A kit for detecting an extracellular vesicle marker in situ, and a detection method and application thereof

Abstract

The application discloses a kit for in-situ detection of an extracellular vesicle marker and a detection method and application thereof. The application enriches and rapidly captures extracellular vesicles through titanium dioxide modified magnetic beads, simultaneously in-situ detects micro ribonucleic acids in the vesicles and membrane surface proteins, and can be used for non-invasive early detection, real-time monitoring and treatment reaction evaluation without a complex pretreatment process. The detection method can realize multi-index parallel detection, can realize screening of the most valuable markers, has high sensitivity and high accuracy, can meet clinical application requirements, and can provide a new thought and technical scheme for clinical research and application of diseases such as tumors.

Description

Technical Field

[0001] This invention relates to the field of biomedical nanotechnology, specifically to a kit for in situ detection of extracellular vesicle markers, its detection method, and its application. Background Technology

[0002] Extracellular vesicles (EVs) are a type of nanoscale vesicle secreted by cells, possessing a phospholipid bilayer structure, and are widely distributed in bodily fluids such as blood, urine, and saliva. EVs carry a variety of biological information from their cellular origin, including membrane surface proteins, lipids, and intravesical nucleic acid molecules. Among these, microRNAs (miRNAs) and surface proteins have become important research subjects due to their good stability and disease relevance.

[0003] Extensive research has been conducted on the detection of extracellular vesicle biomarkers in existing technologies. However, extracellular vesicle-based detection methods still face several limitations in practical applications. First, the complex composition of body fluids means that disease-related extracellular vesicles typically constitute a low proportion of the total extracellular vesicles, making it difficult to efficiently enrich and accurately analyze target extracellular vesicles. Furthermore, most current detection methods are often limited by interference from numerous impurities and normal cell-derived extracellular vesicles in body fluid samples, failing to identify disease-derived extracellular vesicles. Second, existing detection strategies often analyze only a single type of biomarker, such as detecting only extracellular vesicle membrane surface proteins or only miRNAs within the vesicles. This fails to comprehensively reflect the multidimensional molecular information carried by extracellular vesicles, thus limiting the specificity and stability of the detection results.

[0004] On the other hand, existing extracellular vesicle analysis procedures typically require separation and purification before subsequent detection. Commonly used separation methods include ultracentrifugation, precipitation, filtration, and size exclusion chromatography. These methods generally suffer from cumbersome procedures, long processing times, high equipment requirements, or insufficient reproducibility, making them unsuitable for rapid detection and clinical applications. In contrast, magnetic bead separation technology offers advantages such as ease of operation, rapid separation speed, convenient washing and enrichment, and ease of standardization and platform integration. Therefore, it shows great promise for the rapid extraction of extracellular vesicles from complex samples.

[0005] Furthermore, the detection methods for extracellular vesicle surface proteins and intravesical miRNAs differ. Surface proteins typically require the vesicle surface structure to remain relatively intact for recognition. However, miRNAs are located inside the vesicles, and traditional detection methods often require vesicle lysis to release nucleic acids before amplification and signal detection. These differences in detection conditions and processing methods make efficient synergistic analysis of extracellular vesicle membrane proteins and miRNAs from the same sample difficult. Meanwhile, some in-situ detection methods for membrane proteins rely on specialized equipment such as nanoflow cytometry, which suffers from high equipment costs, complex operation, and limited application scenarios, further hindering the widespread adoption of these technologies. Existing research indicates that extracellular vesicle surface proteins and intravesical miRNAs are not independent processes in disease development but rather participate in multiple biological processes. Compared to single-marker detection, simultaneously acquiring information on extracellular vesicle surface proteins and intravesical miRNAs helps to more comprehensively characterize disease-related features and improve the accuracy and reliability of detection results.

[0006] Therefore, current technologies still lack a method for rapid extraction of extracellular vesicles from complex samples and further, based on the extraction vector, for rapid in-situ detection. Developing a multiplex in-situ detection method for extracellular vesicle biomarkers based on magnetic bead capture is of great significance for simplifying procedures, shortening detection time, improving the ability to perform combined analysis of multiple biomarkers, and promoting the application of extracellular vesicle detection technology. Summary of the Invention

[0007] Purpose of the invention: The first objective of this invention is to provide a kit for in situ detection of extracellular vesicle markers.

[0008] A second objective of this invention is to provide a method for in situ detection of extracellular vesicle markers.

[0009] The final objective of this invention is to provide a kit or detection method for in situ detection of extracellular vesicle markers and its application in the preparation of reagents or kits for diagnosing lymphoma.

[0010] Technical Solution: To achieve the above objectives, this invention provides a kit for in situ detection of extracellular vesicle markers. The kit includes titanium dioxide-modified magnetic beads, enzyme-free amplification probes, and fluorescently labeled antibodies. The enzyme-free amplification probes include hairpin probe A and hairpin probe B. The stem region of hairpin probe A is complementary to the target miRNA. Hairpin probe A is modified with a fluorescent luminescent group within its sequence and with a fluorescent quenching group at its 3' end. Hairpin probe A and hairpin probe B are partially complementary. Both hairpin probe A and hairpin probe B are modified with -TTTTTT-cholesterol at their 3' ends. The fluorescently labeled antibody is complementary to the target surface protein.

[0011] Preferably, the extracellular vesicle markers include one or more combinations of miR-155-5p, miR-125b-5p, miR-21-5p, miR-107, CD20, CD63, PD-L1, or CXCR4.

[0012] Preferably, the amount of magnetic beads used is 3-5 mg of magnetic beads with a diameter of 5 μm per 1 mL of extracellular vesicle solution.

[0013] Preferably, the fluorescent luminescent group includes one or more of Cy5, ROX or FAM, and the fluorescent quenching group includes BHQ.

[0014] Hairpin probe A and hairpin probe B include the following combinations:

[0015] (1) The nucleotide sequence of hairpin probe A is shown in SEQ ID NO.2, and the nucleotide sequence of hairpin probe B is shown in SEQ ID NO.3;

[0016] (2) The nucleotide sequence of hairpin probe A is shown in SEQ ID NO.12, and the nucleotide sequence of hairpin probe B is shown in SEQ ID NO.13;

[0017] (3) The nucleotide sequence of hairpin probe A is shown in SEQ ID NO.14, and the nucleotide sequence of hairpin probe B is shown in SEQ ID NO.15;

[0018] (4) The nucleotide sequence of hairpin probe A is shown in SEQ ID NO.16, and the nucleotide sequence of hairpin probe B is shown in SEQ ID NO.17.

