A rpa-nfo primer probe combination for rapid detection of oriental white stork dna, a kit containing the combination and a detection method

Abstract

The application discloses a RPA-nfo primer probe combination for rapid detection of eDNA of oriental white stork, a kit containing the combination and a detection method, and belongs to the technical field of molecular biology and species detection. The primer probe combination is combination 1-2 or combination 2-2, wherein the 5' end of the downstream primer is modified with Biotin, the 5' end of the probe is modified with 6-FAM, the internal part contains an idSp site, and the 3' end is closed by a C3 Spacer. The above-mentioned primer probe combination is used for RPA-nfo constant temperature amplification, the amplification product is diluted, and then added to a colloidal gold test strip for color development, and whether the sample contains eDNA of the oriental white stork is determined according to the color development of the quality control line and the detection line. The application is simple in operation, visual in result, low in dependence on equipment, and can be used for rapid screening of eDNA of the oriental white stork.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and species detection technology, specifically relating to an RPA-nfo primer-probe combination for rapid DNA detection of Oriental White Storks, a kit containing the combination, and a detection method. Background Technology

[0002] The Oriental White Stork (Ciconia boyciana) is an important and rare bird species. Monitoring its population distribution, migratory stopovers, habitat use, and activity areas is crucial for wetland conservation, biodiversity surveys, migratory corridor management, and ecological restoration assessments. In wetland patrols, ecological restoration zone management, and surveys of key protected species, quickly determining the presence of Oriental White Storks or whether they have left detectable genetic information helps provide timely data for conservation management.

[0003] Current monitoring of Oriental White Storks primarily relies on manual observation, binoculars, infrared cameras, video surveillance, trace investigation, and patrol records. While these methods are intuitive and fundamental, they are easily affected by factors such as weather, lighting, terrain, vegetation obstruction, the individual's activity status, dwell time, and the experience of the investigators. For individuals exhibiting low density, short-term stopovers, long-distance activity, or concealed activity, traditional observation methods may result in missed detections or insufficient evidence for confirmation.

[0004] With the development of molecular ecology and environmental DNA technology, DNA detection methods such as PCR, qPCR, sequencing, and metabarcoding analysis have been used for target species identification and environmental sample analysis. These methods have good accuracy and are suitable for laboratory result confirmation and scientific research analysis. However, they usually require nucleic acid extraction equipment, thermal cyclers, quantitative PCR instruments, electrophoresis imaging systems, or sequencing platforms, and depend on professional operation. Samples also need to be preserved, transported, and queued for testing, resulting in a long overall cycle, which is not conducive to rapid on-site screening and immediate judgment.

[0005] Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technique that enables the amplification of target nucleic acid fragments at relatively low and constant temperatures. The RPA-nfo system further utilizes an nfo probe modified with 5'FAM, internal idSp, and 3'C3 Spacer, along with primers modified with 5'Biotin, to form a FAM / Biotin dual-labeled structure in the amplification product. This dual-labeled amplification product can be visually identified using colloidal gold test strips, allowing for visual judgment via the control and test lines.

[0006] Currently, rapid detection technologies such as RPA, MIRA, LAMP, and colloidal gold test strips have been applied in pathogen detection, food source identification, and some species identification. However, specialized and experimentally screened primer-probe combinations and kits for rapid RPA-nfo colloidal gold detection targeting the Oriental White Stork are still lacking. Therefore, it is necessary to develop a rapid and visual RPA-nfo detection system targeting the target sequence EU263930.1 of the Oriental White Stork. Summary of the Invention

[0007] This invention provides an RPA-nfo primer-probe combination for rapid DNA detection of Oriental White Storks, a kit containing the combination, and a detection method, to solve the problems of existing detection methods relying on complex equipment, cumbersome operation, long cycle, and unsuitability for rapid on-site screening.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides an RPA-nfo primer-probe combination for rapid detection of DNA in Oriental White Stork, wherein the combination is combination 1-2 or combination 2-2;

[0010] The combination 1-2 includes: an upstream primer ProbePanel_1_2_F, the sequence of which is SEQ ID NO:5; a downstream primer ProbePanel_1_2_R, the sequence of which is SEQ ID NO:6, and the 5′ end of the downstream primer is modified with biotin; and a probe ProbePanel_1_1_Probe, the sequence of which is SEQ ID NO:4, and the 5′ end of the probe is modified with 6-FAM, contains an idSp site, and the 3′ end is closed with a C3 spacer;

[0011] The combination 2-2 includes: an upstream primer ProbePanel_2_2_F, whose sequence is SEQ ID NO:10; a downstream primer ProbePanel_2_2_R, whose sequence is SEQ ID NO:11, and the 5′ end of the downstream primer is modified with biotin; and a probe ProbePanel_2_1_Probe, whose sequence is SEQ ID NO:9, and the 5′ end of the probe is modified with 6-FAM, contains an idSp site, and the 3′ end is closed with a C3 spacer.

