, total bilirubin (T-BIL) kit, direct bilirubin (D-BIL) kit, alkaline phosphatase (ALP / AKP) assay kit, aspartate aminotransferase (AST / GOT) kit, and alanine aminotransferase (ALT / GPT) kit were all purchased from Nanjing Jiancheng Biotechnology Institute (Nanjing, China); the total bile acid (TBA) content detection kit was purchased from Solarbio (Beijing, China); taurine deoxycholic acid (Tauro-nor-THCA-24-DBD) was purchased from Shanghai Nafu Biotechnology Co., Ltd. (Shanghai, China). 1% CA feed was purchased from Shuyi Shuer Biotechnology Co., Ltd. (Changzhou, China).

[0025] Whole exome sequencing was performed by Crystal Biotech (Shanghai) Co., Ltd.; Sanger sequencing was performed by Crystal Biotech (China) Co., Ltd.; and all lentivirus packaging and construction were performed by Genecast (China, Shanghai).

[0026] Example 1 1. Sample Acquisition The inventors discovered a family with progressive familial intrahepatic cholestasis of blood type II. Clinical information of some members of this family is shown in Table 1. The family pedigree is as follows: Figure 1 As shown, where, Indicates male carrier, Indicates female carrier, This refers to the sick child.

[0027] Table 1. Clinical information of family members with progressive familial intrahepatic cholestasis of disease type II Peripheral blood samples of 1 mL were collected from each of the clinically diagnosed family members mentioned above and placed in EDTA anticoagulant tubes. Informed consent was obtained from all study subjects or their legal guardians.

[0028] 2. Exon sequencing (1) DNA extraction and quality control: For peripheral blood samples, DNA was extracted using the QIAamp DNA Blood Maxi Kit (51194, Qiagen), and the DNA concentration was precisely quantified using the Qubit dsDNA BR Assay Kit (Q32853, Thermo Fisher) on a Qubit 4.0 Fluorometer. At the same time, the integrity of the DNA was assessed by 1% agarose gel electrophoresis.

[0029] (2) DNA fragmentation: Take 1 μg of qualified genomic DNA and use a Bioruptor ultrasonic disruptor (Diagenode, Belgium) to randomly break it into fragments with an average fragment length of about 200 bp.

[0030] (3) End repair, dA tail addition, and adapter ligation: The fragmented DNA obtained in step (2) was first purified using AMPureXP magnetic beads (Beckman Coulter Inc, Brae, CA, USA) to remove small fragment products. Subsequently, following the instructions of the KAPA library preparation kit (Kapa, ​​Inc.), the purified DNA underwent three enzymatic reactions: end repair, 3' end dA tail addition, and ligation with Illumina platform paired-end index adapters. After all reactions were completed, the product was purified again using AMPureXP magnetic beads.

[0031] (4) Library amplification and purification: The ligation product was subjected to minimal PCR cycling. After amplification, the amplified library was quantified using a Qubit 4.0 Fluorometer (Thermo Fisher, Germany).

[0032] (5) Exon capture: Multiple quantified libraries were pooled and liquid-phase hybridization was performed using the Twist 36.6M (TWIST Inc.) Exon capture kit to enrich the target exon regions. After capture, the captured libraries were analyzed and evaluated using an Agilent 2100 Bioanalyzer, and their DNA concentration was determined using a Qubit 4.0 Fluorometer (Thermo Fisher, Germany).

[0033] (6) Sequencing: The quality-tested capture library was sequenced on the NovaSeq 6000 sequencing platform (Illumina, Inc.) using paired-end sequencing mode with a read length of 2×150bp to obtain raw sequencing data for subsequent analysis. Data statistics and analysis: Valid sequencing data from quality control were aligned to the reference genome (hg19 build (UCSC)) using the BWA mem algorithm. Alignment results were sorted using Sentieon sort, and repetitive sequences were marked using Sentieon Dedup. Insertion lengths were estimated and distribution maps were plotted using InsertSizeMetricAlgo. Sequencing data alignment was statistically analyzed for each sample's BAM file.

[0034] The main components of mutation screening based on sequencing results include: dynamically removing adapter sequence fragments and low-quality fragments from the 3' end of sequencing data using Skewer software; screening for autosomal recessive mutations based on family history; removing polymorphisms and synonymous mutations, leaving non-synonymous mutations; using bioinformatics websites such as SIFT_pred, Polyphen2-HDIV_pred, Polyphen2-HVAR_pred, LRT_pred, MutationTaster_pred, MutationAssessor_pred, FATHMM_pred, PROVEAN_pred, and fathmm-MKL_coding_pred to predict the pathogenicity of mutations; and comprehensively screening for suspicious mutations based on patient clinical symptoms and related gene functions for mutation verification and family analysis.

