Methylation markers and kits for urothelial carcinoma detection

Abstract

The application discloses a methylation marker. The methylation marker comprises at least one of the following chromosomal regions: 1) chr8:57359229-57359312; 2) chr11:637390-637481, with hg19 as a reference genome. The methylation marker comprises a CpG site modified by 5-methylation or 5-hydroxymethylation.

Description

Technical Field

[0001] This invention belongs to the field of medicine and health. Specifically, this invention relates to methylation markers and kits for the detection of urothelial carcinoma. More specifically, this invention relates to reagents, methods for detecting methylation levels for non-diagnostic purposes, and their uses. Background Technology

[0002] Urothelial carcinoma is a multifocal malignant tumor originating from the urothelial tract and is the most common tumor of the urinary system. Urothelial carcinoma includes renal pelvis cancer, ureteral cancer, bladder cancer, and urethral cancer, with bladder cancer accounting for the highest proportion, exceeding 90%. Hematuria is the most common and earliest symptom of bladder cancer. This hematuria is often painless, intermittent, and can subside or stop on its own, easily creating the illusion that the disease has been cured. Bladder cancer is characterized by long survival and a high recurrence rate (50%-70% of patients relapse within 5 years), therefore, bladder cancer screening and recurrence monitoring are essential.

[0003] Commonly used methods for detecting urothelial carcinoma include urine cytology, urine tumor marker testing, imaging studies, and endoscopy. However, these methods still have some limitations, such as insufficient sensitivity and specificity. Summary of the Invention

[0004] This application is based on the inventor's discovery of the following problems:

[0005] Urine cytology is an important method for the diagnosis and postoperative follow-up of bladder cancer. Its sensitivity is 13%–75%, and its specificity is 85%–100%, but its sensitivity for G1 and low-grade tumors is only 16%. In addition to its low sensitivity, the performance of urine cytology is also affected by factors such as low cell count, urinary tract infection, stones, or bladder instillation therapy.

[0006] Urinary tumor marker detection includes nuclear matrix protein 22 (NMP22) and bladder tumor antigens (BTAstat and BTAtrak). Because urinary tumor marker detection has high sensitivity but low specificity, it has not been widely used in clinical practice.

[0007] Imaging examinations include ultrasound, CT and computed tomography urography (CTU), magnetic resonance imaging (MRI) and magnetic resonance urography (MRU). Cystoscopy and biopsy are currently the most reliable methods for diagnosing bladder cancer and are also one of the main means of monitoring postoperative recurrence. However, imaging and endoscopic examinations are expensive, and due to limitations in equipment and medical resources such as physicians, large-scale screening is not possible. Furthermore, some examinations may cause harm to patients. For example, cystoscopy may cause complications such as urogenital infections, urethral and bladder bleeding, urethral injury, and urethral stricture. Patient compliance is poor, and repeated monitoring places a huge burden on patients.

[0008] This application aims to at least partially solve one of the aforementioned technical problems or at least provide a useful commercial option. In view of this, this application provides a methylation biomarker with advantages such as high sensitivity and high specificity for the detection of urothelial carcinoma. According to an embodiment of this application, the methylation biomarker comprises: using hg19 as a reference genome, having at least one of the following chromosomal regions: 1) chr8:57359229-57359312; 2) chr11:637390-637481.

[0009] It should be noted that this application only shows methylation markers with hg19 as the reference genome. Those skilled in the art will understand that, based on the methylation markers disclosed in this application with hg19 as the reference genome, methylation markers obtained based on other reference genomes (such as HG38, GRCh36, GRCh37, GRCh38, etc.) are also within the scope of protection of this application.

[0010] In another aspect of this application, a reagent is provided. According to an embodiment of this application, the reagent includes a reagent for detecting the aforementioned methylation markers.

[0011] In another aspect of this application, a reagent kit is provided. According to an embodiment of this application, the reagent kit includes the aforementioned reagents.

[0012] In another aspect of this application, a method for detecting methylation levels for non-diagnostic purposes is proposed. According to embodiments of this application, the method includes detecting the methylation level of a sample to be tested using the aforementioned reagents or kits.

[0013] In another aspect of this application, the use of the aforementioned reagents or kits in the preparation of products for the detection, diagnosis, screening, recurrence monitoring, or prognostic assessment of urothelial carcinoma is proposed.

