Sequence set for lung cancer related methylation marker detection and application thereof

Abstract

The application discloses a sequence set for lung cancer related methylation marker detection and application thereof. The sequence set comprises a primer pair and corresponding probes, and the primer pair is used for targeted amplification of DNA fragments containing one or more CpG sites in promoter regions of PTGER4, RASSF1A and SHOX2 genes, respectively. Each primer pair comprises an upstream primer and a downstream primer, wherein the 3' end terminal base of the upstream primer is thymine, and the 3' end terminal base of the downstream primer is adenine; the probes are used for specific identification of target sequences containing methylation related CpG sites in the promoter regions of PTGER4, RASSF1A and SHOX2 genes, respectively. The application realizes specific identification and amplification of low-abundance methylation targets by optimizing key bases at the 3' end of primers and probe recognition regions; further improves the reaction buffer system, improves the stability and amplification efficiency of low-copy templates, and thus improves the specificity and accuracy of detection.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostics and nucleic acid detection technology. Specifically, it relates to a sequence set for the detection of lung cancer-related methylation biomarkers and its application. More specifically, this invention relates to sequence sets and compositions and their uses, methods for in vitro detection of methylated DNA, and kits. Background Technology

[0002] Lung cancer is one of the malignant tumors with high incidence and mortality rates worldwide. Patient prognosis is closely related to the clinical stage at diagnosis. Therefore, early screening and diagnosis are of great significance for improving early detection rates, improving patient prognosis, and reducing mortality. Currently, clinical screening and diagnosis of lung cancer mainly rely on low-dose computed tomography (LDCT) and histopathological biopsy, but both have certain limitations. Although LDCT is recommended for screening high-risk groups, its specificity is relatively low, it is prone to false positives, and it carries a certain risk of radiation exposure, making it unsuitable for high-frequency repeated screening. At the same time, LDCT mainly relies on imaging morphological characteristics for judgment, and it still has limitations in differentiating between benign and malignant nodules, identifying early occult lesions, and assessing molecular-level risks. Histopathological biopsy is an important basis for the diagnosis of lung cancer, but it is an invasive procedure that may cause complications such as bleeding and pneumothorax. Moreover, it is affected by factors such as lesion location, lesion size, and patient tolerance, making it difficult to meet the needs of large-scale screening and repeated dynamic monitoring.

[0003] In recent years, non-invasive liquid biopsy technology has become an important research direction for early screening and auxiliary diagnosis of lung cancer. Circulating tumor DNA (ctDNA) carries information on tumor-related gene mutations and epigenetic abnormalities. Among them, abnormal DNA methylation usually occurs in the early stages of tumor development and has certain tissue specificity and stability. Abnormal hypermethylation in the promoter regions of PTGER4, RASSF1A, and SHOX2 genes is closely related to the occurrence and development of lung cancer and has been used in lung cancer auxiliary diagnosis and early screening research, making it a promising ctDNA methylation biomarker. However, existing detection methods are mostly based on real-time quantitative PCR (qPCR) or methylation-specific PCR, which still have certain technical bottlenecks in early lung cancer screening: First, sensitivity and repeatability are limited. The content of ctDNA in the peripheral blood of early patients is low, and the abundance of methylated ctDNA is even lower, making it easy to miss detection; second, the quantitative ability is limited. Small fluctuations in copy number in low-copy samples may lead to result deviations, making it difficult to achieve stable and accurate absolute quantification.

[0004] In contrast, digital polymerase chain reaction (dPCR) divides the reaction system into numerous independent droplets or microwells, allowing target nucleic acid molecules to amplify in individual reaction units and achieving absolute quantification of the target molecules using a Poisson distribution model. Compared to traditional qPCR, dPCR is independent of standard curves and cycle thresholds, and features strong detection capabilities for low-abundance targets, high quantitative accuracy, and good resistance to background interference. It provides an important technological foundation for the detection of plasma ctDNA methylation biomarkers and has the potential for application in early lung cancer screening and auxiliary diagnosis.

[0005] Despite this, applying digital PCR technology to the combined detection of PTGER4, RASSF1A, and SHOX2 still faces key technical challenges: First, false positives due to incomplete bisulfite conversion. ctDNA methylation detection typically requires bisulfite conversion to distinguish between methylated and unmethylated cytosine; however, in actual testing, incompletely converted unmethylated cytosine may be misidentified as methylated cytosine, leading to non-specific amplification or false positive signals, affecting detection specificity. Second, low-abundance ctDNA is difficult to detect reliably. Peripheral blood ctDNA is characterized by short fragments, low content, easy degradation, and easy adsorption. Especially in early lung cancer samples, the target methylation template copy number is low. Conventional amplification systems may suffer from insufficient amplification efficiency, unstable repeatability, and loss of low-abundance signals under low-copy, short-fragment template conditions, making it difficult to reliably achieve the combined detection of multiple methylation targets. These problems limit the further application of existing technologies in precise non-invasive screening for early lung cancer.

[0006] Therefore, there is an urgent need in this field to establish a digital PCR detection method and reagent system that can improve the detection capability of low-copy methylated ctDNA, reduce non-specific signals caused by incomplete template transformation, and achieve stable detection of lung cancer-related methylation markers such as PTGER4, RASSF1A, and SHOX2, thereby providing a more sensitive, specific, and reproducible technical solution for early screening and auxiliary diagnosis of lung cancer. Summary of the Invention

[0007] The purpose of this invention is to address the problems of low target content, non-specific amplification, false positives due to insufficient bisulfite conversion of the template, and insufficient stability of plasma ctDNA in the detection of low-abundance ctDNA methylation. To this end, this invention provides a sequence set for the detection of lung cancer-related methylation biomarkers and its applications. The sequence set includes primer and probe sets designed for methylation-related regions of the PTGER4, RASSF1A, and SHOX2 genes. By optimizing the key bases at the 3' end of the primers and the probe recognition region, the selective amplification capability for templates fully converted by bisulfite can be enhanced, and the recognition specificity for low-abundance methylated templates can be improved, thereby reducing the risk of false positives caused by insufficient template conversion. Furthermore, by combining this with an improved reaction buffer system, the stability and amplification efficiency of low-copy ctDNA templates in the reaction system can be improved, thereby enhancing the specificity, repeatability, and accuracy of the detection.

[0008] In a first aspect of the invention, a sequence set is proposed. According to embodiments of the invention, the primer pairs respectively target and amplify DNA fragments containing one or more CpG sites in the promoter regions of the PTGER4, RASSF1A, and SHOX2 genes; each primer pair includes an upstream primer and a downstream primer, wherein the 3' terminal base of the upstream primer is thymine, and the 3' terminal base of the downstream primer is adenine; the probes respectively target and recognize sequences containing methylated CpG sites in the DNA fragments. The sequence set proposed in this invention can enhance the selective amplification capability of templates fully converted with bisulfite, achieve selective amplification and specific recognition of low-abundance methylation targets, reduce the risk of false positives caused by insufficient template conversion, improve the stability and amplification efficiency of low-copy ctDNA templates, thereby improving the specificity, repeatability, and accuracy of detection.

[0009] In a second aspect of the invention, a composition is provided. According to an embodiment of the invention, the composition comprises the set of sequences. According to an embodiment of the invention, the composition comprises at least one of the following additional technical features: According to an embodiment of the present invention, the molar ratio of the first primer pair, the second primer pair, and the third primer pair is (1~2):(1~2):(1~2).

[0010] According to an embodiment of the present invention, the molar ratio of the first primer pair, the second primer pair, the third primer pair, and the fourth primer pair is (1~2):(1~2):(1~2):(1~2).

[0011] According to an embodiment of the present invention, the molar ratio of the first primer pair, the second primer pair, the third primer pair, the first probe, the second probe, and the third probe is (2~4):(2~4):(2~4):(1~2):(1~2):(1~2).

[0012] According to an embodiment of the present invention, the molar ratio of the first primer pair, the second primer pair, the third primer pair, the fourth primer pair, the first probe, the second probe, the third probe, and the fourth probe is (2~4):(2~4):(2~4):(2~4):(1~2):(1~2):(1~2):(1~2). By optimizing the ratio of primer pairs to probes, the amplification efficiency of each target in the multiplex reaction system is balanced, thereby achieving optimal copy number detection in each channel, high signal-to-noise ratio, and thorough separation of positive and negative droplets, further ensuring the accuracy and consistency of multiplex detection.

[0013] In a third aspect of the present invention, a method for in vitro detection of methylated DNA is proposed. According to an embodiment of the present invention, the method includes: (1) performing multiplex digital PCR detection on cfDNA from a sample to be tested using the sequence set or the composition to determine whether target methylated DNA is present in the cfDNA; and (2) independently detecting the positive partition signals of the channels corresponding to the first, second, third, and / or fourth fluorescent groups, and determining the content of the methylated DNA after Poisson distribution correction based on the number of positive partitions in each channel and the total number of partitions. The method proposed in this invention supports non-invasive detection of various sample types and has high specificity, repeatability, and accuracy.

[0014] In a fourth aspect of the invention, a reagent kit is provided. According to embodiments of the invention, the reagent kit comprises the sequence set or the composition. The reagent kit proposed by the present invention supports non-invasive detection of various sample types and has high specificity, repeatability, and accuracy.

[0015] In a fifth aspect of the invention, the use of the sequence set or the composition in at least one of the following is proposed, including: (1) Nucleic acid amplification. The sequence set or composition can be used as a primer-probe combination for specific amplification in polymerase chain reaction (PCR) or digital PCR detection to achieve specific amplification and detection of target DNA fragments. By designing the 3′ end of the primer at the T / U site formed after bisulfite transformation and combining it with the probe to specifically recognize the methylated target sequence that still retains cytosine after transformation, the selective amplification ability of fully transformed target template can be improved, and the false positive signals caused by untransformed or incompletely transformed template participating in amplification can be reduced, thereby improving the specificity and accuracy of methylated DNA detection.

[0016] (2) Sequencing. The sequence set or composition can be used for targeted amplification, targeted enrichment, or sequencing library construction. Specifically, the primer sequences can be used to specifically amplify or enrich the methylation-related regions of PTGER4, RASSF1A, and SHOX2 genes and the ACTB internal reference region in the cfDNA to be tested after bisulfite conversion, and the resulting amplification products can be used for next-generation sequencing or other nucleic acid sequencing analysis to further detect the methylation status and abundance of the target region.

[0017] (3) In vitro detection of methylated DNA. The sequence set or composition can be used to construct a detection system based on digital PCR (dPCR) or real-time quantitative PCR (qPCR) for in vitro qualitative or quantitative detection of methylated DNA content in samples. Combining multiple technological innovations such as SSB-mediated single-stranded template signal multiplication mechanism and glycerol-BSA synergistic microenvironment optimization, it can accurately capture trace methylation signals with an abundance as low as 2-5 copies / system in the plasma of early lung cancer patients, achieving accurate absolute quantification of low-abundance targets.

[0018] (4) Assisted diagnosis of lung cancer. The sequence set or composition can be used to construct a molecular detection method for the auxiliary diagnosis of lung cancer. By detecting the methylation levels of PTGER4, RASSF1A, and SHOX2 genes in the plasma cfDNA of the subject, and combining it with the ACTB internal reference gene correction, it can be determined whether the subject has lung cancer.