[0035] The final result identified a TNS1 mutant gene causing progressive familial intrahepatic cholestasis of disease. The cDNA sequence of the wild-type TNS1 gene is available in GenBank accession number NM_022648.7. This mutation corresponds to rs61746994 in the dbSNP database (based on G>A on the positive strand of the GRCh38 genome). The local nucleotide sequence containing the G>A mutation site on the positive strand of the GRCh38 genome is shown in SEQ ID NO.1, and the genomic sequence is shown in SEQ ID NO.6. Since the TNS1 gene is located on the negative strand of the chromosome, this genomic change is mapped to the reference transcript NM_022648.7 as c.2575C>T, i.e., the 2575th base changes from cytosine (C) to thymine (T). The local nucleotide sequence containing the c.2575C>T mutation site is shown in SEQ ID NO.2. This mutation causes the 859th codon of the encoded protein to change from CGG (arginine, Arg) to TGG (tryptophan, Trp), namely the p.Arg859Trp (p.R859W) missense mutation (SEQ ID NO.3), where, SEQ ID NO.1 (underlined bases are mutation sites): TGGCTCCTCCTCTGGAGTCC A GGAGGGGTC.

[0036] SEQ ID NO.2 (underlined bases are mutation sites): GACCCCTCC T GGACTCCAGAGGAGGAGCCA.

[0037] SEQ ID NO.3 (underlined amino acids indicate mutation sites): DPSW TPEEEP。

[0038] SEQ ID NO.6: >2 dna:chromosome chromosome:GRCh38:2:217847167:217847967:1。

[0039] TAAGCTTTGCTTTCCCAGGCTCTGGGATCTTGGTCCCACCTCTGTCACCGTACACATTACTCTCTAATGAAATCATCTGTCTGTGTATCTGTCCGCTCACTAGACTGTAAATTTCTTGAGGGCAGGAATTGCTTGACATTGAACTTTGAAACTTGGTGTCTGGCTTGGTGCCTATCAGACAATGAATGCAGGAAGGGATAACTGGCTAGCATATAGGCTCCTGAGAGCCTCCTCCCACCAGTGAAAGCAACATCTGCTTAGGGGTCATGGCTGGACCTGCACCTCCCCCCAGCAAGACCAAATAAGGAAGGGGTAGAAGGAGTCAGGACTGAATACCTCTTACCTGCTACCCTGTGGGCCACCAGCCCTTCTAAATTCAATGGCTCCTCCTCTGGAGTCC G GGAGGGGTCTGAAGTCGCTTCCTTTGGTGAGAGCAGAGGCTGAGCAGTGAGGCCAGGGAGAGAGGCTGGGGGTTGCTGAGGCCCTGGAGGGCTGTGGGTGGTCGGAAGGAAGGCAGGCAAGGAGGAAGAGGCTGGGCTCTTTGAATGGAAATCCTGGTTAGGCCCAGCCAAACATGGCTGATAGTCATAAGGTGAGTAAGACCTGCCAGGAGGGACAGACTCCAGAGAGGCCCGTGGGGCTGGCTCAGGGGTTCCCAACGAATGCCCACTGGGGATATAGCCAGATCTGGACTGGGTCAGTGGATGGGACTGACGGGAGGATCCAGAGAGGGGCTGGGAGGAGAGTGGAGAAGCCCCTGGCCAGGCCCCGGGGACACTCTGGGACTTGTGTAGTGGGGCA。

[0040] Sanger sequencing was performed on the above-mentioned family members to verify the c.2575C>T mutation site in the TNS1 gene. Using extracted genomic DNA as a template, PCR amplification was performed using specific primers (forward and reverse primers). The polymerase chain reaction (PCR) reaction system was 25 μL, specifically: 22 μL Golden Star T6 Super PCR Mix, 1 μL forward primer (10 μmol / L), 1 μL reverse primer (10 μmol / L), and 1 μL DNA template.

[0041] PCR cycling parameters: PCR amplification was performed on a thermal cycler according to the following program: 98℃ pre-denaturation for 2 min, 1 cycle; 35 amplification cycles were performed, each cycle consisting of denaturation at 98℃ for 10 s, annealing at 56℃ for 10 s, and extension at 72℃ for 10 s; after amplification, a final extension at 72℃ for 2 min was performed, 1 cycle; after the reaction was completed, the product was stored at 4℃.