[0012] Secondly, the present invention provides a rapid DNA detection kit for Oriental White Stork, comprising the primer and probe combination provided by the present invention, as well as reagents and / or colloidal gold test strips for RPA-nfo amplification.

[0013] Furthermore, the colloidal gold test strip described in the kit of the present invention is a lateral chromatography test strip.

[0014] Thirdly, this invention provides a rapid DNA detection method for Oriental White Storks, comprising the following steps:

[0015] (1) Prepare the DNA template to be tested;

[0016] (2) Prepare an RPA-nfo reaction system, wherein the system contains any one of the primer-probe combinations provided by the present invention;

[0017] (3) Add the DNA template and carry out the amplification reaction under isothermal conditions;

[0018] (4) After diluting the amplification product, add it to the colloidal gold test strip for color development;

[0019] (5) Determine whether the sample contains Oriental White Stork DNA based on the color development of the control line and the detection line of the test strip.

[0020] Furthermore, the isothermal amplification temperature described in the method of the present invention is 37-42℃, and the amplification time is 15-20 minutes.

[0021] Furthermore, the RPA-nfo reaction system described in the method of the present invention is a 50 μL system, which comprises: 29.4 μL AD buffer, 2 μL 10 μM upstream primer, 2 μL 10 μM downstream primer, 0.6 μL 10 μM probe, 13.5 μL template and ddH2O, and 2.5 μL B buffer.

[0022] Furthermore, the dilution mentioned in step (4) of the method of the present invention is to dilute by 10-20 times with ddH2O or the diluent specified on the test strip.

[0023] Furthermore, the judgment criteria for step (5) of the method of the present invention are as follows: if both the control line and the detection line show color, it is judged as positive; if only the control line shows color, it is judged as negative; and if the control line does not show color, it is judged as invalid detection.

[0024] In this invention, after basic RPA electrophoresis verification using a recombinant plasmid of the Oriental White Stork EU263930.1 related synthetic target fragment as a positive template, both combinations 1-2 and 2-2 showed clear amplification bands in agarose gel electrophoresis. Each combination was performed in duplicate, and the results showed good repeatability of the amplification bands in both combinations, indicating that they can amplify the Oriental White Stork target fragment under positive template conditions.

[0025] In the negative validation experiment, bands appeared at different positions in combinations 1-1, 2-1, and 3-1, which may be primer dimers or non-specific amplification bands. In contrast, the negative results of combinations 1-2 and 2-2 were cleaner, with no obvious interfering bands, and therefore they are more suitable as the preferred combinations for subsequent detection of Oriental White Stork RPA-nfo colloidal gold test strips.

[0026] In the RPA-nfo colloidal gold test strip positive assay, only combinations 1-2 and 2-2 were tested. Each combination was tested in triplicate. Under the Oriental White Stork positive template conditions, clear C and T lines were observed in both combinations, indicating that the two combinations can achieve visualized detection of the Oriental White Stork target fragment in the RPA-nfo colloidal gold test strip system.

[0027] Compared to traditional PCR, qPCR, or sequencing methods, this invention employs isothermal amplification and colloidal gold test strips for assessment, offering advantages such as relatively simple reaction conditions, visualized results, lower equipment dependence, and suitability for subsequent rapid on-site screening development. Compared to unscreened candidate combinations, combinations 1-2 and 2-2 demonstrate better application potential based on three types of experimental results: positive amplification, negative verification, and test strip color development.

[0028] The technical effects of this invention are:

[0029] (1) This invention first screened out a specific RPA-nfo primer-probe combination for the target sequence EU263930.1 of Oriental White Stork. Through positive amplification, negative verification and test strip color development triple experiment, it was proved that the combination 1-2 and 2-2 have high specificity and sensitivity.