[0019] (5) Preparation of the kit. The kit is used for in vitro detection of methylated DNA and / or diagnosis of lung cancer. The sequence set or composition can be used as a core raw material component for the preparation of standardized, commercially available detection kits. The kit contains an optimized buffer system (containing specific concentrations of Tris-HCl, glycerol, BSA, SSB, KCl, MgCl2, dNTPs and Taq DNA polymerase), premixed primer and probe combinations, positive control, negative control and instructions for use. It is suitable for droplet digital PCR platforms and has advantages such as simple operation, short detection cycle (3-4 hours), controllable cost and strong clinical applicability, which can meet the actual needs of large-scale population screening and routine clinical testing.

[0020] In a sixth aspect of the present invention, a method for assisting in the diagnosis of lung cancer is proposed. According to an embodiment of the present invention, the method includes the following steps: (1) performing multiplex PCR detection on cfDNA derived from a subject's sample using the sequence set, the composition, or the kit to determine whether target methylated DNA is present in the cfDNA. (2) independently detecting the fluorescence signals of the channels corresponding to the first, second, third, and / or fourth fluorescent groups, and determining the copy number or methylation ratio of methylated DNA based on the fluorescence signals in each channel. The method is used for the auxiliary assessment of lung cancer-related risks in subjects. The method proposed in this invention is simple to operate, has a short detection cycle (3-4 hours), is cost-controllable, and has strong clinical applicability, which can meet the actual needs of large-scale population screening and routine clinical testing. Attached Figure Description

[0021] Figure 1 This is a diagram showing the results of single amplification screening of the basic probe according to an embodiment of the present invention.

[0022] Figure 2 The results of quadruple digital PCR detection using the molecular switch design of this invention are shown in Figure A. A is a two-dimensional fluorescence scatter plot of the FAM-CY5 channel, where blue droplet clusters represent PTGER4 positive droplets, pink droplet clusters represent RASSF1A positive droplets, and red droplet clusters represent double-positive droplets of PTGER4 and RASSF1A. B is a two-dimensional fluorescence scatter plot of the VIC-ROX channel, where green droplet clusters represent ACTB positive droplets, orange droplet clusters represent SHOX2 positive droplets, and red droplet clusters represent double-positive droplets of ACTB and SHOX2.

[0023] Figure 3 The above are images of clinical sample testing results according to embodiments of the present invention. In these images, A is a two-dimensional fluorescence scatter plot of the VIC-ROX channel, where green droplet clusters are ACTB-positive droplets and orange droplet clusters are SHOX2-positive droplets; B is a two-dimensional fluorescence scatter plot of the VIC-CY5 channel, where green droplet clusters are ACTB-positive droplets and pink droplet clusters are RASSF1A-positive droplets; and C is a two-dimensional fluorescence scatter plot of the FAM-VIC channel, where blue droplet clusters are PTGER4-positive droplets and green droplet clusters are ACTB-positive droplets. Detailed Implementation

[0024] Embodiments of the present invention are described in detail below. Examples of these embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0025] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Therefore, a feature defined with "first" or "second" may explicitly or implicitly include one or more of that feature.

[0026] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0027] In this article, the term "circulating tumor DNA" (ctDNA) refers to DNA fragments released from tumor cells into body fluids, existing either in free form or in complex with proteins, and reflecting tumor genomic mutation information. cfDNA specifically refers to the portion originating from tumor cells.

[0028] In this article, the term "free deoxyribonucleic acid" (cfDNA) refers to DNA fragments released into body fluids during apoptosis or necrosis, and is mainly found in biological samples such as blood and urine.

[0029] In this paper, the term "CpG site" refers to a specific sequence pattern in genomic DNA, where a cytosine (C) is followed immediately by a guanine (G) molecule linked by a phosphodiester bond (p). CpG sites are the core target of DNA methylation research.

[0030] In this paper, the term "3' T / A molecular switch" refers to designing the key base at the 3' end of the upstream primer to correspond to uracil (U) after bisulfite conversion (recognized as thymine T during subsequent amplification), and designing the 3' end of the downstream primer to be adenine (A) complementary to U. If the unmethylated C in the template is not completely converted to U, a severe base mismatch will occur at the 3' end of the primer, and the extension reaction cannot be initiated, ensuring that only fully converted DNA can participate in amplification.

[0031] It should be noted that in this invention, the nucleotide sequence of the primers is designed based on the target nucleic acid sequence after bisulfite conversion. Specifically, after bisulfite treatment, the unmethylated cytosine (C) in the target nucleic acid undergoes a deamination reaction to convert to uracil (U). In the subsequent PCR amplification process, the uracil (U) is recognized by DNA polymerase as thymine (T), that is, U is read and replicated as T in the amplification product. Those skilled in the art should understand that primers designed with uracil (U) in the bisulfite-converted sequence as a reference are functionally equivalent to primers synthesized with thymine (T) as the corresponding base. Therefore, the above-mentioned substitution of U and T in the primer sequence does not change the hybridization specificity of the primer with the transformed target sequence; the two can be considered as equivalent substitutions in function and both fall within the scope of this invention.

[0032] In this paper, "U / T site" refers to a nucleotide position that is uracil (U) on the template strand after bisulfite treatment, but will (or should) be read as thymine (T) in the subsequent PCR amplification product.

[0033] In this article, the term "copy number" or "copies" refers to the number of a gene in the genome, with single copies being a single copy and multiple copies being multiple copies.

[0034] In this paper, the term "sense strand" refers to the nucleotide chain in the DNA double helix that carries the amino acid sequence encoding the protein, also known as the sense strand, coding strand, or positive strand, whose base sequence is identical to that of the transcribed mRNA (only T is replaced by U).

[0035] In this paper, the term "antisense strand" refers to the strand of the DNA double helix that is complementary to the transcription template. The definition varies in different literature: early literature referred to the transcription template strand as the sense strand and its complementary strand as the antisense strand; while recent literature mostly defines the non-template strand as sense DNA (coding strand) and the template strand as antisense DNA.

[0036] In this article, the term "UNG enzyme" refers to uracil-N-glycosylation enzyme, also known as uracil DNA glycosylation enzyme (UDG), which is a glycosylation enzyme that specifically catalyzes the breaking of uracil glycosidic bonds in DNA.

[0037] In this paper, the term "locked nucleic acid" refers to a chemically modified RNA nucleotide derivative in which the 2'-O and 4'-C positions of the ribose form a bicyclic structure via a methylene bridge, thereby fixing the furanose conformation.

[0038] In this paper, the term "identity" refers to the sequence matching between two nucleotides.

[0039] This application achieves highly specific capture of low-abundance methylation targets by optimizing primers and probes, significantly reducing the risk of false positives. In addition, by combining improved buffer system components, it effectively solves the technical bottleneck of extremely low abundance, easy degradation, and easy adsorption of ctDNA in clinical plasma, while significantly improving detection specificity and accuracy.

[0040] sequence set In embodiments of the present invention, a sequence set is proposed. According to an embodiment of the present invention, the primer pairs respectively target and amplify DNA fragments containing one or more CpG sites in the promoter regions of the PTGER4, RASSF1A, and SHOX2 genes; each primer pair includes an upstream primer and a downstream primer, wherein the 3' terminal base of the upstream primer is thymine, and the 3' terminal base of the downstream primer is adenine; the probes respectively target and recognize sequences containing methylated CpG sites in the DNA fragments.

[0041] According to embodiments of the present invention, the sequence set includes primer sets and probe sets targeting methylation-related regions in the promoter regions of the PTGER4, RASSF1A, and SHOX2 genes. The primer sets include primer pairs targeting the PTGER4, RASSF1A, and SHOX2 genes, respectively, each primer pair including an upstream primer and a downstream primer. The 3' terminal base of the upstream primer is thymine, and the 3' terminal base of the downstream primer is adenine, used to enhance the selective amplification capability of templates fully converted by bisulfite. The probe set includes probes targeting target sequences containing methylation-related CpG sites in the promoter regions of the PTGER4, RASSF1A, and SHOX2 genes, respectively, and achieves specific detection of the target methylated template by recognizing methylated CpG sites that remain cytosine after bisulfite treatment.

[0042] According to an embodiment of the present invention, the primer pair comprises a first primer pair, the first primer pair including a first upstream primer and a first downstream primer; a second primer pair, the second primer pair including a second upstream primer and a second downstream primer; and a third primer pair, the third primer pair including a third upstream primer and a third downstream primer; the first upstream primer includes SEQ ID NO:1 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:1; the first downstream primer includes SEQ ID NO:2 or a nucleotide sequence having 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:2; the second upstream primer includes SEQ ID NO:4 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:2; and the second upstream primer includes SEQ ID NO:4 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:1. The nucleotide sequence shown in NO:4 has at least 70%, 75%, 80%, 85%, 90%, 95%, and 99% identity; the second downstream primer includes SEQ ID NO:5 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, and 99% identity with the nucleotide sequence shown in SEQ ID NO:5; the third upstream primer includes SEQ ID NO:7 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, and 99% identity with the nucleotide sequence shown in SEQ ID NO:7; the third downstream primer includes SEQ ID NO:8 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, and 99% identity with the nucleotide sequence shown in SEQ ID NO:8.

[0043] According to embodiments of the present invention, the sequence set includes at least one of the following additional technical features: According to an embodiment of the present invention, the first upstream primer and the first downstream primer are set at the TCGGTTGTTTTTCGGGGTTATTTCGTTGTTTTTTTAGTTTTGTCGCGTTTTAGCGATTTTCGGCGTCGTCGGAGTTTTCGTCGTATCGCGGGCGTCGAGATTTAG site (after transformation); the second upstream primer and the second downstream primer are set at the AGTTCGGGGTTCGTTTTGTGGTTTCGTTCGGTTCGCGTTTGTTAGCGTTTAAAGTTAGCGAAGTACGGGTTTAATCGGGTTATGTCGGGGGAGTTTGAG site (after transformation); and the third upstream primer and the third downstream primer are set at the TGTGTCGTATAGGGAGTCGTATTCGTAGACGTTTTTCGTTGTTTTTGGGTTCGGGTTAAATTTTGTATAAGGTTTTTTGGATAGTTAGGTAATTTTCGTTTCGTTTGTTCGATCGGGGTCGTACGA site (after transformation).

[0044] According to embodiments of the present invention, the primers target the aforementioned sites and exhibit good specificity and high amplification efficiency.

[0045] It should be noted that when performing target gene methylation detection, the DNA sample must first undergo bisulfite conversion. During this conversion, only unmethylated cytosine (C) is converted to uracil (U), while methylated cytosine remains unchanged. Therefore, there is a definite correspondence between the target gene sequence before and after conversion, and the two sequences can be deduced from each other.

[0046] According to an embodiment of the present invention, the DNA fragment of PTGER4 has a nucleotide sequence as shown in SEQ ID NO:10.

[0047] According to an embodiment of the present invention, the DNA fragment of RASSF1A has a nucleotide sequence as shown in SEQ ID NO:11.

[0048] According to an embodiment of the present invention, the DNA fragment of SHOX2 has a nucleotide sequence as shown in SEQ ID NO:12.

[0049] According to embodiments of the present invention, for the target sequences of PTGER4, RASSF1A, SHOX2, and ACTB, the present invention first selects the promoter regions or methylation-related regions of each gene as candidate detection regions, and then screens target sequences based on the sequence characteristics after bisulfite transformation. For methylation targets, regions containing multiple CpG sites and where the methylated and unmethylated templates show a clear base difference after transformation are preferred; for the ACTB internal reference gene, conserved regions that can be stably amplified after transformation and can reflect the amount of sample DNA input and transformation quality are preferred, and may be excluded. The following principles are considered comprehensively during the candidate sequence screening process: (1) The candidate target region should contain CpG sites that can be used for methylation recognition, and the CpG sites are preferably located in the probe coverage area, near the 3' end of the primer, or in a position that can be used to construct a molecular switch recognition structure, so as to enhance the ability to distinguish between methylated templates and non-methylated templates.