[0019] The kit also includes HEPES buffer, NP-40 / Triton X-100 solution and / or bovine serum albumin solution.

[0020] Preferably, the mass volume fraction (m / V) of the NP-40 / Triton X-100 solution is 0.1%.

[0021] Preferably, the bovine serum albumin solution has a mass-volume fraction of 0.5%.

[0022] This invention also provides a method for in situ detection of extracellular vesicle markers, the detection method being used for non-disease detection, the method comprising the following steps:

[0023] (1) The serially diluted miRNA to be tested was co-incubated with the corresponding hairpin probe A and hairpin probe B, the fluorescence signal was detected, and the linear equation for the absolute amount of the miRNA to be tested was obtained.

[0024] or,

[0025] Extracellular vesicles were enriched using titanium dioxide-modified magnetic beads. The resulting magnetic bead / extracellular vesicle complex was diluted to different concentrations and co-incubated with hairpin probes A and B corresponding to the miRNA to be tested. Fluorescence signals were detected, and a linear equation for the relative amount of the miRNA to be tested was obtained. Fluorescently labeled antibodies corresponding to the surface proteins to be tested were added and incubated. Fluorescence signals were detected, and a linear equation for the relative amount of the proteins to be tested was obtained.

[0026] (2) The test sample containing extracellular vesicles was enriched with titanium dioxide-modified magnetic beads. The obtained magnetic bead / extracellular vesicle complex was added to hairpin probes A and B for co-incubation, and fluorescently labeled antibody was added for co-incubation. The fluorescence signal was detected, and the content of the miRNA and / or protein to be tested was obtained by substituting it into the corresponding linear equation.

[0027] Preferably, it is used to detect extracellular vesicles containing any one or more miRNAs of miR-155-5p, miR-125b-5p, miR-21-5p or miR-107, and / or containing any one or more membrane surface proteins of CD20, CD63, PD-L1 or CXCR4.

[0028] The present invention also provides a kit or detection method for in situ detection of extracellular vesicle markers, and its application in the preparation of reagents or kits for diagnosing lymphoma.

[0029] Preferably, the application can distinguish between healthy individuals, individuals with newly diagnosed active lymphoma, or individuals with lymphoma in remission after treatment.

[0030] Preferably, the application involves testing patient plasma, and the ratio of plasma to magnetic beads is 0.5 to 10:1, preferably 2.5:1.

[0031] The detection method of this invention enables non-destructive detection of multiple biomarkers from extracellular vesicles. When magnetic beads and extracellular vesicles are co-incubated in a buffer system, the magnetic beads and extracellular vesicles interact to achieve capture. When the magnetic bead / extracellular vesicle complex and probe are co-incubated in a buffer system, the probe, modified with cholesterol, enters the extracellular vesicle and forms a double strand with the target biomarker microRNA. The inhibition of the fluorescent luminescent group by the fluorescent quenching group is reduced, and the system generates a fluorescent signal. When the magnetic bead / extracellular vesicle complex and fluorescently labeled antibody are co-incubated in a buffer system, the antibody specifically recognizes and binds to the membrane surface protein of the target biomarker. The detection of any one or two target biomarkers can be achieved by observing the change in the intensity of the fluorescence signal or by measuring the proportion of positive particles obtained by flow cytometry.

[0032] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0033] 1. The detection method of the present invention can realize the rapid extraction of extracellular vesicles (EVs). By modifying the tail end of the enzyme-free amplification probe with cholesterol molecules that have membrane-penetrating ability, the in-situ detection of microRNA inside EVs is realized. There is no need to lyse EVs to extract microRNA, thus preserving the complete surface protein structure. In addition, the membrane surface proteins can be detected in situ at the same time, which is convenient and fast and avoids the loss and error caused by the pretreatment process.

[0034] 2. The detection method of this invention optimizes the reaction system by optimizing the buffer solution, the amount of magnetic beads, and the probe modification, thereby significantly improving the sensitivity and accuracy of extracellular vesicle biomarker detection, and can detect as low as approximately 10. 8 It has a particle / mL extracellular vesicle count (lower limit of the number of extracellular vesicle particles in human plasma), which is more sensitive than existing technologies (qPCR or ELISA); the detection range for microRNA is 10 pM-10 nM, and the lowest detection limit for specific biomarkers is about 1.77 pM; and it can eliminate the interference of a large number of impurities in plasma samples, thus solving the problem of difficult accurate detection of biomarkers in complex clinical samples.

[0035] 3. This invention can simultaneously detect extracellular vesicle membrane surface proteins and internal microRNAs, providing a combination of biomarkers including CD20+miR-125b, CD63+miR-21, PD-L1+miR-21, PD-L1+miR-155, and CD20+miR-155. This solves the problem that the detection of membrane surface proteins or microRNAs alone is insufficient as a disease characterization in clinical testing, and provides new ideas and methods for the mechanisms of tumor development, tumor diagnosis, and prognosis. Attached Figure Description

[0036] Figure 1 Figure showing experimental results for optimizing the buffer system during extracellular vesicle capture;

[0037] Figure 2 The figure shows the experimental results for optimizing the amount of titanium dioxide-modified magnetic beads used in extracellular vesicle capture.

[0038] Figure 5 The effect of poly(T) bases on the performance of cholesterol-modified enzyme-free amplification probes;

[0039] Figure 3 This is a characterization diagram of extracellular vesicles stained with PKH26 dye and captured by titanium dioxide-modified magnetic beads, as observed under a confocal microscope.

[0040] Figure 4 The image shows the characterization of titanium dioxide-modified magnetic beads co-incubated with PKH26 dye under a confocal microscope.

[0041] Figure 6 This is a flowchart illustrating the process principle, which involves a multiplex in-situ detection method for extracellular vesicle biomarkers based on magnetic bead capture.

[0042] Figure 7 Graph showing the detection capability of cholesterol-modified enzyme-free amplification probes;

[0043] Figure 8 This is a graph showing the anti-interference ability test of enzyme-free amplification probes;

[0044] Figure 9 This is a confocal microscopy characterization of microRNA, a biomarker, based on in-situ detection using magnetic beads.