[0030] (2) This invention uses isothermal amplification (37-42℃) and visual judgment with colloidal gold test strips. It does not require thermal cycler, fluorescence quantitative PCR instrument, electrophoresis imaging system or sequencing platform. It is easy to operate and suitable for rapid detection in the field or at the grassroots level.

[0031] (3) This invention can be directly applied to the rapid screening of environmental DNA samples or tissue DNA, providing a convenient molecular tool for the monitoring and protection management of Oriental White Stork populations. The detection cycle is short, enabling rapid detection of Oriental White Stork DNA. Attached Figure Description

[0032] Figure 1 The flowchart for the Oriental White Stork RPA-nfo colloidal gold test strip shows the process of sample collection or DNA template preparation, RPA-nfo isothermal amplification, amplification product dilution, colloidal gold test strip detection, and result interpretation.

[0033] Figure 2Agarose gel electrophoresis images of RPA amplification products using the preferred primer combinations with the Oriental White Stork synthetic target fragment as a template. 1: RPA amplification product of primer combination 1-2; 2: RPA amplification product of primer combination 2-2. Using the recombinant plasmid of the Oriental White Stork synthetic target fragment as a positive template, both combinations 1-2 and 2-2 can amplify bands near the target size.

[0034] Figure 3 The image shows the positive detection results of the optimized primer-probe combination RPA-nfo colloidal gold test strip. Using the recombinant plasmid of the Oriental White Stork synthetic target fragment as a positive template, the amplification products of optimized primer-probe combinations 1-2 and 2-2 were detected using the RPA-nfo colloidal gold test strip system. 1: Primer-probe combination 1-2; 2: Primer-probe combination 2-2. The results show that both test strips exhibited a control line (C line) and a detection line (T line), indicating a positive result. This demonstrates that combinations 1-2 and 2-2 can both achieve visual positive detection of the Oriental White Stork target fragment under the conditions of this embodiment.

[0035] Figure 4 Agarose gel electrophoresis images of RPA amplification products from primer combinations 1-2 in the negative control. 1: Negative control reaction products of primer combinations 1-2. No Oriental White Stork target fragment template was added to the negative control reaction. Electrophoresis results show that no clear specific amplification bands were observed near the size of the target amplification fragment, indicating that primer combinations 1-2 did not produce obvious primer dimers or non-specific amplification bands under the negative reaction conditions of this example.

[0036] Figure 5 Agarose gel electrophoresis image of the RPA amplification product of primer combination 2-2 negative control. 1: Negative control reaction product of primer combination 2-2. No Oriental White Stork target fragment template was added to the negative control reaction. The electrophoresis results show that no clear specific amplification band was observed near the size of the target amplification fragment, indicating that primer combination 2-2 did not produce obvious primer dimers or non-specific amplification bands under the negative reaction conditions of this example.

[0037] Figure 6 The detection results of the preferred primer-probe combination negative control RPA-nfo colloidal gold test strip are shown in the figure. 1: Negative control reaction product of primer-probe combination 1-2; 2: Negative control reaction product of primer-probe combination 2-2. No Oriental White Stork target fragment template was added to the negative control reaction. The results show that both combination 1-2 and combination 2-2 test strips only showed the control line C, and no detection line T was observed, indicating a negative result. This suggests that the two preferred combinations did not produce obvious non-specific amplification signals that could lead to a positive result under the negative reaction conditions of this embodiment. Detailed Implementation

[0038] This invention provides an RPA-nfo primer-probe combination for rapid DNA detection in Oriental White Storks, a kit containing this combination, and a corresponding detection method. The method uses a target fragment related to Oriental White Stork EU263930.1 as the detection target. The target fragment is presented as a positive template in the form of a synthetic target fragment recombinant plasmid, and the target fragment is approximately 464 bp in length. SEQ ID NO:1 is the sequence of the target fragment related to Oriental White Stork EU263930.1.

[0039] This invention designs and tests six pre-defined RPA-nfo candidate combinations. These combinations are not obtained by randomly crossing multiple primer sets and probes, but rather by fixing the combination relationship based on the principle that the probe must be located within the amplified fragment of the corresponding F / R primer. The six candidate combinations are 1-1, 1-2, 2-1, 2-2, 3-1, and 3-2. Through positive template basic RPA electrophoresis experiments, negative verification experiments, and positive experiments using RPA-nfo colloidal gold test strips, combinations 1-2 and 2-2 were determined to be the current preferred combinations.