[0014] Additional aspects and advantages of this application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of this application. Attached Figure Description

[0015] The above and / or additional aspects and advantages of this application will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0016] Figure 1 This is a graph showing the difference in cytosine methylation rate between biomarkers in bladder cancer and non-cancerous cells in Example 1 of this application. CpG1-CpG12 are CpG sites on biomarkers chr8:57359229-57359312, and CpG13-CpG26 are CpG sites on biomarkers chr11:637390-637481.

[0017] Figure 2 This is a graph showing the ΔCt values ​​of two methylation markers, chr8:57359229-57359312 and chr11:637390-637481, in control and cancer sample groups in Example 3 of this application.

[0018] Figure 3 This is the ROC curve of two methylation markers chr8:57359229-57359312 and chr11:637390-637481 in Example 3 of this application. Detailed Implementation

[0019] The embodiments of this application are described in detail below. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application.

[0020] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this application, unless otherwise stated, "multiple" means two or more.

[0021] In this article, unless otherwise specified, "methylation" is a form of DNA chemical modification that can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent binding of a methyl group to the 5th carbon position of cytosine in a CpG dinucleotide of the genome, under the action of DNA methyltransferases. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.

[0022] In this article, unless otherwise specified, "methylation level" refers to whether cytosine in one or more CpG dinucleotides within a DNA sequence is methylated, or the frequency / proportion / percentage of methylation, representing both a qualitative and quantitative concept. In practical applications, different detection indicators can be used to compare DNA methylation levels depending on the specific circumstances. For example, in some cases, comparisons can be made based on the Ct values ​​of the samples; in others, the proportion of gene methylation in the sample can be calculated as (number of methylated molecules / (number of methylated molecules + number of unmethylated molecules)) × 100, and then compared; in still others, statistical analysis and integration of various indicators are performed to derive the final judgment index.

[0023] The term “CpG site” as used in this article refers to a region in a DNA molecule in which a cytosine nucleotide is followed by a guanine nucleotide in a basic linear sequence along its 5' to 3' direction, and this region is methylated by events that occur naturally in vivo or by chemical action in vitro.

[0024] In this document, unless otherwise specified, "identity" is used to describe the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences relative to a reference sequence, determined by conventional methods such as NCBI Blast v2.0, to calculate the degree of sequence identity between two or more nucleotide sequences. Other techniques, computer algorithms, and settings used to determine the degree of sequence identity are referenced in WO 04 / 037999, EP 0967284, EP 1 085 089, WO 00 / 55318, WO 00 / 78972, WO 98 / 49185, and GB 2357768-A.

[0025] The term "diagnosis" as used in this article refers not only to "judgment" but also to "determination," "differentiation," "identification," "examination," "detection," and "prediction" of cancer and benign lesions, cancer and its progression, cancer risk, treatment effectiveness, and recurrence risk. Benign lesions include, but are not limited to, cystitis, stones, benign prostatic hyperplasia, hydronephrosis, and renal cysts.

[0026] As used herein, the term "prognosis" refers to the prediction of the likely outcome of cancer, including the expectation of cancer recovery. As used herein, the terms prognostic information and predictive information are interchangeable in meaning any aspect of the course of a disease or condition that may be used to predict its course, whether or not treatment is administered. Such information may include, but is not limited to, the patient's average life expectancy, the probability of the patient surviving for a given time (e.g., 6 months, 1 year, 5 years, etc.), the probability that the patient's disease will be cured, and the probability that the patient's disease will respond to a particular treatment (wherein, response may be defined in any different way). Both prognostic and predictive information are included within the broad category of diagnostic information.

[0027] The term "Youden index," also known as the accuracy index, is used in this article to evaluate the validity of screening tests. It is applied when the harm of false negatives (missed diagnoses) and false positives (false diagnoses) is considered equally significant. The Youden index is the sum of sensitivity and specificity minus 1. It represents the overall ability of a screening method to detect true patients and non-patients. A higher index indicates a better screening test and greater validity. The term "optimal Youden index" refers to the case where the sum of sensitivity and specificity minus 1 is maximized.

[0028] The term "sensitivity" as used in this article refers to the proportion of positive samples that yield a positive result using a assay, also known as the true positive rate. Sensitivity is typically calculated as the number of true positives identified by the assay divided by the sum of the number of true positives and false negatives determined by the assay on known positive samples.