[0045] Figure 10 This is a fluorescence intensity measurement diagram for in-situ detection of the biomarker microRNA based on magnetic beads;

[0046] Figure 11 An optimized diagram of a closed system for in-situ detection of extracellular vesicle biomarker membrane surface proteins based on magnetic beads;

[0047] Figure 12 This is a confocal microscopy characterization of biomarker membrane surface proteins based on in-situ detection using magnetic beads;

[0048] Figure 13 Figure 1 shows the results of flow cytometry for rapid in-situ detection of dual biomarkers microRNA and membrane surface proteins based on magnetic beads;

[0049] Figure 15 Correlation analysis between in-situ detection of biomarker microRNA based on magnetic beads and gold standard quantitative PCR;

[0050] Figure 14 The graph shows the measurement results of biomarkers of extracellular vesicles at different concentrations using the corresponding methods.

[0051] Figure 16 To analyze the correlation between in-situ detection of biomarker membrane surface proteins based on magnetic beads and the gold standard ELISA;

[0052] Figure 17 Results of optimizing the buffer system for extracting extracellular vesicles from plasma using magnetic beads;

[0053] Figure 18 Confocal microscopy characterization of microRNA and membrane surface proteins, dual biomarkers of extracellular vesicles in the plasma of lymphoma patients, based on in situ detection of magnetic beads;

[0054] Figure 19 The optimized plasma-magnetic bead ratio for extracting extracellular vesicles from plasma using magnetic beads is shown in the figure.

[0055] Figure 20 A heatmap of dual biomarkers for rapid detection of clinical samples from newly diagnosed lymphoma patients, lymphoma patients in remission, and healthy individuals based on magnetic beads and flow cytometry, and a PLS-DA plot for biomarker combination screening;

[0056] Figure 21 The image shows the test results of clinical samples from newly diagnosed lymphoma patients, lymphoma patients in remission, and healthy individuals. Detailed Implementation

[0057] The technical solution provided by the present invention will be described in detail below with reference to the embodiments.

[0058] The reagents used in the following examples:

[0059] Titanium dioxide-modified magnetic beads (polystyrene microspheres loaded with superparamagnetic iron oxide nanoparticles) (5 μm, 25 mg / mL, Nanjing Dongna Biotechnology Co., Ltd., catalog number: MBTi-B-5); HEPES buffer (10 mM, pH=7.4, Shanghai Yuanye Biotechnology Co., Ltd., catalog number: R29393); PKH26 dye (Shanghai Maokang Biotechnology Co., Ltd., catalog number: MX4021); 1×PBS buffer (pH=7.4, Gibco, Thermo, catalog number: C1) 0010500BT); Tris-HCl buffer (pH=7.4, Shanghai Yuanye Biotechnology Co., Ltd., catalog number: R29929); fetal bovine serum (Gibco, Thermo, catalog number: A5256701); RPMI-1640 medium (Jiangsu Kaiji Biotechnology Co., Ltd., catalog number: KGL1501); fluorescently labeled antibodies: anti-human CD20 (Wuhan Aiboteke Biotechnology Co., Ltd., catalog number: A22152), anti-human CD63 (BioLegend, Product No.: 353006); Anti-human PD-L1 (Wuhan Aibotek Biotechnology Co., Ltd., Product No.: A22304); Anti-human CXCR4 (Wuhan Sanying Biotechnology Co., Ltd., Product No.: 98175-1-RR); miRNA extraction and purification kit (Jiangsu Kangwei Century Biotechnology Co., Ltd., Product No.: CWY113S); Reverse transcription kit (Wuhan Saiwei Biotechnology Co., Ltd., Product No.: G3330); Real-time PCR kit (Hunan Aikerui Biotechnology Co., Ltd., Product No.: AG11701); ELISA kit (anti-human CD20, CD63, Wuhan Huamei Biotechnology Co., Ltd., Product No.: CSB-E14007h, CSB-E12825h); Fluorescent substrate and BCA kit (Beyotime Biotechnology Co., Ltd., Product No.: P0205S, P0010); T-octylphenoxypolyethoxyethanol (Triton X-100) and 4-nonylphenyl-polyethylene Glycol (NP-40) (Shanghai Aladdin Biotechnology Co., Ltd., catalog number: T109027, N274285); Agarose (Biowest agarose, catalog number: BY-R0100); Goldview nucleic acid dye (Beijing Puxitang Biotechnology Co., Ltd., catalog number: S30864); Nucleic acid molecular weight standard and loading buffer (Thermo, catalog number: SM1213); Serum-free culture medium (Yisheng Biotechnology Co., Ltd., catalog number: 41210ES76).

[0060] The devices used in the following embodiments:

[0061] High-speed centrifuge (Eppendorf), ultra-high-speed centrifuge (Beckman Coulter), confocal microscope (Leica), transmission electron microscope (Thermo), nanoparticle tracer analyzer (Particle Metrix), multi-functional microplate reader (Tecan), 96-well plate (Corning), flow cytometer (Beijing Cenglang Biotechnology Co., Ltd.), electrophoresis power supply (Bio-Rad), electrophoresis tank (Beijing Liuyi Biotechnology Co., Ltd.), real-time PCR instrument (Xi'an Tianlong Technology Co., Ltd.).

[0062] Example 1: Optimization of conditions for in situ detection of extracellular vesicle markers using a kit

[0063] 1. Optimization of conditions for capturing extracellular vesicles with titanium dioxide-modified magnetic beads

[0064] (1) Optimization of the buffer system:

[0065] Raji cells (purchased from Wuhan Pronosei Life Sciences Co., Ltd.) were cultured in RPMI-1640 medium containing 10% fetal bovine serum at 37°C under humidification with 5% CO2. When the cell density reached 80% to 90%, the cells were separated from the medium and transferred to serum-free medium, where they were cultured at 37°C for another 48 hours. The Raji cell culture medium was collected and centrifuged sequentially at room temperature: 200 g for 15 min to remove cells; 2000 g for 15 min to remove cell debris; and 10,000 g for 60 min to further remove larger particles and other impurities. Then, the cells were centrifuged at 140,000 g for 90 min at 4°C, the supernatant was discarded, and the precipitate was resuspended in HEPES buffer; this was repeated again at 140,000 g for 90 min at 4°C, and the supernatant was discarded. Finally, the obtained extracellular vesicles were dispersed in HEPES buffer, 1×PBS buffer, or Tris-HCl buffer (all at a concentration of 7.2 × 10⁻⁶). 8 (particles / mL), stored at -80°C as an extracellular vesicle standard for subsequent experiments.