[0040] Combinations 1-2 include ProbePanel_1_2_F, ProbePanel_1_2_R, and ProbePanel_1_1_Probe. The sequence of ProbePanel_1_2_F is TATCCATAAAGCATTGCAGAGAACCACCACT; the sequence of ProbePanel_1_2_R is TAACTGCAGTGGGAAATATACTAGCTAGCTG, with a biotin modification at the 5' end; the sequence of ProbePanel_1_1_Probe is AATTAATGTCTTAGAACAAGTACAATGTATGCCCT / idSp / AGATCAGTGTAATG, with a 6-FAM modification at the 5' end, containing an idSp site, and a C3 spacer closed at the 3' end.

[0041] Combination 2-2 includes ProbePanel_2_2_F, ProbePanel_2_2_R, and ProbePanel_2_1_Probe. The sequence of ProbePanel_2_2_F is CATAAAGCATTGCAGAGAACCACCACTTAAA; the sequence of ProbePanel_2_2_R is TGTAGATGTGCATTAACTTGCTTGTCCGCTT, with a biotin modification at the 5' end; the sequence of ProbePanel_2_1_Probe is AATCAATTAATGTCTTAGAACAAGTACAATGTAT / idSp / CCCTAAGATCAGTG, with a 6-FAM modification at the 5' end, containing an idSp site, and a C3 spacer closed at the 3' end.

[0042] In implementing this invention, the aforementioned primer-probe combination can be used in conjunction with a commercially available DNA isothermal rapid amplification kit and / or a nucleic acid colloidal gold test strip. The basic RPA electrophoresis screening experiment can use a commercially available basic DNA isothermal rapid amplification kit, and the reaction system should be prepared and amplification and pre-electrophoresis pretreatment performed according to the kit's instructions. The RPA-nfo colloidal gold test strip detection experiment can use a commercially available colloidal gold test strip-type DNA isothermal rapid amplification kit, and isothermal amplification should be performed according to the kit's instructions. After amplification, the amplified products can be diluted according to the nucleic acid test strip instructions and then detected using a colloidal gold test strip.

[0043] The detection method of this invention includes: preparing a DNA template to be tested; preparing an RPA-nfo reaction system containing an F primer, a 5' Biotin-R primer, and an nfo probe; adding the template and a start-up buffer for isothermal amplification; diluting the amplification product and adding it to the colloidal gold test strip detection system; and determining whether the sample contains Oriental White Stork DNA based on the color development result of the test strip. Specifically, simultaneous color development of both the C and T lines indicates a positive result, color development of only the C line indicates a negative result, and no color development of the C line indicates an invalid detection. The main sequences involved in this invention are shown in Table 1.