[0029] Similarly, the term "specificity" refers to the ratio of the number of true negatives determined by the assay to the sum of the number of true negatives and false positives determined by the assay on known negative samples.

[0030] In this article, unless otherwise specified, "probe" refers to an oligonucleotide sequence containing a 5' fluorescent reporter group and a 3' fluorescent quencher group. When the probe binds to the corresponding site on DNA, it does not emit fluorescence because of the presence of the quencher group near the fluorescent group. During amplification, if the probe binds to the strand being amplified, the 5'-3' exonuclease activity of DNA polymerase (such as Taq polymerase) digests the probe. Since the fluorescent group is far from the quencher group, its energy is not absorbed, thus producing a fluorescent signal. With each PCR cycle, the fluorescence signal, like the target fragment, undergoes a synchronous exponential growth process.

[0031] The term "urothelial carcinoma," also known as transitional cell carcinoma (TCC), refers to a malignant tumor originating from urothelial cells. The urothelial cell line is a specialized type of transitional epithelium distributed across multiple sites in the urinary system, including the renal pelvis, ureter, bladder, and proximal urethra.

[0032] This invention proposes methylation markers, reagents, kits, methods for detecting methylation levels for non-diagnostic purposes, and their applications, which will be described in detail below.

[0033] Methylation markers

[0034] In one aspect of this application, a methylation biomarker is proposed. According to an embodiment of this application, the methylation biomarker comprises: using hg19 as a reference genome, having at least one of the following chromosomal regions: 1) chr8: 57359229-57359312; 2) chr11: 637390-637481. By detecting the methylation information of the above biomarkers in a subject's sample, non-invasive, accurate, convenient, and economical detection of urothelial carcinoma can be achieved, thereby reducing patient burden, improving testing compliance, and improving diagnosis and treatment.

[0035] According to embodiments of this application, the physical location of the methylation marker is determined based on human whole genome sequence alignment.

[0036] According to embodiments of this application, the methylation marker includes CpG sites modified by 5-methylation or 5-hydroxymethylation.

[0037] It should be explained that those skilled in the art will understand that any means of detecting or analyzing these protected methylation markers, including but not limited to PCR (methylation-specific PCR, digital PCR, quantitative real-time PCR, etc.), DNA methylation chips, pyrosequencing, high-throughput sequencing, third-generation sequencing or single-molecule sequencing and mass spectrometry, are within the scope of protection of this application.

[0038] Methods for analyzing methylation markers are based on the presence or absence, and the proportion, of methylation at all or part of the CpG sites in the methylation marker region. Specifically, the presence or absence, and proportion, of methylation can be obtained directly or indirectly through sequence differences, PCR amplification, Ct values, melting curves, and electrical signals.

[0039] According to embodiments of this application, partial or complete detection of these methylation marker regions includes positive strands, negative strands, unconverted sequences, and converted sequences.

[0040] reagents

[0041] In another aspect of this application, a reagent is provided. According to an embodiment of this application, the reagent includes a reagent for detecting the methylation markers described in the first aspect of this application. By detecting the methylation information of the above-mentioned markers in a subject's sample using the reagent, non-invasive, accurate, convenient, and economical urothelial carcinoma detection can be achieved, thereby reducing patient burden, improving testing compliance, and improving diagnosis and treatment.

[0042] According to embodiments of this application, the reagent includes a primer set and / or a probe set for detecting the methylation marker.

[0043] According to embodiments of this application, the primer set includes a first primer set adapted to amplify chromosomal region 1), wherein the primers in the first primer set are shown as SEQ ID NO:3-4 or nucleotide sequences having 90% identity with them; and / or a second primer set adapted to amplify chromosomal region 2), wherein the primers in the second primer set are shown as SEQ ID NO:6-7 or nucleotide sequences having 90% identity with them.

[0044] According to embodiments of this application, primer modifications include, but are not limited to, simple shortening, lengthening, translation, or alteration of the primer position.

[0045] According to an embodiment of this application, the probe set includes: a first probe, the first probe being adapted to detect chromosomal region 1), the first probe being as shown in SEQ ID NO:5 or a nucleotide sequence having 90% identity with it; and / or, a second probe, the second probe being adapted to detect chromosomal region 2), the second probe being as shown in SEQ ID NO:8 or a nucleotide sequence having 90% identity with it.