[0066] Raji extracellular vesicle solutions dispersed in the above-mentioned different buffer solutions were prepared in duplicate for each group. One sample was directly analyzed for concentration by nanoparticle tracer analysis, and this concentration was denoted as A0. The other sample was incubated with 5 μm titanium dioxide-modified magnetic beads (final concentration 5 mg / mL) at 37°C for 10 min. Magnetic separation (using a magnetic rack to adsorb the magnetic beads until the supernatant was completely clear) was performed. The supernatant was collected and analyzed for nanoparticle tracer analysis to obtain the concentration of extracellular vesicles in the supernatant, denoted as A1. The extraction efficiency was calculated using the following formula:

[0067] Extraction efficiency (%) = (A0 – A1) / A0 × 100%

[0068] like Figure 1 As shown, different buffer solutions resulted in varying extraction efficiencies when the extraction system was modified. PBS buffer, primarily composed of phosphate and currently used in most systems, exhibited the lowest extraction efficiency (less than 50%). HEPES buffer showed the highest extraction efficiency (approximately 90%). This indicates that buffer optimization is crucial for the extraction of extracellular vesicles from titanium dioxide magnetic beads. Therefore, the following experiments all used extracellular vesicles dispersed in HEPES buffer.

[0069] (2) Optimization of the amount of titanium dioxide modified magnetic beads:

[0070] The extraction efficiency of Raji extracellular vesicles dispersed in HEPES buffer was calculated according to the above steps, with the difference being that the amount of titanium dioxide modified magnetic beads used was 0.5, 1, 1.25, 1.5, 2, 2.5, 3, 3.5, 3.75, 4 and 5 mg respectively.

[0071] like Figure 2 As shown, as the amount of titanium dioxide-modified magnetic beads increased, an increase in extraction efficiency was observed, gradually reaching a plateau. The magnetic beads achieved a capture efficiency of nearly 90% at a dosage of approximately 3 mg. This invention utilizes titanium dioxide-modified magnetic beads for the extraction of extracellular vesicles, preserving the complete structure of the extracellular vesicles and providing a reliable sample basis for subsequent detection.

[0072] (3) Validation of titanium dioxide-modified magnetic beads capturing extracellular vesicles under preferred conditions

[0073] Extracellular vesicle solutions dispersed in HEPES buffer were stained with PKH26 dye for fluorescent labeling. Then, 5 μm titanium dioxide-modified magnetic beads (final concentration 3 mg / mL) were added, and the mixture was incubated at 37°C for 10 min. After magnetic separation, the samples containing the magnetic beads were observed under a confocal microscope. As a control, the same procedure was performed on HEPES buffer containing only PKH26 dye and without extracellular vesicles.

[0074] Confocal microscopy results as follows Figure 3 As shown, the staining results of the control group are as follows. Figure 4 As shown, Figure 3 The superposition results of mid-field and fluorescence channels demonstrate that extracellular vesicles can be captured by titanium dioxide-modified magnetic beads. Figure 4 This indicates that when PKH26 dye is incubated with magnetic beads, the dye does not stain the magnetic beads, demonstrating... Figure 3 The staining results shown are from the captured extracellular vesicles.

[0075] 2. Optimization of cholesterol-modified enzyme-free amplification probe design:

[0076] Solutions of the same concentration (200 nM) were prepared for: [A-poly(T)-Cho] (i.e., miR-155-5p detection probe hairpin probe A, nucleotide sequence as shown in SEQ ID NO.2: Cho-TTTTTTACCCCTATCACGA / iCy5 / TTAGCATTAACCATGTGTAGATTAATGCTAA-BHQ), probe A (nucleotide sequence as shown in SEQ ID NO.18: ACCCCTATCACGA / iCy5 / TTAGCATTAACCATGTGTAGATTAATGCTAA-BHQ), and a cholesterol-only modified probe (A-Cho) (nucleotide sequence as shown in SEQ ID NO.19: Cho-ACCCCTATCACGA / iCy5 / TTAGCATTAACCATGTGTAGATTAATGCTAA-BHQ). Take 10 μL of each of the three solutions mentioned above, mix them thoroughly with the loading buffer, and run the mixture on a 5% agarose gel electrophoresis system at 120 V for 40 min. Observe the gel imaging system to confirm whether the molecular structure of the probe is normal. At the same time, take 200 μL of each of the three solutions mentioned above and measure the melting curve in a real-time PCR instrument. Simultaneously, take 20 μL of each of the [A-poly(T)-Cho] and (A-Cho) solutions, add the biomarker molecule miR-155-5p (nucleotide sequence shown in SEQ ID NO.1) to a final concentration of 10 nM, and measure the change in fluorescence intensity within the system using a multi-functional microplate reader over 60 minutes at 37℃.

[0077] like Figure 5As shown, melting curve testing (left side) demonstrates that adding six additional T bases to the cholesterol-modified side is necessary to maintain the normal function of the probe. The stem structure of the hairpin probe is maintained by hydrogen bonds formed by complementary base pairing. As the temperature gradually increases, the hydrogen bonds are broken, the hairpin structure opens, and the fluorescence signal is enhanced if the probe functions normally. When probe A is only modified with cholesterol (A-Cho), no enhanced fluorescence signal is observed with increasing temperature, indicating an abnormal probe structure. In contrast, both the poly(T)-modified probe [A-poly(T)-Cho] and the original probe A show fluorescence signal release, highlighting the importance of the additional T base modification. Agarose gel electrophoresis also confirms this conclusion (middle side). Probe A (A-Cho) modified only with cholesterol shows an abnormally large molecular weight band and tail in lane 2, indicating functional abnormality. In contrast, the band in lane 3 demonstrates that the additional T base modification has a positive effect on the probe structure. Compared to the original probe A, the increased molecular weight of [A-poly(T)-Cho] is due to the additional addition of the T base and cholesterol. Similarly, the probe's performance was tested (right side figure). The rapid increase in fluorescence signal after the addition of the target molecule indicates that the poly(T)-modified probe [A-poly(T)-Cho] has normal detection function. Meanwhile, modification with only cholesterol without the addition of the T base (A-Cho) resulted in abnormal probe function, preventing fluorescence signal release, further illustrating the importance of the additional T base modification.

[0078] Example 2: In situ detection of extracellular vesicle miRNAs and surface membrane proteins using the kit.