[0042] PCR amplification product detection: After the PCR reaction, 2 μL of the amplification product was taken for agarose gel electrophoresis. The specific procedure is as follows: The sample was added to the well of a 1% agarose gel (with nucleic acid dye pre-added during gel preparation), and a DNA molecular weight standard (marker) was added as a reference. Electrophoresis was performed at a constant voltage of 110 V for 20-30 min. After electrophoresis, the gel was observed, photographed, and the results were recorded under a gel imaging system. Based on the brightness of the electrophoretic bands, the PCR products with higher brightness were selected and sent to the sequencing department of Qingke Biotechnology for bidirectional genome sequencing. The sequencing primers were the same as the forward amplification primers. The forward amplification primer sequence is shown in SEQ ID NO.4, and the reverse amplification primer sequence is shown in SEQ ID NO.5.

[0043] SEQ ID NO. 4: 5'-ATCTTGGTCCCACCTCTGTCA-3'.

[0044] SEQ ID NO. 5: 5'-GATTTCCATTCAAAGAGCCCA-3'.

[0045] Sequencing results as follows Figure 2 As shown.

[0046] Depend on Figure 2Sanger sequencing was performed on the proband and their parents at the c.2575C>T site of the TNS1 gene to verify this finding. The sequencing results showed that the proband had a homozygous c.2575C>T mutation (the sequencing peak diagram showed only a single mutation peak at this site); the proband's father was a heterozygous carrier of this mutation (the sequencing peak diagram showed overlapping C and T peaks at this site); and the proband's mother was also a heterozygous carrier of this mutation (the sequencing peak diagram showed overlapping C and T peaks at this site). This cosegregation in the family conforms to autosomal recessive inheritance patterns, further supporting the conclusion that the c.2575C>T mutation in the TNS1 gene is the pathogenic gene variant in this child.

[0047] Example 2 TNS1 R859W Effects of mutations on bile acid efflux function in hepatocytes 1. Construct TNS1 R859W Mutant cells Human primary hepatocytes (PHH, purchased from Liver Biotech, Shenzhen, China) were packaged and infected using a lentiviral system (lentivirus purchased from Jikai Gene, Shanghai, China). Stable expression vectors (Lenti-EV, as a negative control), wild-type TNS1 (Lenti-TNS1-WT), or TNS1 were constructed. R859W PHH cells containing the mutant (Lenti-TNS1-R859W). The lentiviral titer at infection was 1 × 10⁻⁶. 9 TU / mL, after 24h of infection, replace with fresh DMEM (Sigma-Aldrich) medium, add puromycin (final concentration 2 μg / mL) and screen for 72h to obtain cell lines that stably express the target gene.

[0048] 2. Detection of cellular bile excretion rate The above PHH cells were used at 2×10 5 Cells were seeded at a density per well in a collagen sandwich configuration: 24-well plates were pre-coated with type I collagen (1.54 mg / mL), cured at 37°C for 1.5 h, and then seeded with cells. The plates were cultured at 37°C in a 5% CO2 incubator for 5 days, with the culture medium changed every 2 days, to induce the formation of polar bile duct-like structures. After culture, THCA at a final concentration of 20 μM was added for 10 min, followed immediately by treatment with pre-cooled Ca2+-containing medium. 2+Wash three times with 1.2 mM HBSS buffer to quickly stop THCA uptake by cells. Add 100 μL of lysis buffer (PBS containing 0.1% Triton X-100), lyse on ice for 30 minutes, and collect the supernatant for fluorescence microplate reader detection (excitation wavelength 498 nm, emission wavelength 517 nm). Calculate the intracellular THCA accumulation based on the standard curve, and calculate the bile acid excretion index (BEI) according to the formula below to reflect the efflux transport capacity of PHH cells: ; In the formula, A cells+bile Total THCA content in cells and bile duct structures; A cells This refers to the intracellular THCA residue level only.

[0049] The results are as follows Figure 3 As shown.

[0050] Depend on Figure 3 From A in the equation, we know that TNS1 R859W The BEI of the mutant group was significantly lower than that of the wild-type TNS1 group, indicating that TNS1 R859W The mutation impairs the ability of hepatocytes to excrete bile acids. Figure 3 B in Figure 3 The immunofluorescence pattern of C in the TNS1 group further supports this functional impairment. Compared with the wild-type TNS1 group, TNS1 R859W The fluorescence signal distribution of bile acid-related transport structures in this group was significantly disordered, with more dispersed morphology and increased local accumulation, suggesting possible disruption of cell polarity and bile acid efflux-related structures. Furthermore, Figure 3 Quantitative results of D in the study showed that the relevant structural area of ​​the mutant group was significantly reduced, which means that the functional membrane domains of hepatocytes used for bile acid transport were reduced.