[0050] (2) The candidate region should have appropriate sequence complexity after conversion with bisulfite to avoid excessively long continuous single bases, excessively high or low GC content, excessive repetitive sequences and obvious secondary structure regions, so as to reduce non-specific amplification and background signal.

[0051] (3) The length of the candidate amplification fragment should be suitable for plasma cfDNA detection, and shorter amplification fragments are preferred to improve the amplification efficiency of fragmented cfDNA and low abundance ctDNA templates.

[0052] (4) Candidate primer regions should avoid highly homologous regions and sequences with high repetition between different targets as much as possible, and avoid primer complementarity, primer dimer, probe cross hybridization and target cross amplification.

[0053] (5) The probe design region should cover the key methylation recognition sites and have good hybridization specificity and fluorescence signal separation ability; if necessary, LNA modification should be introduced at the CpG recognition base or its adjacent position to improve the recognition stability of the probe on the target methylation template.

[0054] (6) When designing molecular switch primers, the key recognition bases should be placed at the 3' end of the primer or its adjacent region according to the base differences between methylated templates, unmethylated fully converted templates and incompletely converted templates. This will enable the primers to extend effectively only on the target methylated and fully converted templates, thereby reducing false positive amplification caused by unmethylated templates and incompletely converted templates.

[0055] (7) For the same candidate target region, multiple sets of conventional candidate primer-probe combinations can be designed first, and their amplification efficiency, fluorescence clustering, background signal, positive signal, copy number stability and cross-reaction can be compared. After obtaining a candidate combination with better performance, the primers or probes can be extended, shortened or finely adjusted in position based on their binding region to form an optimized combination with molecular switch effect.

[0056] (8) The optimized primer-probe combination of the molecular switch should simultaneously meet the requirements of stable amplification of positive template, no obvious false positives of non-methylated template, low interference of incomplete transformation template, clear separation of four-channel fluorescence signal and good compatibility of multiplex digital PCR system.

[0057] Based on the above principles, this invention conducted extensive screening of candidate target regions such as PTGER4, RASSF1A, SHOX2, and ACTB, and further designed multiple sets of candidate primer-probe combinations. By comparing the amplification performance, signal separation, low copy detection capability, and cross-reactivity of different combinations, a molecular switch primer-probe combination suitable for digital PCR detection of plasma cfDNA methylation was finally obtained.

[0058] According to an embodiment of the present invention, the probe comprises: a first probe, a second probe, and a third probe, wherein the first probe comprises a nucleotide sequence of SEQ ID NO:3 or having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:3; the second probe comprises a nucleotide sequence of SEQ ID NO:6 or having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:9; and the third probe comprises a nucleotide sequence of SEQ ID NO:9 or having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:9. Provided the primers ensure complete template transformation, only the methylated C (5mC) will bind to the probe to generate a fluorescent signal, further locking onto the specific detection target.

[0059] According to embodiments of the present invention, the above-mentioned sequence set may further include at least one of the following additional technical features: According to an embodiment of the present invention, the sequence set further includes a fourth primer pair and a fourth probe for detecting one or more internal reference genes.

[0060] According to embodiments of the present invention, the internal reference gene includes at least one selected from the following: ACTB (β-actin), GAPDH, 18S rDNA, and HPRT1. By introducing the internal reference gene and its primer probes, effective monitoring of sample quality and loading volume is achieved, ensuring the accuracy and reliability of the detection results.

[0061] According to a preferred embodiment of the present invention, the internal reference gene is selected from ACTB.

[0062] According to an embodiment of the present invention, the internal reference gene has a nucleotide sequence as shown in SEQ ID NO:16.

[0063] According to an embodiment of the present invention, the fourth primer pair includes a fourth upstream primer and a fourth downstream primer. The fourth upstream primer includes SEQ ID NO:13 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:13. The fourth downstream primer includes SEQ ID NO:14 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:14.

[0064] According to an embodiment of the present invention, the fourth probe comprises SEQ ID NO:15 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the nucleotide sequence shown in SEQ ID NO:15.

[0065] According to an embodiment of the present invention, at least one of the first probe, the second probe, the third probe, and the fourth probe carries a fluorescent group and a quenching group.

[0066] According to an embodiment of the present invention, the first probe carries a first fluorescent group and a quenching group, the second probe carries a second fluorescent group and a quenching group, the third probe carries a third fluorescent group and a quenching group, and the fourth probe carries a fourth fluorescent group and a quenching group.

[0067] According to embodiments of the present invention, the first, second, third, and fourth fluorescent groups include at least one selected from the following: FAM, SYBR Green I, FITC, VIC, HEX, JOE, ROX, Texas Red, or Cy5. By assigning different fluorescent groups to different targets, multiplex fluorescence detection of four genes—SHOX2, RASSF1A, PTGER4, and ACTB—is achieved in a single-tube reaction system.

[0068] According to an embodiment of the present invention, the quenching group includes at least one selected from the following: BHQ1, BHQ2 or BHQ3.

[0069] According to an embodiment of the present invention, the fluorescent group and / or quenching group are located at the 3' end or 5' end of the probe.

[0070] According to an embodiment of the present invention, the fluorescent group is located at the 5' end of the probe.

[0071] According to an embodiment of the present invention, the quenching group is located at the 3' end of the probe.

[0072] According to an embodiment of the present invention, the first, second, third, and fourth probes carry different fluorescent groups. By assigning different fluorescent groups to different targets, multiplex fluorescence detection of four genes—SHOX2, RASSF1A, PTGER4, and ACTB—is achieved in a single-tube reaction system. The fluorescence signals of each channel are read independently without interference. Combined with the droplet detection technology of the digital PCR platform, absolute quantification of each target can be performed based on the Poisson distribution principle, without relying on a standard curve, thus avoiding systematic errors introduced by the preparation and operation of standards.

[0073] Composition In an embodiment of the present invention, a composition is provided. According to an embodiment of the present invention, the composition comprises the sequence set.

[0074] According to embodiments of the present invention, the composition includes at least one of the following additional technical features: According to an embodiment of the present invention, the molar ratio of the first primer pair, the second primer pair, and the third primer pair is (1~2):(1~2):(1~2). For example, the molar ratio of the first primer pair, the second primer pair, and the third primer pair is 1:1:1, 1:1:1.5, 1:1:2, 1:1.5:1, 1:1.5:1.5, 1:1.5:2, 1:2:1, 1:2:1.5, 1:2:2, 1.5:1:1, 1.5:1:1.5, 1.5:1:2, 1.5:1.5:1.5, 1.5:1.5:2, 1.5:2:1, 1.5:2:1.5, 1.5:2:2, 2:1:1, 2:1:1.5, 2:1:2, 2:1.5:1, 2:1.5:1.5, 2:1.5:2, 2:2:1, 2:2:1.5, or 2:2:2. Therefore, when the above molar ratio is achieved, the primer pair can effectively detect the copy number of each channel with a high signal-to-noise ratio.

[0075] According to an embodiment of the present invention, the molar ratio of the first primer pair, the second primer pair, the third primer pair, and the fourth primer pair is (1~2):(1~2):(1~2):(1~2). Exemplarily, the molar ratio of the first primer pair, the second primer pair, the third primer pair, and the fourth primer pair is 1:1:1:1, 1:1:1:1.5, 1:1:1:2, 1:1:1.5:1, 1:1:1.5:1.5, 1:1:1.5:2, 1:1:2:1, 1:1:2:1.5, 1:1:2:2, 1:1.5:1:1, 1:1.5:1:1.5, 1:1.5:1:2, 1:1.5:1.5:1.5, 1:1. 5:1.5:2, 1:1.5:2:1, 1:1.5:2:1.5, 1:1.5:2:2, 1:2:1:1, 1:2:1:1.5, 1:2:1:2, 1:2:1.5:1, 1:2:1.5:1.5, 1:2:1.5:2, 1:2:2:1, 1:2:2:1.5, 1:2:2:2, 1.5:1:1:1, 1.5:1:1:1.5, 1.5:1:1:2, 1.5:1:1.5:1.5 1.5:1:1.5:2, 1.5:1:2:1, 1.5:1:2:1.5, 1.5:1:2:2, 1.5:1.5:1:1, 1.5:1.5:1:1.5, 1.5:1.5:1:2, 1.5:1.5:1.5:1, 1.5:1.5:1.5:1.5, 1.5:1.5:1.5:2, 1.5:1.5:2:1, 1.5:1.5:2:1.5, 1.5:1.5:2:2, 1.5:2:1:1, 1.5:2: The molar ratios are 1:1.5, 2:1.5:1:1.5, 2:1.5:1:2, 2:1.5:1.5:1, 2:1.5:1.5:1.5, 2:1.5:1.5:2, 2:1.5:2:1, 2:1.5:2:1.5, 2:1.5:2:2, 2:2:1:1, 2:2:1:1.5, 2:2:1:2, 2:2:1.5:1, 2:2:1.5:1.5, 2:2:1.5:2, 2:2:2:1, 2:2:2:1.5, or 2:2:2:2. Therefore, with the above molar ratios, the primer pairs can more effectively detect the copy number of each channel, resulting in a higher signal-to-noise ratio.

[0076] According to an embodiment of the present invention, the molar ratio of the first primer pair, the second primer pair, the third primer pair, the first probe, the second probe, and the third probe is (2~4):(2~4):(2~4):(1~2):(1~2):(1~2). For example, the molar ratios of the first primer pair, the second primer pair, the third primer pair, the first probe, the second probe, and the third probe are 2:2:2:1:1:1, 2:2:2:1:1:2, 2:2:2:1:2:1, 2:2:2:1:2:2, 2:2:2:2:1:1, 2:2:2:2:1:2, 2:2:2:2:2:1:2, 2:2:2:2:2:1, 2:2:2:2:2:2:2, 2:2:3:1:1:1, 2:2:3:1:1:2, 2:2:3:1:2:1, 2:2:3:1:2:2, 2:2:3:2:1:1, 2:2:3:2:1:2, 2:2:3:2:2:1, 2:2 :3:2:2:2、2:2:4:1:1:1、2:2:4:1:1:2、2:2:4:1:2:1、2:2:4:1:2:2、2:2:4:2:1:1、2:2:4:2:1:2、2:2:4:2:2:1、2:2:4:2:2:2、2:3:2:1:1:1、2:3:2:1:1:2、2:3:2:1:2:1、2:3:2:1:2:2、2:3:2:2:1:1、2:3:2:2:1:2、2:3:3:2:2:1、2:3:3:2:2:2、2:3:4:1:1:1、2:3:4:1:1:2、2: 3:4:1:2:1, 2:3:4:1:2:2, 2:3:4:2:1:1, 2:3:4:2:1:2, 3:2:2:2:2:1, 3:2:2:2:2:2, 3:2:3:1:1:1, 3:2:3:1:1:2, 3:2:3:1:2:1, 3:2:3:1:2:2, 3:2:3:2:1:1, 3:2:3:2:1:2, 4:3:3:2:2:1, 4:3:3:2:2:2, 4:3:4:1:1:1, 4:3:4:1:1:2, 4:3:4:1:2:1, 4:3:4:1:2:2, 4:3:4:2:1:1, 4 :3:4:2:1:2, 4:3:4:2:2:1, 4:3:4:2:2:2, 4:4:2:1:1:1, 4:4:2:1:1:2, 4:4:2:1:2:1, 4:4:2:1:2:2, 4:4:2:2:1:1, 4:4:2:2:1:2, 4:4:2:2:2:1, 4:4:2:2:2:2, 4:4:3:1:1:1, 4:4:3:1:1:2, 4:4:3:1:2:1, 4:4:3:1:2:2, 4:4:3:2:1:1, 4:4:3:2:1:2, 4:4:4:2:2:1 or 4:4:4:2:2:2.Therefore, with the above molar ratio, the primer pair can more effectively detect the copy number of each channel, and the signal-to-noise ratio is further improved.