[0079] 1. In situ detection of extracellular vesicle miRNA

[0080] (1) Design of cholesterol-modified enzyme-free amplification probes in the kit

[0081] In this embodiment, miR-155-5p (sequence shown in SEQ ID NO.1) is used as an example. Hairpin probe A and hairpin probe B designed for miR-155-5p were synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd. (all probes and biomarkers in this application were synthesized and purified by this company).

[0082] miR-155-5p (SEQ ID NO.1): UUAAUGCUAAUCGUGAUAGGGGU

[0083] miR-155-5p detection probe:

[0084] Hairpin probe A (SEQ ID NO.2): Cho-TTTTTTACCCCTATCACGA / iCy5 / TTAGC ATTAACCATGTGTAGATTAATGC TAA-BHQ

[0085] Hairpin probe B (SEQ ID NO.3): Cho-TTTTTTTGCATTAATCTACACATGGTTAATGCTAATCGTGCATGTGTAGA

[0086] Note: The underlined portion of probe A is complementary to miR-155-5p, and the thickened portion is complementary to probe B.

[0087] like Figure 6 As shown, we designed a method to simultaneously label a fluorescent luminescent group (Cy5), a fluorescence quenching group (black hole quencher, BHQ), and cholesterol molecules C. 27 H 46 The A probe of O (CAS No.: 57-88-5, Cho) was used to study the performance of the enzyme-free amplification system designed for this research. After the probe forms a hairpin structure, the fluorescent luminescent group Cy5 and the fluorescent quencher group BHQ are positioned close together in the stem-loop structure, causing fluorescence quenching of the dual-labeled probe A. When the biomarker is absent, the probe cannot be opened. When the biomarker is present, it hybridizes with probe A to open the hairpin structure, causing the fluorescent luminescent group and the fluorescent quencher group of hairpin probe A to separate spatially, resulting in fluorescence emission from the fluorescent luminescent group. Furthermore, the exposed single-stranded sequence in A can bind to hairpin probe B, further releasing the biomarker and triggering the next round of hairpin assembly reaction, thereby generating a large number of A / B double-stranded structures, resulting in a continuous enhancement of the fluorescence signal.

[0088] (2) Sensitivity detection of enzyme-free amplification probes:

[0089] The biomarker miR-155-5p (referred to as T) and its corresponding hairpin probes A and B were dissolved in HEPES buffer. Probes A and B were diluted to a final concentration of 20 nM. Different concentrations of T (10 pM-10 nM) were incubated with probes A and B at 37 °C for 0–60 min, and the fluorescence intensity was measured using a multi-functional microplate reader.

[0090] like Figure 7 As shown in the left figure, it exhibits good detection capability after 10 minutes of incubation. Figure 7 As shown in the right figure, at the 10-minute time point, a linear correlation can be observed between the fluorescence intensity (y) and the concentration (x) of the biomarker within the specified range (y = 3513x + 144.0, R0). 2=0.99), with a linear range of 10 pM-10 nM. The calculated limit of detection for this biomarker is approximately 1.77 pM.

[0091] (3) Specific detection of enzyme-free amplification probes:

[0092] Dissolve the sequence mismatch markers (mm1, mm2, mm3, nucleotide sequences as shown in SEQ ID NO. 4~6) and hairpin probes A and B separately in HEPES buffer. Hairpin probes A and B were also diluted to a final concentration of 20 nM. Add 10 nM of mm1, mm2, mm3, or T, or 0.001 nM of T (as a negative control), to the solutions of probes A and B, respectively, and incubate at 37°C for 1 hour. After the reaction, measure the fluorescence intensity using a multi-mode microplate reader.

[0093] mm1 (SEQ ID NO.4): UCCCUGAGACCCUAACUUGUGA

[0094] mm2 (SEQ ID NO.5): UAGCUUAUCAGACUGAUGUUGA

[0095] mm3 (SEQ ID NO.6): AGCAGCAUUGUACAGGGCUAUCA

[0096] like Figure 8 As shown, in the absence of biomarkers or in the presence of sequence-mismatched biomarkers, the background signal of fluorescence remains at a low level. The method employed in this invention exhibits low background signal and good detection capability, laying the foundation for subsequent in-situ detection.

[0097] (4) Confocal microscopy to verify the results of in situ detection of miRNA

[0098] The same method as in Example 1 was used to prepare a solution with a concentration of 7.2 × 10⁻⁶ ppm in 1 mL. 8 Raji extracellular vesicle solution (HEPES buffer) was prepared at 1 / mL and stained with PKH26 dye. Then, 3 mg of 5 μm titanium dioxide-modified magnetic beads were added, and the mixture was incubated at 37°C for 10 min. After magnetic separation purification, 200 nM hairpin probes A and B were added, and the mixture was incubated at 37°C for 2 h. After incubation, free hairpin probe molecules were removed by magnetic separation. The sample was then observed under a confocal microscope, and fluorescence intensity was measured using a microplate reader.

[0099] like Figure 9As shown, under a confocal microscope, extracellular vesicles labeled with PKH26 dye (green) and the detected biomarker microRNA (red) clearly exhibited significant co-localization, demonstrating the feasibility of in-situ detection of the biomarker microRNA. Figure 10 As shown, the fluorescence intensity was measured using an ELISA reader. When microRNA was detected, a significant increase in fluorescence signal was observed, further demonstrating the success of in situ detection.

[0100] 2. In-situ detection of extracellular vesicle membrane surface proteins:

[0101] The concentration obtained was 7.2 × 10⁻⁶, prepared using the same method as in Example 1. 8 Raji extracellular vesicle solution (HEPES buffer) was prepared in 5 separate tubes, each containing 1 mL of the solution. Each tube was stained with PKH26 dye, incubated with 3 mg of 5 μm titanium dioxide-modified magnetic beads at 37°C for 10 min, and then magnetically purified. Different volume fractions (0%, 0.5%, 1%, 1.5%, and 2%) of bovine serum albumin solution were added for blocking for 10 min. After magnetic purification, 10 μL of fluorescently labeled antibody (anti-human CD63 protein) was added to each tube, and the tubes were incubated at 37°C for 30 min. After incubation, free antibody was removed by magnetic separation. The samples were then observed under a confocal microscope.

[0102] like Figure 11 As shown, without the addition of bovine serum albumin (BSA), significant adsorption of fluorescent antibodies onto the magnetic bead surface was observed, resulting in excessively high background signals, which is detrimental to subsequent detection. This is because magnetic beads typically have difficulty with the non-specific adsorption of proteins such as antibodies. However, with increasing BSA concentration, a significant decrease in background signal was observed. When 0.5% (w / v) of BSA was added, the background signal decreased significantly, and this value did not decrease with further increases in BSA concentration. Therefore, 0.5% BSA was determined as the optimal concentration for detecting extracellular vesicles derived from cell culture medium.