[0046] According to embodiments of this application, the 5' ends of the first probe and the second probe are labeled with fluorescent reporter groups, and the 3' ends are labeled with fluorescent quencher groups.

[0047] According to embodiments of this application, the fluorescent reporter group is selected from at least one of the following: FAM, VIC, ROX, and Cy5; the fluorescent quencher group is selected from at least one of the following: BHQ1, BHQ2, BHQ3, and MGB.

[0048] According to a specific embodiment of this application, the first probe shown in SEQ ID NO:5 is modified with 5'-FAM, 3'-BHQ1; and the second probe shown in SEQ ID NO:8 is modified with 5'-VIC, 3'-BHQ1.

[0049] According to embodiments of this application, the primer set and probe set include: 1) SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5; or 2) SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8.

[0050] Reagent test kit

[0051] In another aspect, this application provides a reagent kit. According to embodiments of this application, the reagent kit includes the aforementioned reagents. By detecting the methylation information of the above-mentioned markers in a subject's sample using the reagent kit, non-invasive, accurate, convenient, and economical detection of urothelial carcinoma can be achieved, thereby reducing patient burden, improving testing compliance, and improving diagnosis and treatment.

[0052] According to embodiments of this application, the kit further includes a DNA methylation conversion reagent.

[0053] It should be explained that methylation conversion reagents can convert cytosine (C) in nucleic acid fragments to uracil (U), while 5-methylcytosine (5mC) remains unchanged. Furthermore, by designing primers targeting the methylated sequence, PCR amplification of the methylated site is performed. If an amplified fragment is obtained, it indicates the presence of methylation at that site in the nucleic acid fragment; if no amplified fragment is obtained, it indicates the absence of methylation at that site, thus enabling the diagnosis of bladder cancer. Specifically, the methylation conversion reagent can be a sulfite conversion reagent or an enzymatic conversion reagent.

[0054] According to embodiments of this application, the kit further comprises at least one of PCR reaction buffer, dNTPs, DNA polymerase, and magnesium ions.

[0055] According to embodiments of this application, the kit further includes primers and probes for detecting an internal reference gene.

[0056] According to embodiments of this application, the primers used for detecting the internal reference gene (GAPDH) are as shown in SEQ ID NO:9, SEQ ID NO:10, or nucleotide sequences having 90% identity with them.

[0057] According to embodiments of this application, the probe for detecting the internal reference gene (GAPDH) is as shown in SEQ ID NO:11 or a nucleotide sequence having 90% identity with it.

[0058] According to embodiments of this application, the kit further includes one or more PCR additives, such as dimethyl sulfoxide, betaine, glycerol, formamide, and trehalose.

[0059] According to an embodiment of the present application, the kit further comprises a positive control and a negative control.

[0060] According to an embodiment of the present application, by detecting the methylation markers disclosed in the present invention and analyzing the methylation status of the markers, the kit can determine the risk of a subject suffering from urothelial carcinoma. The kit contains a control, which may be a cell line, sequence or plasmid DNA with known methylation status in a specific region of a related gene. The control is tested synchronously with the sample. When the test result meets the quality inspection standard, the quality control is qualified; otherwise, it indicates that there is an abnormality in the experiment, and the test should be repeated.

[0061] Method for detecting methylation level for non-diagnostic purposes

[0062] In yet another aspect of the present application, the present application provides a method for detecting a methylation level for non-diagnostic purposes. According to an embodiment of the present application, the method comprises using the aforementioned reagent or kit to perform methylation level detection on a test sample.

[0063] According to an embodiment of the present application, the test sample comprises a natural sample or a standard substance.

[0064] According to an embodiment of the present application, the test sample comprises a tissue sample or a body fluid sample.

[0065] According to an embodiment of the present application, the body fluid sample comprises at least one of blood, serum, plasma, urine, feces, tear, tumor cells, alveolar lavage fluid, sputum and pus.

[0066] According to an embodiment of the present application, the tissue sample comprises at least one of a tissue and a paraffin section.

[0067] The methylation level detection based on the aforementioned method can be used for scientific research or drug development and the like. The aforementioned method can also be used to predict the occurrence risk of urothelial carcinoma and / or prostate cancer, which can effectively improve the diagnosis efficiency and diagnostic accuracy of urothelial carcinoma and / or prostate cancer, save diagnosis time and labor cost, and is suitable for large-scale screening.