[0077] According to an embodiment of the present invention, the molar ratio of the first primer pair, the second primer pair, the third primer pair, the fourth primer pair, the first probe, the second probe, the third probe, and the fourth probe is (2~4):(2~4):(2~4):(2~4):(1~2):(1~2):(1~2):(1~2). By optimizing the ratio of primer pairs to probes, the amplification efficiency of each target in the multiplex reaction system is balanced, thereby achieving optimal copy number detection in each channel, the highest signal-to-noise ratio, and thorough separation of positive and negative droplets, further ensuring the accuracy and consistency of multiplex detection.

[0078] Detection methods In an embodiment of the present invention, a method for in vitro detection of methylated DNA is provided. According to an embodiment of the present invention, the method includes: (1) Multiplex PCR detection of cfDNA using the sequence set or the composition, wherein the cfDNA is derived from the sample to be tested and contains methylated DNA.

[0079] (2) The fluorescence signals of the first, second, third, and / or fourth fluorescent channels are detected independently, and the copy number or methylation ratio of methylated DNA is determined based on the fluorescence signals. The fluorescence signals include the number of positive partitions and the total number of partitions, and are corrected for Poisson distribution to determine the content of the methylated DNA, which is used for the auxiliary assessment of the subject's lung cancer-related risk.

[0080] According to embodiments of the present invention, the method supports non-invasive detection of various sample types.

[0081] According to an embodiment of the present invention, the sample to be tested includes at least one of the following: blood, plasma, serum, cells, tissue, saliva, or feces.

[0082] According to an embodiment of the present invention, the multiplex PCR amplification includes at least one of the following additional technical features: According to an embodiment of the present invention, the amplification system of the multiplex PCR includes at least one of the following: single-stranded DNA binding protein, bovine serum albumin, and glycerol. By introducing key enhancing components such as SSB, BSA, and glycerol, SSB can specifically bind to the denatured single-stranded DNA template, prevent the sense and antisense strands from rapidly returning to their original positions and eliminate secondary structures, allowing the single-stranded template to be physically distributed into different droplets for independent amplification during droplet generation, effectively increasing the detection copy number by more than 50%; glycerol adjusts the viscosity of the system to ensure the physical stability of the droplets during thermal cycling and reduces droplet fusion and clumping; BSA seals the reaction interface to reduce the non-specific adsorption loss of trace ctDNA. The synergistic effect of these three components significantly improves the detection capability and detection stability of low-abundance templates.

[0083] According to an embodiment of the present invention, in the multiplex PCR amplification system, the working concentration of glycerol is 4% to 6%. Exemplarily, the working concentration of glycerol is 4%, 4.5%, 5%, 5.5%, or 6%, or a range between any two of the above values, such as 4% to 5.5%, 4% to 5%, 4% to 4.5%, 4.5% to 6%, 4.5% to 5.5%, 4.5% to 5%, 5% to 6%, 5% to 5.5%, or 5.5% to 6%. According to a preferred embodiment of the present invention, the working concentration of glycerol is 4%, which effectively increases the viscous resistance of the aqueous phase and enhances the mechanical strength of the droplet membrane.

[0084] According to an embodiment of the present invention, in the multiplex PCR amplification system, the working concentration of bovine serum albumin is 0.15% to 0.5%. Exemplarily, the working concentration of bovine serum albumin is 0.15%, 0.2%, 0.3%, 0.4%, or 0.5%, or a range between any two of the above values, such as 0.2% to 0.5%, 0.3% to 0.5%, 0.4% to 0.5%, 0.15% to 0.4%, 0.2% to 0.4%, 0.3% to 0.4%, 0.15% to 0.3%, 0.2% to 0.3%, or 0.15% to 0.2%. According to a preferred embodiment of the present invention, the working concentration of bovine serum albumin is 0.2% to 0.4%. This concentration range can effectively passivate the reaction vessel wall and the oil-water interface of the droplets, preventing trace amounts of ctDNA from being lost due to adsorption.

[0085] According to an embodiment of the present invention, the working concentration of the single-stranded DNA binding protein in the multiplex PCR amplification system is 2-4 ng / μL. Exemplarily, the working concentration of the single-stranded DNA binding protein is 2, 2.5, 3, 3.5, or 4 ng / μL, or a range between any two of the above values, such as 2.5-4, 3-4, 3.5-4, 2-3.5, 2.5-3.5, 3-3.5, 2-3, 2.5-3, or 2-2.5 ng / μL. According to a preferred embodiment of the present invention, the working concentration of the single-stranded DNA binding protein is 2.5-3.5 ng / μL. This concentration range effectively prevents rapid re-annealing between complementary strands and the formation of secondary structures. This mechanism not only protects the integrity of the single-stranded template, but more importantly, it promotes the physical allocation of the sense and antisense strands of the original double-stranded DNA molecule into different microdroplets for independent amplification during droplet generation.

[0086] According to an embodiment of the present invention, the amplification system of the multiplex PCR further includes at least one of the following: PCR buffer, DNA polymerase, dNTPs or ddH2O.

[0087] According to an embodiment of the present invention, the PCR buffer comprises at least one selected from the following: Tris-HCl, K + or Mg 2+ .

[0088] According to an embodiment of the present invention, the Mg in the multiplex PCR amplification system 2+ The working concentration is 5~7mM, for example, the Mg 2+ The working concentration is 5, 5.5, 6, 6.5, or 7 mM. According to a preferred embodiment of the present invention, the Mg... 2 + The working concentration is 6 mM.

[0089] According to an embodiment of the present invention, the working enzyme amount of the DNA polymerase in the multiplex PCR amplification system is 3U to 4U. Exemplarily, the working enzyme amount of the DNA polymerase is 3U, 3.2U, 3.4U, 3.5U, 3.6U, 3.8U or 4U. According to a preferred embodiment of the present invention, the working enzyme amount of the DNA polymerase is 3U.

[0090] According to an embodiment of the present invention, the reaction program for the multiplex PCR is 94℃~96℃ for 10 min, for one cycle; 93℃~95℃ for 30 s, 55℃~65℃ for 60 s, for 45~55 cycles. This program is highly compatible with the droplet detection system of the digital PCR platform.

[0091] According to an embodiment of the present invention, the methylated DNA includes at least one selected from the following: PTGER4, RASSF1A, SHOX2.

[0092] Reagent test kit In an embodiment of the present invention, a kit is provided. According to an embodiment of the present invention, the kit includes the sequence set or the composition.

[0093] According to an embodiment of the present invention, the kit includes at least one of the following additional technical features: According to an embodiment of the present invention, the working concentration of the upstream primer and / or downstream primer is 300-500 nM. Exemplarily, the working concentration of the upstream primer and / or downstream primer is 300, 350, 400, 450, or 500 nM, or a range between any two of the above values, such as 350-500, 400-500, 450-500, 300-450, 350-450, 400-450, 300-400, 350-400, or 300-350 nM. According to a preferred embodiment of the present invention, the working concentration of the upstream primer and / or downstream primer is 350-450 nM.

[0094] According to an embodiment of the present invention, the working concentration of the probe is 100~300 nM. Exemplarily, the working concentration of the probe is 100, 150, 200, 250, or 300 nM, or a range between any two of the above values, such as 150~300, 200~300, 250~300, 100~250, 150~250, 200~250, 100~200, 150~200, or 100~150 nM. According to a preferred embodiment of the present invention, the working concentration of the probe is 200 nM.

[0095] Those skilled in the art will understand that the ratio of the primer pairs and probes can achieve a balanced amplification efficiency for each target in the multiplex reaction system, thereby optimizing the copy number detection of each channel, achieving a high signal-to-noise ratio, and ensuring thorough separation of positive and negative droplets, further guaranteeing the accuracy and consistency of multiplex detection.

[0096] According to embodiments of the present invention, the method further includes at least one of single-stranded DNA binding protein, bovine serum albumin, and glycerol. By introducing key enhancing components such as SSB, BSA, and glycerol, SSB can specifically bind to denatured single-stranded DNA templates, preventing rapid retracement of the sense and antisense strands and eliminating secondary structures, allowing the single-stranded template to be physically distributed into different droplets for independent amplification during droplet generation, effectively increasing the detection copy number by more than 50%; glycerol adjusts the viscosity of the system to ensure the physical stability of the droplets during thermal cycling, reducing droplet fusion and clumping; BSA seals the reaction interface to reduce the non-specific adsorption loss of trace ctDNA. The synergistic effect of these three components significantly improves the detection capability and detection stability of low-abundance templates.

[0097] According to an embodiment of the present invention, the working concentration of glycerol is 4% to 6%. Exemplarily, the working concentration of glycerol is 4%, 4.5%, 5%, 5.5%, or 6%, or a range between any two of the above values, such as 4% to 5.5%, 4% to 5%, 4% to 4.5%, 4.5% to 6%, 4.5% to 5.5%, 4.5% to 5%, 5% to 6%, 5% to 5.5%, or 5.5% to 6%. According to a preferred embodiment of the present invention, the working concentration of glycerol is 4%, which effectively increases the viscous resistance of the aqueous phase and enhances the mechanical strength of the droplet film.

[0098] According to an embodiment of the present invention, the working concentration of bovine serum albumin is 0.15% to 0.5%. Exemplarily, the working concentration of bovine serum albumin is 0.15%, 0.2%, 0.3%, 0.4%, or 0.5%, or a range between any two of the above values, such as 0.2% to 0.5%, 0.3% to 0.5%, 0.4% to 0.5%, 0.15% to 0.4%, 0.2% to 0.4%, 0.3% to 0.4%, 0.15% to 0.3%, 0.2% to 0.3%, or 0.15% to 0.2%. According to a preferred embodiment of the present invention, the working concentration of bovine serum albumin is 0.2% to 0.4%. This concentration range can effectively passivate the reaction vessel wall and the oil-water interface of the droplets, preventing the loss of trace amounts of ctDNA due to adsorption.

[0099] According to an embodiment of the present invention, the working concentration of the single-stranded DNA binding protein is 2-4 ng / μL. Exemplarily, the working concentration of the single-stranded DNA binding protein is 2, 2.5, 3, 3.5, or 4 ng / μL, or a range between any two of the above values, such as 2.5-4, 3-4, 3.5-4, 2-3.5, 2.5-3.5, 3-3.5, 2-3, 2.5-3, or 2-2.5 ng / μL. According to a preferred embodiment of the present invention, the working concentration of the single-stranded DNA binding protein is 2.5-3.5 ng / μL. This concentration range effectively prevents rapid re-annealing between complementary strands and the formation of secondary structures. This mechanism not only protects the integrity of the single-stranded template, but more importantly, it promotes the physical allocation of the sense and antisense strands of the original double-stranded DNA molecule into different microdroplets for independent amplification during droplet generation.