[0103] like Figure 12 As shown, after blocking with 0.5% bovine serum albumin solution, significant colocalization of extracellular vesicles labeled with PKH26 dye (green) and the detected biomarker membrane surface protein CD63 (red) was observed under a confocal microscope, demonstrating the feasibility of in situ detection.

[0104] 3. Simultaneous in-situ detection of extracellular vesicle miRNAs and membrane surface proteins:

[0105] The concentration of 7.2 × 10⁻⁶ was obtained by the same method as in Example 1.8 Raji extracellular vesicle solution (HEPES buffer) was prepared at 1 mL. 3 mg of 5 μm titanium dioxide-modified magnetic beads were added to 1 mL of this solution and incubated at 37°C for 10 min. After magnetic separation and purification, 200 nM hairpin probes A and B were added, and the mixture was incubated at 37°C for two hours. After magnetic separation and purification, 0.5% (w / v) bovine serum albumin solution was added for blocking for 10 min. After magnetic separation and purification, 10 μL of fluorescently labeled antibody (anti-human CD20) was added, and the mixture was incubated at 37°C for 30 min. After incubation, free antibody was removed by magnetic separation. The proportion of positive particles was then detected by flow cytometry. A blank control of 5 μm titanium dioxide-modified magnetic beads was used for flow cytometry measurements.

[0106] like Figure 13 As shown, flow cytometry clearly revealed high expression of miR-155-5p and CD20 biomarkers in Raji extracellular vesicles. Furthermore, flow cytometry analysis demonstrated that these two biomarkers could be detected as having double positive co-localization, further illustrating the reliability of the method.

[0107] Example 3: Validation of the existing gold standard for in-situ detection of the kit

[0108] To verify the reliability of the method of the present invention, the results obtained by this method are now compared with those obtained by quantitative real-time PCR and ELISA.

[0109] Validation Example 1: Detection of miRNA by quantitative real-time PCR:

[0110] Raji extracellular vesicle solution (HEPES buffer) was incubated with 3 mg of 5 μm titanium dioxide-modified magnetic beads at 37°C for 10 min to prepare a magnetic bead-extracellular vesicle complex sample. This sample was then diluted to different concentrations (1×10⁻⁶). 11 2×10 10 5×10 9 1×10 9 5×10 8 The samples were processed sequentially using a miRNA extraction and purification kit, a reverse transcription kit, and a quantitative real-time PCR kit, with reactions performed according to the kit descriptions. Finally, based on gold standard quantitative real-time PCR, the cycle thresholds (Ct values) for measuring biomarkers at different concentrations were obtained.

[0111] Primer sequences used in quantitative real-time PCR (using stem-loop method):

[0112] miR-155-5p-RT (SEQ ID NO.7): GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCT

[0113] miR-155-5p-Forward (SEQ ID NO.8): CGCGTTAATGCTAATCGTGAT

[0114] miR-155-5p-Reverse (SEQ ID NO.9): ATCCAGTGCAGGGTCCGAGG

[0115] Internal Reference:

[0116] U6-Reverse (SEQ ID NO.10):AACGCTTCACGAATTTGCGT

[0117] U6-Forward (SEQ ID NO.11): CTCGCTTCGGCAGCACA

[0118] Reverse transcription procedure:

[0119] .

[0120] Verification Example 2: Detection of membrane surface proteins using ELISA:

[0121] The magnetic bead-extracellular vesicle complex sample prepared in Example 1 was diluted to different concentrations (1×10⁻⁶). 11 2×10 10 5×10 9 1×10 9 5×10 8 Extracellular vesicle membrane proteins (human CD20) were quantitatively analyzed using a gold standard ELISA. All steps were performed under constant temperature and humidity conditions at 37°C. A blank control was set up with magnetic beads without extracellular vesicles at the same concentration as the test sample. First, 100 μL of the test magnetic bead-extracellular vesicle complex or blank control was added and incubated for 2 hours, then all liquid was discarded. Next, 100 μL of biotin-labeled antibody working solution was added and incubated for 1 hour. The plate was washed 3 times, with 200 μL of wash buffer added for 2 min each time. Then, 100 μL of horseradish peroxidase-labeled avidin working solution was added to each well and incubated for 1 hour. All liquid was discarded, and the plate was washed 3 times, with 200 μL of wash buffer added for 2 min each time. Finally, 100 μL of chromogenic substrate was added to each well and incubated in the dark for 30 min. After the reaction was complete, the fluorescence signal was measured using a microplate reader.

[0122] The present invention provides a method for in situ detection of miRNAs and surface membrane proteins:

[0123] The magnetic bead-extracellular vesicle complex sample prepared in Validation Example 1 was diluted to different concentrations, corresponding to Validation Examples 1 and 2. 200 nM miR-155-5p hairpin probe A and hairpin probe B were added, and the samples were incubated at 37°C for 2 hours. After magnetic separation and purification, 0.5% (w / v) bovine serum albumin solution was added for blocking for 10 min. After magnetic separation and purification, 10 μL of fluorescently labeled antibody (anti-human CD20) was added, and the samples were incubated at 37°C for 30 min. After incubation, free antibody was removed by magnetic separation. The samples were then analyzed by flow cytometry to detect the proportion of positive particles in the corresponding fluorescent channels. Figure 14 Based on the results, a standard curve was plotted. The percentage of CD20 positive particles was Y1, Y1=-296.3 +38.45lg(X); the percentage of miR-155-5p positive particles was Y2, Y2=-204.3 + 26.89lg(X), where X is the concentration of extracellular vesicles.

[0124] The flow cytometry results were compared with the Ct value obtained in validation example 1 (the biomarker to be detected was miR-155-5p) and the fluorescence intensity value obtained in validation example 2 (the biomarker to be detected was CD20). Figure 14 Compare and perform correlation analysis: such as Figure 15 and Figure 16 As shown, for different biomarkers, the method proposed in this invention is highly consistent with the results obtained by quantitative real-time PCR and ELISA (for the biomarker miR-155-5p, R...). 2 = 0.94; for the biomarker CD20, R 2 = 0.98), and has a lower detection limit compared to quantitative PCR and ELISA (for the biomarker miR-155-5p, quantitative PCR: 1.6 × 10⁻⁶). 9 Particles / mL, this method: 7.9 × 10⁻⁶ 8 Particles / mL; for the biomarker CD20, ELISA: 1.0 × 10⁻⁶ 9 Particles / mL, this method: 7.8 × 10⁻⁶ 8 The particle count (particles / mL) demonstrates the high reliability and application potential of this method in the measurement of various biomarkers.