[0068] In some examples of the present application, the aforementioned test sample is selected from a tissue or a body fluid. The aforementioned body fluid may be selected from blood, saliva, tissue, urine and the like. In some preferred examples of the present application, the aforementioned biological sample is selected from a urine sample or a nucleic acid sample derived from urine. Based on the urine sample or the nucleic acid sample derived from urine, invasive endoscopic examination is avoided, which can effectively reduce the physical and mental burden of the subject and improve detection compliance.

[0069] It should be noted that the methylation markers of this invention are selected from chromosome region 1) chr8:57359229-57359312 and chromosome region 2) chr11:637390-637481. Furthermore, they include the positive and negative strands of these regions, as well as the sequences after base conversion. The base conversion methods include, but are not limited to, bisulfite conversion and enzymatic conversion.

[0070] use

[0071] In another aspect of this application, the use of the aforementioned reagents or kits in the preparation of products for the detection, diagnosis, screening, recurrence monitoring, or prognostic assessment of urothelial carcinoma is proposed.

[0072] According to embodiments of this application, the urothelial carcinoma includes at least one of renal pelvis carcinoma, ureteral carcinoma, bladder carcinoma, and urethral carcinoma.

[0073] use

[0074] In another aspect of this application, the use of the aforementioned reagents or kits in the preparation of products for the detection, diagnosis, screening, recurrence monitoring, or prognostic assessment of renal or prostate cancer is proposed.

[0075] The sequence of this application is shown in the table below.

[0076] sequence list

[0077]

[0078] The following will explain the solution of this application with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0079] Example 1:

[0080] Whole-genome methylation sequencing was performed on DNA extracted from 49 cancerous tissues and 32 adjacent normal tissues from bladder cancer patients. Combined with methylation microarray data from The Cancer Genome Atlas (TCGA-BLCA), sites with high AUC and differential methylation rates were screened by analyzing methylation rate data. After qPCR primer and probe design and screening, methylation biomarkers for the detection, diagnosis, screening, recurrence monitoring, or prognostic assessment of urothelial carcinoma were obtained. Using hg19 as the reference genome, the biomarkers are chromosome region 1 (chr8:57359229-57359312, SEQ ID NO:1, also known as biomarker 1) and chromosome region 2 (chr11:637390-637481, SEQ ID NO:2, also known as biomarker 2).

[0081] The positive chain sequences of the marker regions are shown in Table 1 below.

[0082] Table 1

[0083]

[0084] The whole-genome methylation sequencing method and data analysis method described above are selected from conventional methods in this field.

[0085] The sequencing method was based on the MGIEasy whole-genome methylation library preparation kit (MGI, #940-001527-00) for library construction. Following the instructions, the following steps were completed: DNA fragmentation and screening, end repair and dA tail addition, adapter ligation, ligation product purification, methylation transformation and purification, PCR amplification, PCR product purification, PCR product quality testing, and subsequent circularization and DNB preparation. PE100 sequencing was performed using the MGISEQ-2000 (MGI). Alternatively, a commercially available kit (MGISEQ-2000RS high-throughput sequencing kit (FCL PE100), #1000012554) can be purchased for sequencing, or sequencing can be performed by a sequencing service provider.

[0086] Furthermore, the difference in methylation rate of the aforementioned marker was validated in bladder cancer and non-bladder cancer cell lines, with results as follows: Figure 1 As shown, chromosome regions 1 and 2 of this application show significant differences between bladder cancer and non-cancerous cells (the darker the color, the higher the methylation rate), and each CpG site also shows certain differences, which can be applied to the detection of urothelial carcinoma.

[0087] Example 2:

[0088] This embodiment describes the method and experimental procedure for detecting the methylation markers screened in Example 1 using qPCR. Urine samples were used as the detection target, and the specific experimental steps are as follows:

[0089] I. Method:

[0090] (1) DNA extraction from urine samples:

[0091] DNA was extracted from urine sediment cells using the DNeasy Blood & Tissue Kit (Qiagen, #69506) according to the instructions.

[0092] (2) Primer and probe design

[0093] Primers and probes were designed for the methylation marker region obtained in Example 1. Specific primer and probe information is shown in Table 2. In this example, the probe shown in SEQ ID NO:5 was modified with 5'-FAM, 3'-BHQ1; the probe shown in SEQ ID NO:8 was modified with 5'-VIC, 3'-BHQ1.