[0100] According to an embodiment of the present invention, the kit further includes at least one of the following: PCR buffer, DNA polymerase, dNTPs or ddH2O.

[0101] According to an embodiment of the present invention, the PCR buffer comprises at least one selected from the following: Tris-HCl, K + or Mg 2+ .

[0102] According to an embodiment of the present invention, the kit further includes an instruction manual describing the method for in vitro detection of methylated DNA.

[0103] use In embodiments of the present invention, the use of the sequence set or the composition in nucleic acid amplification is proposed. The sequence set or composition can be used as a specific amplification primer-probe combination in polymerase chain reaction (PCR) technology to achieve efficient and specific amplification of target DNA fragments. Through the synergistic mechanism of "T / A molecular switch design with the 3' end of the primer positioned at the U / T site after bisulfite conversion" and "probe specific recognition of methylated CpG target sequences that retain C after conversion," the selective amplification and detection capability for fully converted methylated target templates is enhanced, reducing false positive signals caused by unconverted or incompletely converted templates participating in amplification. This reduces the risk of unmethylated C being misjudged as methylated signals due to incomplete conversion, thereby improving the specificity and accuracy of methylated DNA detection.

[0104] In embodiments of the present invention, the use of the sequence set or the composition in sequencing is proposed. The sequence set or composition can be used as a targeted capture probe or amplification primer in next-generation sequencing (NGS) or third-generation sequencing technologies to achieve targeted enrichment and deep sequencing of specific regions of the PTGER4, RASSF1A, SHOX2, and ACTB genes. Utilizing its high specificity recognition capability, it accurately captures methylated target sequences after bisulfite conversion, providing a high-quality, low-background template source for subsequent high-throughput sequencing analysis, suitable for large-scale methylomics studies and clinical screening.

[0105] In embodiments of the present invention, the use of the sequence set or the composition in the in vitro detection of methylated DNA is proposed. The sequence set or composition can be used to construct a detection system based on digital PCR (dPCR) or real-time quantitative PCR (qPCR) for the qualitative or quantitative detection of methylated DNA content in samples in vitro. Combining multiple technological innovations such as SSB-mediated single-stranded template signal multiplication mechanism and glycerol-BSA synergistic microenvironment optimization, it is possible to accurately capture trace methylation signals with abundances as low as 2-5 copies / system in the plasma of early-stage lung cancer patients, achieving precise absolute quantification of low-abundance targets.

[0106] In embodiments of the present invention, the use of the sequence set or the composition in the diagnosis of lung cancer is proposed. The sequence set or composition can be used to construct a molecular detection method for the auxiliary diagnosis of lung cancer, which determines whether the subject has lung cancer by detecting the methylation levels of PTGER4, RASSF1A, and SHOX2 genes in the plasma cfDNA of the subject, combined with ACTB internal reference gene correction.

[0107] In embodiments of the present invention, the use of the sequence set or the composition in the preparation of a kit for in vitro detection of methylated DNA and / or diagnosis of lung cancer is proposed. The sequence set or composition can be used as a core raw material component for the preparation of standardized, commercially available detection kits. The kit comprises an optimized buffer system (containing specific concentrations of Tris-HCl, glycerol, BSA, SSB, KCl, MgCl2, dNTPs, and Taq DNA polymerase), premixed primer-probe combinations, positive control, negative control, and instructions for use. It is suitable for droplet digital PCR platforms and offers advantages such as ease of operation, short detection cycle (3-4 hours), controllable cost, and strong clinical applicability, meeting the practical needs of large-scale population screening and routine clinical testing.

[0108] Auxiliary diagnostic methods In an embodiment of the present invention, a method for assisting in the diagnosis of lung cancer is proposed. According to an embodiment of the present invention, the method includes the following steps: (1) Multiplex PCR detection of cfDNA using the sequence set, the composition or the kit, wherein the cfDNA is derived from the test sample of the subject and the cfDNA contains methylated DNA; (2) The fluorescence signals of the first fluorescent group, the second fluorescent group, the third fluorescent group and / or the fourth fluorescent group channel are detected independently, and the content of the methylated DNA is determined based on the fluorescence signals to assist in the diagnosis of whether the subject has lung cancer.

[0109] According to embodiments of the present invention, the above-described method for assisting in the diagnosis of lung cancer may further include at least one of the following additional technical features: According to an embodiment of the present invention, the working concentration of the upstream primer and / or downstream primer is 300-500 nM. Exemplarily, the working concentration of the upstream primer and / or downstream primer is 300, 350, 400, 450, or 500 nM, or a range between any two of the above values, such as 350-500, 400-500, 450-500, 300-450, 350-450, 400-450, 300-400, 350-400, or 300-350 nM. According to a preferred embodiment of the present invention, the working concentration of the upstream primer and / or downstream primer is 350-450 nM.

[0110] According to an embodiment of the present invention, the working concentration of the probe is 100~300 nM. Exemplarily, the working concentration of the probe is 100, 150, 200, 250, or 300 nM, or a range between any two of the above values, such as 150~300, 200~300, 250~300, 100~250, 150~250, 200~250, 100~200, 150~200, or 100~150 nM. According to a preferred embodiment of the present invention, the working concentration of the probe is 200 nM.

[0111] Those skilled in the art will understand that the ratio of the primer pairs and probes can achieve a balanced amplification efficiency for each target in the multiplex reaction system, thereby optimizing the copy number detection of each channel, achieving a high signal-to-noise ratio, and ensuring thorough separation of positive and negative droplets, further guaranteeing the accuracy and consistency of multiplex detection.

[0112] According to embodiments of the present invention, the method further includes at least one of single-stranded DNA binding protein, bovine serum albumin, and glycerol. By introducing key enhancing components such as SSB, BSA, and glycerol, SSB can specifically bind to denatured single-stranded DNA templates, preventing rapid retracement of the sense and antisense strands and eliminating secondary structures, allowing the single-stranded template to be physically distributed into different droplets for independent amplification during droplet generation, effectively increasing the detection copy number by more than 50%; glycerol adjusts the viscosity of the system to ensure the physical stability of the droplets during thermal cycling, reducing droplet fusion and clumping; BSA seals the reaction interface to reduce the non-specific adsorption loss of trace ctDNA. The synergistic effect of these three components significantly improves the detection capability and detection stability of low-abundance templates.

[0113] According to an embodiment of the present invention, the working concentration of glycerol is 4% to 6%. Exemplarily, the working concentration of glycerol is 4%, 4.5%, 5%, 5.5%, or 6%, or a range between any two of the above values, such as 4% to 5.5%, 4% to 5%, 4% to 4.5%, 4.5% to 6%, 4.5% to 5.5%, 4.5% to 5%, 5% to 6%, 5% to 5.5%, or 5.5% to 6%. According to a preferred embodiment of the present invention, the working concentration of glycerol is 4%, which effectively increases the viscous resistance of the aqueous phase and enhances the mechanical strength of the droplet film.

[0114] According to an embodiment of the present invention, the working concentration of bovine serum albumin is 0.15% to 0.5%. Exemplarily, the working concentration of bovine serum albumin is 0.15%, 0.2%, 0.3%, 0.4%, or 0.5%, or a range between any two of the above values, such as 0.2% to 0.5%, 0.3% to 0.5%, 0.4% to 0.5%, 0.15% to 0.4%, 0.2% to 0.4%, 0.3% to 0.4%, 0.15% to 0.3%, 0.2% to 0.3%, or 0.15% to 0.2%. According to a preferred embodiment of the present invention, the working concentration of bovine serum albumin is 0.2% to 0.4%. This concentration range can effectively passivate the reaction vessel wall and the oil-water interface of the droplets, preventing the loss of trace amounts of ctDNA due to adsorption.

[0115] According to embodiments of the present invention, the working concentration of the single-stranded DNA binding protein is 2-4 ng / μL. Exemplarily, the working concentration of the single-stranded DNA binding protein is 2, 2.5, 3, 3.5, or 4 ng / μL, or a range between any two of the above values, such as 2.5-4, 3-4, 3.5-4, 2-3.5, 2.5-3.5, 3-3.5, 2-3, 2.5-3, or 2-2.5 ng / μL. According to a preferred embodiment of the present invention, the working concentration of the single-stranded DNA binding protein is 2.5-3.5 ng / μL. This concentration range effectively prevents rapid re-annealing between complementary strands and the formation of secondary structures. This mechanism not only protects the integrity of the single-stranded template, but more importantly, it promotes the physical allocation of the sense and antisense strands of the original double-stranded DNA molecule into different microdroplets for independent amplification during droplet generation.

[0116] According to embodiments of the present invention, the method further includes at least one of the following: PCR buffer, DNA polymerase, dNTPs, or ddH2O.

[0117] According to an embodiment of the present invention, the PCR buffer comprises at least one selected from the following: Tris-HCl, K + or Mg 2+ .

[0118] The sequences involved in this invention are shown in Table 1 below: Table 1

[0119] The following will explain the solution of this application with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0120] Example 1: Basic Primer and Probe Screening (Sequence Performance Evaluation) This stage involves a three-step screening process: initial screening with single-phase amplification, verification with multiplexed probes, and concentration optimization. This process identifies the optimal combination and reaction concentration from candidate primers and probes that are highly specific, have high amplification efficiency, and are suitable for multiplex detection, laying the foundation for subsequent specificity verification.

[0121] 1. Initial screening using single amplification 1.1 Construction of plasmid templates for screening Target gene sequence design: Methylation-related regions of the promoter regions of PTGER4, RASSF1A, and SHOX2 genes, as well as the target detection region of the ACTB internal reference gene, were selected. (Specific sequences are shown in Table 1). All cytosine (C) at non-CpG sites in the sequence were replaced with thymine (T), while cytosine (C) at CpG sites remained unchanged (simulating methylation).

[0122] Synthesis and cloning: The four designed sequences were synthesized artificially and cloned into the pUC57 vector to prepare four independent recombinant plasmid standards: p-PTGER4, p-RASSF1A, p-SHOX2, and p-ACTB.

[0123] Quantitative analysis: Dilute uniformly to a concentration of 1000 copies / μL for each plasmid.

[0124] 1.2 An UNG-free basic buffer system was used. The components of the basic buffer system are shown in Table 2.

[0125] Table 2: Composition of the Basic Buffer System

[0126] The final primer concentration was 400 nM, and the final probe concentration was 200 nM. The concentration gradient was adjusted in subsequent optimization stages. Corresponding plasmids were used as templates; the plasmids were quantified and diluted, and then approximately 1000 copies / system were added. The optimal primer-probe combination for each target gene was screened.

[0127] 1.3 Initial Screening by Single Amplification Three sets of candidate primers and probes were designed for each target gene (sequences shown in Table 1) (see Table 3). The primer and probe design at this stage is mainly for preliminary screening of candidate sequences; the design of 3' T / A molecular switches is not yet performed. Further optimization will be carried out based on the best-performing primer and probe combinations in the future.

[0128] Table 3: Primer and probe information

[0129] Note: The "+" symbol in the probe sequences in the table is a locked nucleic acid (LNA) modification marker, indicating that the following nucleotide has been modified with LNA. This is used to increase the probe Tm value and enhance the binding specificity to the target sequence without changing the complementary base pairing characteristics.