[0044] Table 1

[0045] SEQ ID NO:1 Target fragment related to Oriental White Stork EU263930.1 CACCATCAGAAAAAGAGGGCTCAAACCTCTACCTCCAACTCCCAAAGCTGGTATTCTACATTAAACTATTCTCTGAACCCCCAACCTAAACTGCTCGAATCGTCCCACGAGATAGCCCTCGTACAACCTCCAGTACAACGAACAGCGTCAGCAGCAACCCCCATCCCCTATCAGAAATATTCCT GCCCCCTCCGAATAGAACATTGCCACCCACTAAAATCTAACCGAGCAAAAGACAAACCCCCACTATCAACCGTAACCACCCCCACCTTCCAGCACTCAGCAAAACCTCCACAGCCCCCCCAACCATCAGCACCAAAATAAGCCCCACACCATACATTACAACTTGCCGGCTCCCCCAAGCTTC The synthesized target fragment recombinant plasmid was a positive template, with the target fragment being approximately 464 bp in length. SEQ ID NO:2 ProbePanel_1_1_F CATAAAGCATTGCAGAGAACCACCACTTAAA upstream primer SEQ ID NO:3 ProbePanel_1_1_R CTGCAGTGGGAAATATACTAGCTAGCTGCTC 5' Biotin-modified R primer SEQ ID NO:4 ProbePanel_1_1_Probe AATTAATGTCTTAGAACAAGTACAATGTATGCCCT / idSp / AGATCAGTGTAATG 5'6-FAM, internal idSp, 3'C3 Spacer probe SEQ ID NO:5 ProbePanel_1_2_F TATCCATAAAGCATTGCAGAGAACCACCACT upstream primer SEQ ID NO:6 ProbePanel_1_2_R TAACTGCAGTGGGAAATATACTAGCTAGCTG 5' Biotin-modified R primer SEQ ID NO:7 ProbePanel_2_1_F CCATTACAGAGCCTATCCATAAAGCATGCA upstream primer SEQ ID NO:8 ProbePanel_2_1_R GTAGATGTGCATTAACTTGCTTGTCCGCTTA 5' Biotin-modified R primer SEQ ID NO:9 ProbePanel_2_1_Probe AATACAATTAATGTCTTAGAACAAGTACAATGTAT / idSp / CCCTAAGATCAGTG 5'6-FAM, internal idSp, 3'C3 Spacer probe SEQ ID NO:10 ProbePanel_2_2_F CATAAAGCATTGCAGAGAACCACCACTTAAA upstream primer SEQ ID NO:11 ProbePanel_2_2_R TGTAGATGTGCATTAACTTGCTTGTCCCGCTT 5' Biotin-modified R primer SEQ ID NO:12 ProbePanel_3_1_R GTAGATGTGCATTAACTTGCTTGTCCGCTTA 5' Biotin-modified R primer SEQ ID NO:13 ProbePanel_3_1_Probe CAATACAATTAATGTCTTAGAACAAGTACAATGTA / idSp / GCCCTAAGATCAGT 5'6-FAM, internal idSp, 3'C3 Spacer probe SEQ ID NO:14 ProbePanel_3_2_F TATCCATAAAGCATTGCAGAGAACCACCACT upstream primer SEQ ID NO:15 ProbePanel_3_2_R GATGTGCATTAACTTGCTTGTCCGCTTAACA 5' Biotin-modified R primer

[0046] The fixed combination relationships and theoretical amplified fragment lengths for each combination are shown in Table 2.

[0047] Table 2

[0048] 1-1 ProbePanel_1_1_F + ProbePanel_1_1_R +ProbePanel_1_1_Probe Approximately 234 bp Non-preferred; bands appear at different locations in the negative test. 1-2 ProbePanel_1_2_F + ProbePanel_1_2_R +ProbePanel_1_1_Probe Approximately 241 bp Preferred Combination 1 2-1 ProbePanel_2_1_F + ProbePanel_2_1_R +ProbePanel_2_1_Probe Approximately 207 bp Non-preferred; bands appear at different locations in the negative test. 2-2 ProbePanel_2_2_F + ProbePanel_2_2_R +ProbePanel_2_1_Probe Approximately 191 bp Preferred Combination Two 3-1 ProbePanel_2_2_F + ProbePanel_3_1_R +ProbePanel_3_1_Probe Approximately 194 bp Non-preferred; bands appear at different locations in the negative test. 3-2 ProbePanel_3_2_F + ProbePanel_3_2_R +ProbePanel_3_1_Probe Approximately 191 bp Candidate combinations are not currently considered core preferred options.

[0049] The principle of this invention is:

[0050] If the Oriental White Stork DNA or environmental DNA sample contains the target fragment related to Oriental White Stork EU263930.1, this target fragment can be used as a template for RPA-nfo amplification. Under isothermal conditions, the RPA reaction involves the synergistic action of recombinase, single-strand binding protein, and strand displacement DNA polymerase, enabling the primer to recognize and invade the target double-stranded DNA region, followed by polymerase extension to form the amplification product.

[0051] In the RPA-nfo system, the nfo probe contains 5'FAM modification, an internal idSp site, and a 3'C3 spacer blocking structure, which can participate in target fragment recognition and amplification product formation under the nfo-related reaction mechanism. The R primer with 5'Biotin modification works together with the probe with 5'FAM modification to make the target amplification product dual-labeled with FAM and Biotin.

[0052] The colloidal gold test strip is a lateral chromatography test strip. During detection, the amplification products labeled with both FAM and Biotin can be identified and captured during lateral chromatography, forming a visible band on the detection line (T line). The control line (C line) is used to display the chromatographic process and the validity of the test strip. Therefore, the presence of Oriental White Stork-specific DNA in the sample can be determined by visually observing the color development of the C and T lines.