[0094] Table 2

[0095]

[0096] The PCR system contains the internal reference gene GAPDH. The primer and probe sequences of the internal reference gene used in this embodiment are shown in Table 3. The modification used for the internal reference gene is 5'-ROX, 3'-BHQ2.

[0097] Table 3

[0098] Serial Number sequence Remark SEQ ID NO:9 TTTAGGAGTGAGTGGAAGATAGA Primer F3 SEQ ID NO:10 AAACCACACCATCCTAATTACCT Primer R3 SEQ ID NO:11 CCCAAAACACATTTCTTCCATTC probe P3

[0099] (3) Bisulfite conversion

[0100] Using the EZ DNAMethylation-Gold Kit (Zymo Research, #D5005 / D5006), DNA was transformed according to the instructions to convert unmethylated C to U, while methylated C remained unchanged.

[0101] (4) Real-time PCR detection

[0102] Using the primer and probe combinations in Table 2, perform PCR reactions together with the primers and probes for the internal reference gene in Table 3, and prepare the PCR mixture according to Table 4:

[0103] reagents Final concentration PCR Buffer 1x <![CDATA[MgCl2]]> 1.5mM dNTP 0.3mM Primer F1 0.2μM Primer R1 0.2μM probe P1 0.1μM Primer F2 0.2μM Primer R2 0.2μM probe P2 0.1μM Primer F3 0.2μM Primer R3 0.2μM probe P3 0.1μM PCR enzyme 1U Total volume (μL) Add NF water to 15μL

[0104] Thoroughly mix the prepared PCR mixture, aliquot it into 15 μL portions for each well, and add 5 μL of transformed DNA to each well, for a total PCR reaction volume of 20 μL. Vortex to mix, then centrifuge.

[0105] Real-time PCR setup: Place the prepared reaction solution into the real-time PCR instrument and amplify according to the following PCR reaction procedure:

[0106] 95℃, 10 min; (95℃, 15 s; 55℃, 30 s; 72℃, 30 s) 45 cycles. Fluorescence signals were collected at 72℃.

[0107] (5) Results Analysis:

[0108] Export the Ct values ​​obtained from each fluorescence channel from the software, either by setting the threshold at the instrument's default threshold or by setting the threshold line at the corner of the S-curve.

[0109] △Ct value calculation: The △Ct value of a methylation marker is obtained by subtracting the Ct value of the corresponding internal reference gene from the Ct value of the methylation marker in each reaction.

[0110] Example 3:

[0111] The kit used in this embodiment for detecting methylation markers includes all the reagents used in the detection method of Example 2. The primers and probes can be selected from the specific sequences in Table 1. Specifically, this embodiment uses the primer and probe sequences shown in Combinations 1 and 2 in Table 2 as examples to verify the performance in urothelial carcinoma detection.

[0112] Following the method in Example 2, urine samples from 84 patients with urothelial carcinoma (82 bladder cancer, 1 ureteral cancer, and 1 renal pelvis cancer) and 61 individuals with benign urinary system diseases (cystitis, stones, benign prostatic hyperplasia, hydronephrosis, renal cysts, etc.) were subjected to DNA extraction, bisulfite conversion, quantitative real-time PCR detection, Ct value derivation, and ΔCt value calculation.

[0113] ROC curves were plotted using SPSS software. For single-gene analysis, the individual ΔCt values ​​of each biomarker were used as input. For dual-gene analysis, binary logistic regression analysis was used as input. The area under the curve (AUC) of the dual-gene combination was calculated. Based on the principle of maximizing the Youden index, the optimal threshold was determined, along with the detection sensitivity and specificity of the biomarker at the corresponding threshold.

[0114] The optimal cutoff value was selected based on the principle of maximizing the Youden index, and the sensitivity and specificity corresponding to each ROC curve were recorded. The results are shown in Table 5.

[0115] Table 5

[0116]

[0117] Note: Chromosome region 1) in this application is the same as marker 1; chromosome region 2) is the same as marker 2.