[0130] 1.4 Digital PCR Workflow (1) Microdroplet preparation: Using a droplet generation chip (Xinyi Manufacturing Technology (Beijing) Co., Ltd.) and a sample preparation instrument (Xinyi Manufacturing Technology (Beijing) Co., Ltd.), 30 μL of PCR reaction system was added to the sample well of the droplet generation chip, and 180 μL of droplet generation oil was added to the oil well. The chip and the 8-tube array were placed in the preparation instrument, covered with a rubber pad, and microdroplet preparation was carried out.

[0131] (2) PCR amplification: Place the 8-tube array containing microdroplets into the PCR instrument for amplification. The amplification program is set as shown in Table 4 below: Table 4: PCR amplification program

[0132] (3) Microdroplet detection: After PCR is completed, the 8-tube array and the droplet detection chip (Xinyi Manufacturing Technology (Beijing) Co., Ltd.) are placed in the fixture. 450 μL and 500 μL of detection oil are added to the oil hole respectively. The rubber gasket is covered and the chip is placed in the chip analyzer (Xinyi Manufacturing Technology (Beijing) Co., Ltd.) for droplet detection.

[0133] (4) Data Analysis: Tens of thousands of microdroplets prepared using droplet generation chips and sample preparation instruments each function as an independent PCR reactor. Most microdroplets do not contain the target gene or contain at least one target gene. After PCR amplification, the fluorescence signal of each microdroplet is detected in each channel using a chip analyzer, and the peak height of the microdroplet signal is recorded. Droplets containing the target gene will be detected with the corresponding fluorescence signal. The fluorescence intensity within the microdroplets is digitized using a fluorescence classification threshold. Microdroplets with strong fluorescence are interpreted as "1" (positive), and microdroplets with weak fluorescence are interpreted as "0" (negative). The number of "1"s and "0"s is counted, and corrected using a Poisson distribution model, the total copy number of each fluorescently labeled target gene in the template can be calculated.

[0134] 1.5 Initial screening results of singleton amplification using basic primers and probes The performance of primers and probes was evaluated based on whether amplification occurred, the ratio of positive signal to background signal (signal-to-noise ratio), copy number, and whether cross-reaction with other genes occurred. The screening results for each target are shown in Table 5 and Appendix 6. Figure 1 As shown. For each target, at least 1-2 primer-probe combinations that can specifically amplify and whose copy numbers meet the expectations should be selected. To ensure that the selected primers and probes only recognize the corresponding gene and do not react non-specifically with templates from the other three genes, cross-selection is also performed.

[0135] Table 5: Screening results for each target

[0136] 2. Multiple concurrent verification (concurrent testing) The primer-probe combinations selected for single amplification were tested in parallel tubes according to Table 6 below. The final primer concentration was 400 nM, and the final probe concentration was 200 nM. A mixed plasmid containing four genes—PTGER4, RASSF1A, SHOX2, and ACTB—was used as a template to determine the parallel tube detection results.

[0137] Table 6: Parallel Screening and Detection Combinations

[0138] 2.1 Verification Results of Multiple Parallel Controllers The results of the multi-channel test are shown in Table 7.

[0139] Table 7: Results of Parallel Tube Screening and Testing

[0140] 3. Results of comprehensive screening of basic primers and probes The results of the combined tube testing showed that the FAM channel of combinations 1 and 3 did not amplify normally, indicating insufficient compatibility with the multiplex system. Although combination 2 could amplify, the copy number of the FAM channel was significantly higher than expected, suggesting that this combination might have non-specific amplification or inter-channel interference in the multiplex system, and therefore it was not selected as the best choice. Combination 4 showed stable detection of all four channels, a more balanced copy number distribution, and amplification signals consistent with the expected results. Therefore, it was determined to be the optimal combination for subsequent combined tube testing. The primer and probe combinations screened after combined tube testing are shown in Table 8 below.

[0141] Table 8: Results of Comprehensive Screening of Basic Primers and Probes

[0142] The "+" symbol in the probe sequence in the table is a locked nucleic acid (LNA) modification marker, indicating that the next nucleotide has been modified by LNA.

[0143] 4. Optimization of primer and probe concentrations The primer and probe concentrations in the reaction system were optimized to improve the PCR reaction system and enhance detection sensitivity and specificity. The final primer concentrations were set to 0.4 μM, 0.5 μM, and 0.6 μM, and the final probe concentrations were set to 0.2 μM, 0.25 μM, and 0.3 μM, as shown in Table 9. Using a mixed plasmid with a diluted concentration of approximately 1000 copies / μL of each plasmid as a template, the final primer and probe concentrations were determined.

[0144] Table 9: Combinations of different primer and probe concentrations

[0145] 4.1 Optimization results of primer and probe concentration The experimental results are shown in Table 10. All concentration combinations achieved stable four-channel detection. Combination 1, with its lower primer and probe concentrations, obtained a balanced four-channel amplification signal, and its detection results were comparable to other high-concentration combinations. Considering both detection stability and reagent usage, combination 1 was determined to be the optimal concentration condition, i.e., a final primer concentration of 0.4 μM and a final probe concentration of 0.2 μM.

[0146] Table 10: Results of different primer-probe concentration combinations

[0147] Through initial screening using singleton amplification, cross-reaction verification, multiplex tube testing, and primer / probe concentration optimization, this stage determined a basic primer / probe combination suitable for subsequent multiplex digital PCR detection and 3' end molecular switch optimization. Considering the amplification efficiency, copy number distribution, cross-reactivity, and compatibility with multiplex systems, the third group of PTGER4, the third group of RASSF1A, the third group of SHOX2, and the third group of ACTB were determined as the optimal basic combination; the final primer concentration was determined to be 0.4 μM, and the final probe concentration to be 0.2 μM. This combination showed stable detection in all four channels of the multiplex system, with a relatively balanced copy number distribution, and can serve as the basic sequence for subsequent specificity verification and system optimization.

[0148] Example 2: Specificity Verification Experiment of Primer 3' End Design Based on the optimized sequences determined in the first stage, the specificity of the primer 3' end T / A molecular switch design was further verified. This design ensures that the 3' end base of the upstream primer corresponds to the T site formed after full bisulfite conversion, and the 3' end base of the downstream primer is complementary to the U / T site after conversion. When the unmethylated cytosine in the template is not fully converted, the 3' end of the primer forms a mismatch with the template, thereby inhibiting non-specific amplification and reducing the risk of false positives caused by insufficient template conversion.

[0149] 1. Experimental Design and Primer Modification Experimental group: Based on the basic optimized primer-probe combination obtained in Example 1, each primer was extended or truncated to optimize it so that the 3' end base of the upstream primer corresponds to the T site after full bisulfite conversion; the 3' end base of the downstream primer is adenine A, which is complementary to the U / T site after conversion.

[0150] Control group: Primers without 3' T / A molecular switch optimization were used. Their 3' terminal bases did not correspond to the U / T site after full bisulfite conversion. These primers were used to compare their amplification inhibition ability against insufficiently converted templates with the experimental group. Except for the 3' terminal bases or adjacent key bases, the control group primers and experimental group primers were kept as close as possible in terms of amplification region, length, GC content, and Tm value to minimize the influence of non-3' end factors on the experimental results. Specific sequences are shown in Table 11 and appendix. Figure 2 As shown: Table 11: Primer and probe sequence information for the experimental and control groups

[0151] Note: The underlined bases in the experimental group represent the molecular switch design sites at the 3' ends of the primers. Specifically, the upstream primer has a T base at the 3' end, corresponding to the U / T site formed by unmethylated cytosine after full bisulfite conversion; the downstream primer has an A base at the 3' end, complementary to the converted U / T site. The underlined bases in the control group represent the non-molecular switch design sites. The upstream primer has a 3' end base corresponding to the retained cytosine C after incomplete conversion; the downstream primer has a G base at the 3' end, complementary to C. The "+" symbol in the probe sequences in the table indicates locked nucleic acid (LNA) modification, meaning the following nucleotide has undergone LNA modification.

[0152] 2. Construction of a simulated conversion ratio template To evaluate the ability of the 3'-terminal T / A molecular switch to recognize incompletely converted templates, this embodiment constructs simulated template systems with different apparent conversion efficiencies by mixing fully converted plasmid templates and unconverted plasmid templates in different proportions.

[0153] The basic sequences of the template genes (PTGER4, RASSF1A, SHOX2 and ACTB) are shown in Table 1.

[0154] Completely transformed template: refers to a simulated template that has been fully transformed by bisulfite, in which unmethylated cytosine is fully converted to U / T, while retaining the signal characteristics of methylated CpG sites.

[0155] Unconverted template: refers to a simulated template that has not undergone bisulfite conversion treatment, used to simulate the situation where unmethylated cytosine has residual C bases due to incomplete conversion.

[0156] By adjusting the ratio of the two templates, different degrees of incomplete conversion can be simulated.

[0157] The specific groups are as follows: Table 12: Construction of simulation templates for different apparent conversion ratios

[0158] The optimized digital PCR reaction system of Example 1 was used.

[0159] The experimental group used primers optimized with a 3' T / A molecular switch, while the control group used primers without a molecular switch. The final primer concentration was 0.4 μM, and the final probe concentration was 0.2 μM.

[0160] 3. A multiplex digital PCR system was used to simultaneously detect PTGER4, RASSF1A, SHOX2, and ACTB. For PTGER4, RASSF1A, and SHOX2, primer systems optimized using different 3' T / A molecular switches were compared between the experimental and control groups. ACTB, as an internal reference gene, used the same primer-probe combination in both experiments to evaluate template quality and reaction system stability; therefore, it was not used as a comparative indicator of the 3' T / A molecular switch design effectiveness. Droplet preparation, PCR amplification, signal reading, and data analysis procedures were consistent with those in Example 1.

[0161] 4. Specificity verification results of the 3' end T / A molecular switch design of primers Digital PCR was performed on the experimental and control groups using templates with different complete transformation ratios. The results, shown in Tables 13-1, 13-2, and 13-3, indicate that the copy numbers of the three methylation targets all increased with the increase of the complete transformation ratio.

[0162] Table 13-1: Detection results of PTGER4 (FAM) at different complete conversion ratios

[0163] Table 13-2: Detection results of RASSF1A (CY5) at different complete conversion ratios

[0164] Table 13-3: Detection results of SHOX2 (ROX) at different complete conversion ratios

[0165] The results showed that the three methylation targets, PTGER4, SHOX2, and RASSF1A, all exhibited consistent detection trends. Under 100% complete template conversion, the copy numbers detected in the experimental and control groups were similar, and stable amplification signals were obtained for all three targets, indicating that the 3' T / A molecular switch design did not reduce the amplification efficiency of fully converted template. As the proportion of fully converted template decreased and the proportion of unconverted template increased, the detection signals in both systems showed a downward trend. However, compared to the system without the molecular switch, the experimental group showed a greater decrease in signal intensity with an increased proportion of unconverted template and maintained a low level of background amplification signal, indicating that the molecular switch system selectively inhibited the amplification of unconverted template. Under 50% complete template conversion, the detection signal in the experimental group was significantly lower than that in the system without the molecular switch; under completely unconverted template conditions, the experimental group detected only about 3-5 copies of low-level background signal, while the system without the molecular switch still detected tens of copies of amplification signal. The above results demonstrate that the 3' T / A molecular switch design, while maintaining the normal amplification capability of fully transformed templates, can reduce non-specific signals caused by insufficiently transformed templates participating in amplification, and can successfully distinguish between "transformed methylated C" and "untransformed non-methylated C," thus improving the specificity of the methylation digital PCR detection system.