[0051] Establishment of a 1% bile acid (CA) cholestasis mouse model: A mouse cholestasis model was established using a diet containing 1% CA. Six-week-old male C57BL / 6J mice were used, with six mice per group, and fed continuously for 14 days. On day 14, blood was collected, allowed to stand at room temperature for 30 min, and then centrifuged at 4℃ and 3000 rpm for 15 min to separate serum. Various indicators were measured using a total bile acid (TBA) kit, a total bilirubin (T-BIL) kit, a direct bilirubin (D-BIL) kit, an alkaline phosphatase (ALP / AKP) assay kit, an aspartate aminotransferase (AST / GOT) kit, and an alanine aminotransferase (ALT / GPT) kit.

[0052] Building TNS1 R859WMutant mouse cholestasis model: Seven days before starting 1% CA diet, AAV8 virus was injected via tail vein to achieve liver-specific expression of human wild-type TNS1 (AAV8-TNS1-WT) or TNS1 in mice. R859W The mutant (AAV8-TNS1-R859W) has an AAV8 titer of 1×10⁻⁶. 13 vg / mL, diluted with sterile PBS to 5×10 before injection. 11 vg / animal, slowly injected via tail vein (completed within 10 seconds). Administering 1% CA diet starting on day 7 post-injection and continuing until day 21 (i.e., day 14 of CA diet feeding). Animals are then euthanized after intraperitoneal anesthesia with sodium pentobarbital (50 mg / kg), and liver tissue and serum are collected for subsequent testing.

[0053] Depend on Figure 4 As shown in section A, under a 1% bile acid diet, TNS1 R859W The livers of the group showed a darker color, more severe histological damage, and more pronounced cholestasis. Figure 4 The B result further confirmed this change; the serum transaminase, bilirubin, and bile acid levels in the mutant group were significantly elevated, and the bile acid content in liver tissue was also greatly increased, indicating that TNS1 R859W The mutation weakens the liver's ability to maintain bile acid homeostasis under high bile acid load.

[0054] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A reagent for detecting progressive familial intrahepatic cholestasis, characterized in that, The reagent includes a primer set for detecting TNS1 gene mutations, wherein the TNS1 mutant gene has a c.2575C>T mutation, and the wild-type TNS1 gene sequence corresponding to the TNS1 mutant gene can be found in GenBank accession number NM_022648.

7.

2. The reagent according to claim 1, characterized in that, The primer set for detecting TNS1 gene mutations includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

5.

3. The use of the reagent as described in claim 1 or 2 in the preparation of a molecular genetic testing kit for progressive familial intrahepatic cholestasis.

4. The use of the reagent as described in claim 1 or 2 in the preparation of a prenatal diagnostic kit for progressive familial intrahepatic cholestasis.

5. The use of the reagent as described in claim 1 or 2 in the preparation of a kit for prognostic assessment of progressive familial intrahepatic cholestasis.

6. A kit for diagnosing and / or screening progressive familial intrahepatic cholestasis, characterized in that, Includes the reagents described in claim 1 or 2.

7. A method for detecting TNS1 mutant genes in progressive familial intrahepatic cholestasis of disease for non-diagnostic purposes, characterized in that, Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the genomic DNA extracted in S1 as a template, perform PCR amplification and purification to obtain the purified PCR product. S3. Using the purified product obtained in S2 as a template, a sequencing reaction was performed using sequencing primers. The sequencing results were compared with the wild-type TNS1 gene sequence to determine whether a mutation exists.

8. A method for constructing an animal model of progressive familial intrahepatic cholestasis, characterized in that, Includes the following steps: Animals were administered an AAV8 virus carrying the TNS1 mutant gene; the animals were induced to develop a progressive familial intrahepatic cholestasis phenotype by feeding them a bile acid diet.

9. The method according to claim 8, characterized in that, The TNS1 mutant gene has a c.2575C>T mutation, and the wild-type TNS1 gene sequence corresponding to the TNS1 mutant gene can be found in GenBank accession number NM_022648.

7.

10. The use of an animal model constructed using the method of claim 8 or 9 in screening drugs for the treatment of progressive familial intrahepatic cholestasis.

Images