[0125] Example 4: Clinical application of the in situ detection kit

[0126] 1. Processing of plasma samples:

[0127] Plasma samples were collected from healthy donors, patients with newly diagnosed active lymphoma, and patients with lymphoma in remission after treatment at Zhongda Hospital Affiliated to Southeast University (ethics approval number No. 2023ZDSYLL238). Cells and cell debris were first removed by low-speed centrifugation (room temperature, 2000 g for 20 min, supernatant collected). The samples were then stored at -80 °C for subsequent use.

[0128] 2. Optimization of the detection process

[0129] (1) Optimization of the buffer system:

[0130] Two 50 μL tubes of treated healthy human plasma were resuspended in 950 μL of HEPES buffer (10 mM, pH=7.4) and placed in 1.5 mL centrifuge tubes. One tube was then given 100 μL of 0.1% NP-40 / Triton X-100 solution, while the other was left unreplenished. Next, 20 μL of titanium dioxide-modified magnetic bead solution was added directly, and the mixture was thoroughly mixed and incubated at 37°C for 20 min. After magnetic separation and purification, the CD63 content was measured using an ELISA kit, and the total protein content was measured using a BCA kit. The ratio of CD63 to total protein was calculated. The ELISA procedure was the same as in Example 3.

[0131] like Figure 17 As shown, the addition of NP40 / Triton X-100 solution is important for the construction of the buffer system. When NP40 / Triton X-100 is present, the proportion of CD63 in the total protein content increases significantly. This indicates that the addition of NP40 / Triton X-100 solution plays an important role in washing away plasma impurities adsorbed on the surface of magnetic beads, and is significant for improving the purity of the extracted extracellular vesicles.

[0132] (2) Optimization of the ratio of plasma to magnetic beads:

[0133] 50 μL of treated plasma from both healthy individuals and patients was resuspended in 950 μL of HEPES buffer (10 mM, pH 7.4) and placed in a 1.5 mL centrifuge tube. Then, 100 μL of 0.1% NP-40 / Triton X-100 solution was added, followed by the addition of different volumes (5 μL, 10 μL, 20 μL, 50 μL, 100 μL) of magnetic bead solution to adjust the plasma-to-magnetic bead volume ratio (0.5:1 to 10:1). The mixture was thoroughly mixed and incubated at 37°C for 20 min. The samples were purified by magnetic separation, washed once with 1 mL of 0.01% NP40 / Triton X-100 solution, then twice with 1 mL of HEPES buffer, and the supernatant was removed.

[0134] Subsequently, 1 μM miR-155-5p hairpin probes A and B, diluted with HEPES buffer, were added and incubated with the magnetic bead-extracellular vesicle complex at 37°C for 2 hours. Magnetic separation was then performed, followed by washing twice with HEPES buffer and removal of the supernatant. After resuspending in HEPES buffer, the sample was blocked with 0.5% (w / v) bovine serum albumin solution for 10 min. Immediately after magnetic separation purification, the sample was mixed with 10 μL of anti-CD63 fluorescent antibody and incubated at 37°C for 30 min. After washing twice, magnetic separation was performed again and the supernatant was removed. The sample was then further analyzed using flow cytometry and observed using confocal microscopy. When observing with confocal microscopy, PKH26 was added to the magnetic bead-extracellular vesicle complex obtained in the final steps for fluorescent labeling, incubated at 37°C for 10 min, and observed after magnetic separation.

[0135] like Figure 18 As shown, the direct detection of plasma from patients with newly diagnosed active lymphoma on the surface of magnetic beads was first observed using confocal microscopy. The feasibility of this method was demonstrated by the obvious co-localization of miR-155-5p (red), membrane structure (green), and CD63 (magenta).

[0136] like Figure 19 As shown, the plasma-to-magnetic-bead ratio is important for the detection results. The number of positive particles (CD63) was counted by flow cytometry. + miR-155-5p +The optimal plasma-to-magnetic-bead ratio was determined to be 2.5:1, i.e., 50 μL of plasma and 20 μL of magnetic beads. This is because the process of extracting extracellular vesicles from plasma using magnetic beads is a whole-cell sampling process; therefore, the plasma-to-magnetic-bead ratio determines the number of extracellular vesicles on each magnetic bead. When there are too many magnetic beads, the number of target biomarkers on each bead is insufficient to be resolved by flow cytometry, resulting in CD63... + miR-155-5p + The proportion of double-positive particles is relatively low. When the number of magnetic beads is insufficient, impurities in the plasma will significantly interfere with the binding of extracellular vesicles, also resulting in a low proportion of double-positive particles.

[0137] (3) Application of detection methods

[0138] Plasma was collected from healthy donors (n=12), patients with newly diagnosed active lymphoma (n=12), and patients with lymphoma in remission after treatment (n=6). 50 μL of plasma from each individual was resuspended in 950 μL of HEPES buffer (10 mM, pH=7.4) and placed in a 1.5 mL centrifuge tube. Then, 100 μL of 0.1% NP-40 / Triton X-100 solution was added. Next, 20 μL of magnetic bead solution was added directly, and the mixture was thoroughly mixed and incubated at 37°C for 20 min. The samples were purified by magnetic separation, washed once with 1 mL of 0.01% NP-40 / Triton X-100 solution, and then washed twice with 1 mL of HEPES buffer, removing the supernatant.

[0139] Subsequently, 1 μM miR-125b-5p, miR-21-5p, and miR-107 hairpin probes A and B (nucleotide sequences as shown in SEQ ID NO. 12~17) diluted with HEPES buffer were added and incubated with the magnetic bead-extracellular vesicle complex at 37°C for 2 hours. Magnetic separation was then performed, followed by washing twice with HEPES buffer and removal of the supernatant. After resuspending, the sample was immediately mixed with 10 μL of fluorescent antibody and incubated at 37°C for 30 minutes. After washing twice with HEPES buffer, magnetic separation was performed again and the supernatant was removed. The sample was then further analyzed using flow cytometry.