[0166] This embodiment systematically evaluated the ability of primer 3' T / A molecular switch design to identify template transformation state by constructing mixed systems of fully transformed and partially transformed templates in different proportions. The results demonstrate that introducing a 3' T / A molecular switch structure based on the optimized primer-probe combination does not affect the normal amplification and detection of fully transformed methylated templates. Simultaneously, it reduces non-specific signals generated by the amplification of partially transformed templates, improving the specificity, stability, and resistance to interference from incomplete transformation in the methylation digital PCR detection system.

[0167] Example 3 Screening of different detection systems This embodiment aims to construct a digital PCR reaction system suitable for the detection of trace nucleic acids, especially low-copy templates of lung cancer ctDNA. Based on the primer and probe combinations determined in Examples 1 and 2, the components of the reaction system, including glycerol, BSA, SSB, and Mg²⁺, were further modified. + Key components, including Taq DNA polymerase, were progressively optimized to improve droplet formation stability, reduce low-copy template adsorption loss, and enhance amplification efficiency and inter-channel consistency. The digital PCR workflow for the following different detection systems is consistent with that in Example 1.

[0168] 1. Optimize glycerol concentration Table 14 shows the preparation of four systems with different glycerol concentrations, with final glycerol concentrations of 2%, 4%, 6%, and 8%, respectively.

[0169] Table 14: Preparation of detection systems for different glycerol concentrations

[0170] 1.1 Detection results of systems with different glycerol concentrations The detection results for systems with different glycerol concentrations are shown in Table 15. The results show that droplets can be detected in systems with 2%, 4%, 6%, and 8% glycerol concentrations. At a glycerol concentration of 2%, the number of droplets is less than 30,000, indicating possible partial merging. When the glycerol concentration reaches 4% or higher, the number of droplets is above 30,000, with some exceeding 50,000 but not exceeding 60,000. However, at a glycerol concentration of 8%, the quantitative analysis decreases. Therefore, a glycerol concentration between 4% and 6% is optimal.

[0171] Table 15: Detection results at different glycerol concentrations

[0172] 2. Optimize BSA concentration Table 16 shows the preparation of systems with different BSA concentrations. A total of 4 systems were prepared with different BSA concentrations under the condition of a fixed glycerol concentration of 4%, with final BSA concentrations of 0.1%, 0.2%, 0.4%, and 0.6%, respectively.

[0173] Table 16: Preparation of Detection Systems for Different BSA Concentrations

[0174] 2.1 Detection results of different BSA concentration systems The detection results for different BSA concentration systems are shown in Table 17. The droplet count was relatively normal in all BSA concentration systems, ranging from 40,000 to 60,000. The quantitation was low at a BSA concentration of 0.1%, possibly due to insufficient amplification efficiency. Increasing the BSA concentration to 0.2%-0.4% improved the quantitation, but at a concentration of 0.6%, the quantitation decreased slightly. Therefore, the optimal BSA concentration is 0.2%-0.4%.

[0175] Table 17: Detection results of different BSA concentrations

[0176] 3. Optimize SSB concentration Table 18 shows the preparation of systems with different SSB concentrations. A total of 5 systems were prepared under the condition of a fixed glycerol concentration of 4% and a BSA concentration of 0.4%, with final SSB concentrations of 0 ng / μL, 1.5 ng / μL, 3 ng / μL, 4.5 ng / μL, and 6 ng / μL, respectively.

[0177] Table 18: Preparation of Detection Systems for Different SSB Concentrations

[0178] 3.1 Detection results of different SSB concentration systems The detection results for different SSB concentration systems are shown in Table 19. The droplet count was relatively normal in all systems, ranging from 40,000 to 60,000. Template quantification was low when the SSB concentration was 0 ng / μL. Increasing the SSB concentration to 1.5 ng / μL-3 ng / μL significantly improved the template quantification results, indicating that an appropriate amount of SSB helps stabilize low-copy nucleic acid templates, reducing the impact of single-stranded template secondary structure or non-specific adsorption on amplification, thereby improving the detection efficiency of low-copy templates. When the SSB concentration was further increased to 4.5 ng / μL and above, the quantitative copy number decreased, suggesting that excessive SSB may affect primer-template binding or PCR amplification efficiency. Therefore, the more suitable SSB concentration is 1.5 ng / μL-3 ng / μL.

[0179] Table 19: Detection results of different SSB concentrations

[0180] 4. Optimize Mg² + Concentration and amount of Taq enzyme Different Mg² + The concentration and Taq enzyme dosage of the system are shown in Tables 20-1, 20-2, 20-3, and 20-4. With a fixed glycerol concentration of 4%, BSA concentration of 0.4%, and SSB concentration of 3 ng / μL, the concentrations of other components in the multiplex system were optimized. 2+ Concentrations include 4 mM, 6 mM, and 8 mM; Taq DNA polymerase dosages include 2 U, 3 U, 4 U, and 5 U. There are a total of 12 combinations.

[0181] Table 20-1: Preparation of detection systems with different Taq enzyme amounts and MgCl2 concentrations

[0182] Table 20-2: Preparation of detection systems with different Taq enzyme amounts and MgCl2 concentrations

[0183] Table 20-3: Preparation of detection systems with different Taq enzyme amounts and MgCl2 concentrations

[0184] Table 20-4: Preparation of detection systems with different Taq enzyme amounts and MgCl2 concentrations

[0185] 4.1 Different Mg²+ Detection results of concentration and Taq DNA polymerase dosage system Different Mg² + The detection results for the concentration and Taq DNA polymerase dosage systems are shown in Table 21. The results showed that, under the condition of a theoretical template copy number of 20 copies / system, the droplet number in each system was within the effective detection range, and no obvious abnormal droplet formation was observed. System 19 was closest to the theoretical copy number overall, and the results of the four channels were relatively balanced. Therefore, considering the accuracy of the copy number, the consistency between channels, and the droplet formation, system 19 was ultimately determined as the preferred reaction system. Therefore, the preferred reaction system was determined to be: 4% glycerol, 0.4% BSA, 3 ng / μL SSB, 6 mM MgCl2, 3U Taq DNA polymerase, 0.4 μM final primer concentration, and 0.2 μM final probe concentration.

[0186] Table 21: Mg² + Detection results of concentration and Taq enzyme volume system

[0187] Test Example 1 To further evaluate the applicability of the kit in clinical plasma samples, this test case collected 25 representative clinical plasma samples for parallel testing. These included 15 samples from pathologically confirmed lung cancer patients and 10 samples from healthy controls or patients with non-lung cancer lung diseases. Three methods were compared: the method of the kit of this invention, i.e., the digital PCR method with molecular switch design; the conventional qPCR detection method; and the digital PCR method without molecular switch control.

[0188] This test case is mainly used to evaluate the effectiveness of the method of the present invention in detecting low-abundance methylation targets, controlling false positives in non-lung cancer samples, and adaptability to clinical plasma samples.

[0189] 1. Sample Information This study included 25 plasma samples. Basic sample information is shown in Table 22 below, and specific clinical specimen testing details are attached. Figure 3 As shown: Table 22: Summary Table of Basic Sample Information

[0190] 2. Experimental Methods 2.1 Sample Processing All samples were processed using a standardized procedure: (1) peripheral blood of the subjects was collected in EDTA anticoagulant tubes; (2) plasma separation was completed within 4 hours; (3) plasma cfDNA was extracted using a commercial cfDNA extraction kit with an elution volume of 45 μL; (4) DNA transformation was performed using a bisulfite transformation kit; (5) the transformed DNA samples were aliquoted and stored at -80°C to avoid repeated freeze-thaw cycles.

[0191] 2.2 Three Detection Methods Method 1: The kit method of this invention (including dPCR with molecular switch design) The primer pairs and probe sequences of the experimental groups of the four genes in Table 11 of Example 2, namely PTGER4, RASSF1A, SHOX2, and ACTB, were used.

[0192] The reaction system used was reaction system 19 as shown in Table 20-2 of Example 3. The digital PCR workflow of the kit was the same as that in Table 4 of Example 1, and the detection was performed using a droplet digital PCR platform.

[0193] Method 2: Conventional qPCR kit method We used a commercially available qPCR kit for lung cancer methylation detection (based on PTGER4 / RASSF1A / SHOX2 three-gene detection) and strictly followed the instructions (the kit was purchased from Beijing Aikelun Medical Technology Co., Ltd., instruction manual number and version number: InLUC01, R25052005).

[0194] Method 3: Molecular switch-free control dPCR method The primer pairs and probe sequences of the control group for the four genes in Table 11 of Example 2: PTGER4, RASSF1A, SHOX2, and ACTB were used.

[0195] The reaction system used was reaction system 19 as shown in Table 20-2 of Example 3. The digital PCR workflow of the kit was the same as that in Table 4 of Example 1, and the detection was performed using a droplet digital PCR platform.

[0196] 2.3 Result Interpretation Criteria To ensure fairness in comparing results between different digital PCR detection systems, in this test example, the method of the kit of this invention, i.e., the digital PCR method with a 3' T / A molecular switch design, and the control digital PCR method without a molecular switch design, use the same result interpretation criteria. Conventional qPCR methods are interpreted according to the corresponding kit instructions and do not use the digital PCR copy number interpretation criteria.

[0197] In this invention, as shown in Table 23, PTGER4, RASSF1A, and SHOX2 are methylation detection targets, and ACTB is an internal reference gene used to evaluate the effectiveness of sample input, DNA transformation, and PCR amplification reactions. Detection results are comprehensively interpreted based on the number of methylation-positive copies, the methylation ratio, and the number of ACTB internal reference copies. When the methylation target reaches the positive determination criteria, it can be considered positive; however, the detection reaction should still meet the requirements for droplet count, positive / negative clustering, and control quality control.

[0198] The methylation ratio is calculated according to the following formula: Methylation ratio = target methylation copy number / ACTB internal reference copy number × 100%.

[0199] Table 23: Determination of Methylation Results

[0200] 2.4 The test results are shown in Table 24.

[0201] Table 24: Summary of detection results of three methods on 25 samples

[0202] 2.5 Comparative Analysis of Positive Detection Rates in Lung Cancer Samples Table 25: Comparison of positive detection rates of three methods for lung cancer patient samples

[0203] As shown in Table 25, the detection rate of the method of the present invention for lung cancer patient samples was 93.3%, which is higher than the 73.3% of the conventional qPCR method. Both the method of the present invention and the controlless dPCR method are based on the principle of digital PCR partitioning amplification and endpoint counting, thus exhibiting good detection capabilities for low-copy templates. The samples missed by conventional qPCR were mainly stage I lung adenocarcinoma samples, suggesting that its ability to detect low-abundance plasma ctDNA methylation signals is relatively limited.

[0204] 2.6 Analysis of negative concordance rate for non-lung cancer samples Table 26: Comparison of negative concordance rates of the three methods for non-lung cancer samples

[0205] As shown in Table 26, in the 10 healthy controls or non-lung cancer lung disease samples included in this test, the method of this invention did not produce any positive results, indicating a good negative concordance rate. Conventional qPCR also did not produce any positive results, but its detection ability in low-copy lung cancer samples was weak. The dPCR without a molecular switch control showed low-level single-target positive signals in some non-lung cancer lung disease samples, suggesting that without a molecular switch design, the system is more susceptible to incomplete template transformation or non-specific amplification.