[0118] The results are as follows Figure 3 As shown in Table 5, the chromosomal regions 1) chr8:57359229-57359312 and 2) chr11:637390-637481 disclosed in this invention both exhibit good detection performance. Specifically, the AUC of chromosomal region 1) as a methylation marker is 0.928, and the AUC of chromosomal region 2) as a methylation marker is 0.897. The performance of the marker combination is improved to 0.943, and the sensitivity and specificity results of the marker combination are both better than those of single-gene detection. In the marker combination detection, 72 out of 84 urothelial carcinoma samples (82 bladder cancer, 1 ureteral cancer, and 1 renal pelvis cancer) were identified as positive / high-risk, with both ureteral and renal pelvis cancers being identified as positive / high-risk. 56 out of 61 benign urinary system control samples were identified as negative / low-risk. Overall, the results are good, reflecting that this invention can effectively assess the risk of urothelial carcinoma.

[0119] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of this application. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0120] Although embodiments of this application have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting this application. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of this application.

Claims

1. A methylation marker, characterized in that, include: Using hg19 as a reference genome, it has at least one of the following chromosomal regions: 1)chr8:57359229-57359312; 2)chr11:637390-637481.

2. The methylation marker according to claim 1, characterized in that, The nucleotide sequence of chromosome region 1) is shown in SEQ ID NO:1, and the nucleotide sequence of chromosome region 2) is shown in SEQ ID NO:

2.

3. A reagent, characterized in that, include: Reagent for detecting the methylation markers as described in claim 1 or 2; Optionally, the reagent includes a primer set and / or probe set for detecting the methylation marker.

4. The reagent according to claim 3, characterized in that, The primer set includes a first primer set, which is adapted to amplify chromosomal region 1), wherein the primers in the first primer set are as shown in SEQ ID NO:3-4 or nucleotide sequences having 90% identity with them; And / or, The second primer set, which is suitable for amplifying chromosome region 2), includes primers as shown in SEQ ID NO:6-7 or nucleotide sequences that are 90% identical to them.

5. The reagent according to claim 3, characterized in that, The probe set includes: a first probe adapted to detect chromosomal region 1), the first probe being as shown in SEQ ID NO:5 or a nucleotide sequence having 90% identity with it; and / or, The second probe is adapted to detect chromosomal region 2), and the second probe is shown as SEQ ID NO:8 or a nucleotide sequence having 90% identity with it; Optionally, the 5' end of the first probe and the second probe are labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; Optionally, the fluorescent reporter group is selected from at least one of the following: FAM, VIC, ROX and Cy5; the fluorescent quencher group is selected from at least one of the following: BHQ1, BHQ2, BHQ3 and MGB.

6. The reagent according to claim 3, characterized in that, The primer set and probe set include: 1) SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5; or 2) SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:

8.

7. A reagent kit, characterized in that, include: The reagent according to any one of claims 3 to 6.

8. The reagent kit according to claim 7, characterized in that, The kit further includes a DNA methylation conversion reagent; Optionally, the kit further comprises at least one of PCR reaction buffer, dNTPs, DNA polymerase, and magnesium ions; Optionally, the kit further includes primers and probes for detecting the internal reference gene; Optionally, the primers used for detecting the internal reference gene are as shown in SEQ ID NO:9, SEQ ID NO:10, or nucleotide sequences having 90% identity with them; Optionally, the probe for detecting the internal reference gene is as shown in SEQ ID NO:11 or a nucleotide sequence having 90% identity with it.

9. A method for detecting methylation levels for non-diagnostic purposes, characterized in that, include: The methylation level of the test sample is detected using the reagents described in any one of claims 3 to 6 or the kit described in claim 7 or 8.

10. The method according to claim 9, characterized in that, The samples to be tested include natural samples or standards; Optionally, the sample to be tested includes a tissue sample or a body fluid sample; Optionally, the body fluid sample includes at least one of blood, serum, plasma, urine, feces, tears, tumor cells, bronchoalveolar lavage fluid, sputum, and pus; Optionally, the tissue sample includes at least one of tissue and paraffin sections.

11. Use of the reagent according to any one of claims 3 to 6 or the kit according to claim 7 or 8 in the preparation of products for the detection, diagnosis, screening, recurrence monitoring or prognostic assessment of urothelial carcinoma.

12. The use according to claim 11, characterized in that, The urothelial carcinoma includes at least one of renal pelvis cancer, ureteral cancer, bladder cancer, and urethral cancer.

Images