[0140] miR-125b-5p detection probe:

[0141] Hairpin probe A (SEQ ID NO.12): Cho-TTTTTTTCACAAGTTAGG / iCy3 / GTCTCAGGGACCATGTGTAGATCCCTGAGAC-BHQ;

[0142] Hairpin probe B (SEQ ID NO.13): Cho-TTTTTTTCAGGGATCTACACATGGTCCCTGAGACCCTAACCATGTGTAGA;

[0143] miR-21-5p detection probe:

[0144] Hairpin probe A (SEQ ID NO.14): Cho-TTTTTTTCAACATCAGT / iFAM / CTGATAAGCTACCATGTGTAGATAGCTTATCAG-BHQ;

[0145] Hairpin probe B (SEQ ID NO.15): Cho-TTTTTTGATAAGCTATCTACACATGGTAGCTTATCAGACTCCATGTGTAGA;

[0146] miR-107 detection probe:

[0147] Hairpin probe A (SEQ ID NO.16): Cho-TTTTTTTGATAGCCCTGTA / iFAM / CAATGCTGCTCCATGTGTAGAAGCAGCATTG-BHQ;

[0148] Hairpin probe B (SEQ ID NO.17): Cho-TTTTTTTGCTGCTTCTACACATGGAGCAGCATTGTACAGCATGTGTAGA.

[0149] Further, flow cytometry was used to rapidly detect 16 combinations of protein and miRNA biomarkers in 30 clinical samples, such as... Figure 20 As shown, this method has the potential for rapid detection and screening of multiple biomarkers. Partial least squares analysis (PLS-DA) reveals that biomarker combinations with a VIP Score of 1 or higher have significant potential. The scores, from highest to lowest, are: CD20+miR-125b, CD63+miR-21, PD-L1+miR-21, PD-L1+miR-155, and CD20+miR-155. Among these 16 biomarker combinations, CD20+miR-125b has the highest score, indicating the greatest potential. Figure 21As shown, testing with an additional 30 clinical samples further demonstrated that the combination of biomarkers identified by this method can effectively distinguish between healthy individuals and patients with newly diagnosed active lymphoma, as well as between patients with newly diagnosed active lymphoma and patients with lymphoma in remission after treatment (left image). This was not achieved by testing miR-125b-5p or CD20 alone (middle and right images), indicating that the dual biomarker co-detection constructed by this method has great potential in clinical applications.

Claims

1. A kit for in situ detection of extracellular vesicle markers, characterized in that, The kit includes titanium dioxide-modified magnetic beads, enzyme-free amplification probes, and fluorescently labeled antibodies. The enzyme-free amplification probes include hairpin probe A and hairpin probe B. The stem region of hairpin probe A is complementary to the target miRNA. Hairpin probe A is modified with a fluorescent luminescent group within its sequence and a fluorescent quenching group at its 3' end. Hairpin probe A and hairpin probe B are partially complementary. Both hairpin probe A and hairpin probe B are modified with -TTTTTT-cholesterol at their 3' ends. The fluorescently labeled antibody is complementary to the target surface protein.

2. The reagent kit according to claim 1, characterized in that, The extracellular vesicle markers include one or more combinations of miR-155-5p, miR-125b-5p, miR-21-5p, miR-107, CD20, CD63, PD-L1, or CXCR4.

3. The reagent kit according to claim 1, characterized in that, The fluorescent luminescent group includes one or more of Cy5, ROX, or FAM, and the fluorescent quenching group includes BHQ.

4. The reagent kit according to claim 1, characterized in that, The hairpin probe A and hairpin probe B comprise the following combinations: (1) The nucleotide sequence of hairpin probe A is shown in SEQ ID NO.2, and the nucleotide sequence of hairpin probe B is shown in SEQ ID NO.3; (2) The nucleotide sequence of hairpin probe A is shown in SEQ ID NO.12, and the nucleotide sequence of hairpin probe B is shown in SEQ ID NO.13; (3) The nucleotide sequence of hairpin probe A is shown in SEQ ID NO.14, and the nucleotide sequence of hairpin probe B is shown in SEQ ID NO.15; (4) The nucleotide sequence of hairpin probe A is shown in SEQ ID NO.16, and the nucleotide sequence of hairpin probe B is shown in SEQ ID NO.

17.

5. The detection kit according to claim 1, characterized in that, The kit also includes HEPES buffer, NP-40 / Triton X-100 solution and / or bovine serum albumin solution.

6. The detection kit according to claim 1, characterized in that, The amount of magnetic beads used is 3-5 mg of 5 μm diameter magnetic beads added to every 1 mL of extracellular vesicle solution.

7. A method for in situ detection of extracellular vesicle markers, characterized in that, The method is used for non-disease detection, and the method includes the following steps: (1) The serially diluted miRNA to be tested was co-incubated with the corresponding hairpin probe A and hairpin probe B, the fluorescence signal was detected, and the linear equation for the absolute amount of the miRNA to be tested was obtained. or, Extracellular vesicles were enriched using titanium dioxide-modified magnetic beads. The resulting magnetic bead / extracellular vesicle complex was diluted to different concentrations and co-incubated with hairpin probes A and B corresponding to the miRNA to be tested. Fluorescence signals were detected, and a linear equation for the relative amount of the miRNA to be tested was obtained. Fluorescently labeled antibodies corresponding to the surface proteins to be tested were added and incubated. Fluorescence signals were detected, and a linear equation for the relative amount of the proteins to be tested was obtained. (2) The test sample containing extracellular vesicles was enriched with titanium dioxide-modified magnetic beads. The obtained magnetic bead / extracellular vesicle complex was added to hairpin probes A and B for co-incubation, and fluorescently labeled antibody was added for co-incubation. The fluorescence signal was detected, and the content of the miRNA and / or protein to be tested was obtained by substituting it into the corresponding linear equation.

8. The method according to claim 7, characterized in that, It is used to detect extracellular vesicles containing one or more miRNAs of miR-155-5p, miR-125b-5p, miR-21-5p or miR-107, and / or containing one or more membrane surface proteins of CD20, CD63, PD-L1 or CXCR4.

9. The use of the kit according to any one of claims 1 to 6 and the detection method according to any one of claims 7 to 8 in the preparation of reagents or kits for diagnosing lymphoma.

10. The application according to claim 9, characterized in that, The application uses patient plasma for testing, and the ratio of plasma to magnetic beads is 0.5 to 10:1.

Images