[0206] Table 27: Detailed Information on False Positive Samples from the Molecular Switch-Free Controlled dPCR Method

[0207] As shown in Table 27, the control-free dPCR method without a molecular switch can produce low-level single-target positivity or raindrop signals in some non-lung cancer samples. Specifically, the low-level single-target signals in N002 and N008 reach the positive threshold and are considered false positives according to clinical diagnosis. N010 only shows a small amount of raindrop signal, which does not reach the positive threshold and is therefore not considered a false positive. These low-level positivity or raindrop signals may originate from insufficient template conversion, non-specific amplification, or interference from complex clinical sample backgrounds, and should not be directly interpreted as true lung cancer-related methylation positivity signals. The method of this invention improves the selective amplification and recognition ability of methylated templates after full bisulfite conversion by optimizing the primer 3' end recognition structure and probe recognition region, reducing false positive interference from unmethylated templates, insufficiently converted templates, and complex clinical backgrounds.

[0208] 2.7 Comprehensive Performance Evaluation Table 28: Comparison of the overall performance of the three methods

[0209] The results, as shown in Table 28, demonstrate that the method of this invention exhibits good low-copy detection capability and anti-false-positive capability in representative clinical plasma samples (see appendix). Figure 3 Compared with conventional qPCR, the method of this invention improves the detection capability of low-abundance methylated ctDNA; compared with dPCR methods without molecular switch controls, the method of this invention reduces non-specific amplification and low-level false positive signals. These results demonstrate that molecular switch primer design, LNA probe recognition, and optimized reaction system can synergistically improve the stability and reliability of methylation digital PCR detection.

[0210] This test case validated the detection performance of the kit using 25 representative clinical plasma samples. The results showed that in 15 lung cancer patient samples, the method of this invention detected 14 cases, with a detection rate of 93.3%, higher than the 73.3% of the conventional qPCR method. In 10 healthy controls and non-lung cancer lung disease patient samples, the method of this invention showed no positive results, with a negative concordance rate of 100%. Although the control-free dPCR method showed good low-copy detection capability in lung cancer samples, low-level single-target positive signals appeared in some non-lung cancer lung disease samples, indicating that its specificity and anti-interference ability are still insufficient.

[0211] The above results demonstrate that this invention possesses both good positive detection capability and false positive control capability in the detection of low-abundance ctDNA methylation. Compared with conventional qPCR methods, the method of this invention can improve the detection capability of low-copy methylation targets, and is especially suitable for samples with low plasma cfDNA content or low target methylation abundance; compared with dPCR methods without molecular switch control, the method of this invention can reduce non-specific amplification and low-level false positive signals caused by unmethylated templates, incompletely transformed templates, and complex clinical sample backgrounds.

[0212] The performance improvements of this invention mainly stem from the synergistic effect of molecular switch primer design, LNA-modified probe recognition, and optimized reaction system. Molecular switch primer design enhances the selective amplification capability of the detection system for methylated templates after full bisulfite conversion and reduces the risk of non-specific amplification due to insufficient template conversion. The LNA-modified probe enhances the hybridization stability and recognition specificity of the target methylated region. The optimized buffer system and SSB auxiliary component improve the amplification stability and signal separation effect of the multiplex digital PCR system under low-copy template conditions.

[0213] Therefore, this invention is not a simple replacement or addition to existing conventional PCR detection technologies, but rather improves the sensitivity, specificity, and stability of digital PCR detection of plasma cfDNA methylation through synergistic optimization of primer structure, probe recognition method, and reaction system composition. This invention can be used for the in vitro detection of lung cancer-related methylation biomarkers and has the potential application as an auxiliary detection method for non-invasive early screening of lung cancer.

[0214] It should be understood that the disclosed invention is not limited to the specific methods, schemes, and substances described, as these are all subject to variation. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the scope of the invention, which is limited only by the appended claims.

[0215] Those skilled in the art will also recognize, or be able to identify, many equivalents of the specific embodiments of the invention described herein using no more than conventional experiments. These equivalents are also included in the appended claims.

Claims

1. A sequence set, characterized in that, This includes primer pairs and their probes; The primer pairs respectively target and amplify DNA fragments containing one or more CpG sites in the promoter regions of the PTGER4, RASSF1A, and SHOX2 genes. The primer pair includes an upstream primer and a downstream primer, wherein, The 3' terminal base of the upstream primer is thymine, and the 3' terminal base of the downstream primer is adenine; The probes target and identify sequences in the DNA fragments that contain methylated CpG sites.

2. The sequence set according to claim 1, characterized in that, The primer pair includes: The first primer pair includes a first upstream primer and a first downstream primer; The second primer pair includes a second upstream primer and a second downstream primer; The third primer pair, comprising a third upstream primer and a third downstream primer; wherein, The first upstream primer comprises the nucleotide sequence shown in SEQ ID NO:1; The first downstream primer comprises the nucleotide sequence shown in SEQ ID NO:2; The second upstream primer pair includes the nucleotide sequence shown in SEQ ID NO:4; The second downstream primer pair includes the nucleotide sequence shown in SEQ ID NO:5; The third upstream primer pair includes the nucleotide sequence shown in SEQ ID NO:7; The third downstream primer pair includes the nucleotide sequence shown in SEQ ID NO:

8.

3. The sequence set according to claim 1, characterized in that, The probes include: a first probe, a second probe, and a third probe; The first probe comprises the nucleotide sequence shown in SEQ ID NO:

3. The second probe comprises the nucleotide sequence shown in SEQ ID NO:

6. The third probe comprises the nucleotide sequence shown in SEQ ID NO:9; Optionally, the DNA fragment of PTGER4 has a nucleotide sequence as shown in SEQ ID NO:10; Optionally, the DNA fragment of the RASSF1A has a nucleotide sequence as shown in SEQ ID NO:11; Optionally, the DNA fragment of said SHOX2 has a nucleotide sequence as shown in SEQ ID NO:12; Optionally, the sequence set further includes a fourth primer pair and a fourth probe for detecting one or more internal reference genes; Optionally, the internal reference gene includes at least one of the following: ACTB, GAPDH, 18S rRNA, or HPRT1; Preferably, the internal reference gene is ACTB; Optionally, the internal reference gene has a nucleotide sequence as shown in SEQ ID NO:16; Optionally, the fourth primer pair includes a fourth upstream primer and a fourth downstream primer; The fourth upstream primer includes the nucleotide sequence shown in SEQ ID NO:13; The fourth downstream primer comprises the nucleotide sequence shown in SEQ ID NO:14; Optionally, the fourth probe comprises the nucleotide sequence shown in SEQ ID NO:

15.

4. The sequence set according to any one of claims 1 to 3, characterized in that, At least one of the first probe, the second probe, the third probe, and the fourth probe carries a fluorescent group and a quenching group; Optionally, the first probe carries a first fluorescent group and a quenching group, the second probe carries a second fluorescent group and a quenching group, the third probe carries a third fluorescent group and a quenching group, and the fourth probe carries a fourth fluorescent group and a quenching group; Optionally, the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group include at least one selected from the following: FAM, SYBR Green I, FITC, VIC, HEX, JOE, ROX, Texas Red, Cy5; Optionally, the quenching group includes at least one selected from the following: BHQ1, BHQ2, or BHQ3; Optionally, the fluorescent group and / or quenching group are located at the 3' or 5' end of the probe; Optionally, the first probe, the second probe, the third probe, and the fourth probe carry different fluorescent groups.

5. A composition, characterized in that, Includes the sequence set as described in any one of claims 1 to 4.

6. The composition according to claim 5, characterized in that, The molar ratio of the first primer pair, the second primer pair, and the third primer pair is (1~2):(1~2):(1~2); Optionally, the molar ratio of the first primer pair, the second primer pair, the third primer pair, and the fourth primer pair is (1~2):(1~2):(1~2):(1~2); Optionally, the molar ratio of the first primer pair, the second primer pair, the third primer pair, the first probe, the second probe, and the third probe is (2~4):(2~4):(2~4):(1~2):(1~2):(1~2); Optionally, the molar ratio of the first primer pair, the second primer pair, the third primer pair, the fourth primer pair, the first probe, the second probe, the third probe, and the fourth probe is (2~4):(2~4):(2~4):(2~4):(1~2):(1~2):(1~2):(1~2):(1~2).

7. A method for in vitro detection of methylated DNA, characterized in that, Includes the following steps: (1) Multiplex PCR detection of cfDNA using the primer and probe set according to any one of claims 1 to 4 or the composition according to any one of claims 5 to 6, wherein the cfDNA is derived from the sample to be tested and the cfDNA contains methylated DNA; (2) The fluorescence signals of the first, second, third and / or fourth fluorescent channels are detected independently to determine the copy number or methylation ratio of methylated DNA.

8. The method according to claim 7, characterized in that, The sample to be tested includes at least one of the following: blood, plasma, serum, cells, tissue, saliva, or feces; Optionally, the amplification system of the multiplex PCR includes at least one of single-stranded DNA-binding protein, bovine serum albumin, and glycerol; Optionally, in the multiplex PCR amplification system, the working concentration of glycerol is 4% to 6%, preferably 4%; Optionally, in the multiplex PCR amplification system, the working concentration of bovine serum albumin is 0.15% to 0.5%, preferably 0.2% to 0.4%; Optionally, the working concentration of the single-stranded DNA binding protein in the multiplex PCR amplification system is 2-4 ng / μL, preferably 2.5-3.5 ng / μL; Optionally, the amplification system of the multiplex PCR further includes at least one of the following: PCR buffer, DNA polymerase, dNTPs or ddH2O; Optionally, the PCR buffer comprises at least one of the following: Tris-HCl, K + or Mg 2+ ; Optionally, the reaction program for the multiplex PCR is 94℃~96℃, 8~15min, for one cycle; 93℃~95℃, 25~35s, 55℃~65℃, 50~70s, for 45~55 cycles. Optionally, the methylated DNA includes at least one of the following: PTGER4, RASSF1A, or SHOX2.

9. A reagent kit, characterized in that, It includes the sequence set as described in any one of claims 1 to 4 or the composition as described in any one of claims 5 to 6.

10. The reagent kit according to claim 9, characterized in that, The working concentration of the upstream primer and / or downstream primer is 300-500 nM, preferably 350-450 nM; Optionally, the working concentration of the probe is 100~300 nM, preferably 200 nM; Optionally, the kit further includes at least one of a single-stranded DNA-binding protein, bovine serum albumin, and glycerol; Optionally, the working concentration of the glycerol is 4% to 6%, preferably 4%; Optionally, the working concentration of the bovine serum albumin is 0.15% to 0.5%, preferably 0.2% to 0.4%; Optionally, the working concentration of the single-stranded DNA binding protein is 2-4 ng / μL, preferably 2.5-3.5 ng / μL; Optionally, the kit further includes at least one of the following: PCR buffer, DNA polymerase, dNTPs, or ddH2O; Optionally, the kit further includes at least one of the following: Tris-HCl, K + or Mg 2+ ; Optionally, the kit further includes an instruction manual describing the method for in vitro detection of methylated DNA as described in claim 7 or 8.

11. Use of the sequence set according to any one of claims 1 to 4 or the composition according to any one of claims 5 to 6 in at least one of the following: (1) Nucleic acid amplification; and / or (2) Sequencing; and / or (3) In vitro detection of methylated DNA; and / or (4) Assisting in the diagnosis of lung cancer; and / or (5) Prepare a kit for in vitro detection of methylated DNA and / or diagnosis of lung cancer.

Images