[0053] For details, please see the appendix. Figure 1 The RPA-nfo colloidal gold test strip detection method of the present invention can be implemented according to the following steps: Step 1, prepare the sample DNA or positive template DNA; Step 2, prepare the RPA-nfo reaction system; Step 3, add F primer, 5' Biotin-R primer and nfo probe to the system; Step 4, add DNA template and start-up buffer; Step 5, perform isothermal amplification at 37-42℃, preferably at 42℃ for 15-20 min; Step 6, dilute the amplification product 10-20 times with ddH2O or the test strip's specified diluent; Step 7, insert the colloidal gold test strip for color development; Step 8, observe the C line and T line within 5 min; Step 9, make a judgment based on the color development results.

[0054] The 50 μL colloidal gold RPA-nfo reaction system may include: 29.4 μL AD buffer, 2 μL F primer (10 μM), 2 μL Biotin-R primer (10 μM), 0.6 μL nfo probe (10 μM), 13.5 μL ddH2O and template combined, and 2.5 μL B buffer. For positive template reactions, 5 μL template and 8.5 μL ddH2O can be added; for NTC reactions, 13.5 μL ddH2O is added, without template.

[0055] In the optimal combination screening stage, basic RPA electrophoresis can be used to verify the amplification ability of F / R primers. A basic RPA 50 μL reaction system may include: 29.4 μL A buffer, 2 μL F primer (10 μM), 2 μL R primer (10 μM), 14.1 μL DNA template and ddH2O combined, and 2.5 μL B buffer. The reaction conditions are 37-39 ℃ for 30 min. After amplification, 50 μL of RPA product is mixed with 8 μL of 6× DNA Loading Buffer and incubated at 56 ℃ for 5 min. 5 μL of the mixture is then loaded onto a 2% agarose gel for electrophoresis, and the amplified product is determined based on the 100-300 bp band. The basic RPA 50 μL reaction system and the colloidal gold RPA-nfo 50 μL reaction system are shown in Tables 3 and 4, respectively.

[0056] Table 3

[0057] A buffer 29.4 μL F primer, 10 μM 2 μL R primer, 10 μM 2 μL <![CDATA[DNA template + ddH₂O]]> 14.1 μL B buffer 2.5 μL Overall system 50 μL

[0058] Table 4

[0059] AD buffer 29.4 μL F primer, 10 μM 2 μL Biotin-R primers, 10 μM 2 μL nfo probe, 10 μM 0.6 μL <![CDATA[ddH2O + Template]]> 13.5 μL B buffer 2.5 μL Overall system 50 μL

[0060] The technical solution of the present invention will be further illustrated by the following examples.

[0061] Example 1: Design and screening of RPA-nfo primer-probe combinations for Oriental White Stork

[0062] Using the target fragment related to Oriental White Stork EU263930.1 as the detection target, a synthetic target fragment recombinant plasmid was used as a positive template. The target fragment is approximately 464 bp in length, and SEQ ID NO:1 is the sequence of the target fragment related to Oriental White Stork EU263930.1.

[0063] Based on the target fragments described above, six pre-designed RPA-nfo candidate combinations were designed: 1-1, 1-2, 2-1, 2-2, 3-1, and 3-2. These six combinations have a fixed relationship, and the probes must be located inside the corresponding F / R primer amplification fragments. They are not random cross-combinations of multiple primer sets and multiple probes.

[0064] The theoretical amplified fragment lengths for the six candidate combinations are as follows: 1-1 approximately 234 bp, 1-2 approximately 241 bp, 2-1 approximately 207 bp, 2-2 approximately 191 bp, 3-1 approximately 194 bp, and 3-2 approximately 191 bp. The theoretical amplified fragments are mainly concentrated in the 190-241 bp range, belonging to small fragment amplification products. For electrophoresis, a 50 bp DNA ladder or other DNA markers that can clearly distinguish the 100-300 bp range are suitable for evaluation. (See appendix) Figure 2 .

[0065] Subsequent positive template basic RPA electrophoresis experiment, negative verification experiment and RPA-nfo colloidal gold test strip positive experiment determined combination 1-2 and combination 2-2 as the current preferred combination.

[0066] Example 2: Basic RPA electrophoresis verification using synthetic target fragments as templates

[0067] This embodiment was used to verify whether the candidate F / R primer combination could amplify a band near the target size under the positive template condition of Oriental White Stork. The experimental materials included the recombinant plasmid of the target fragment related to Oriental White Stork EU263930.1, the basic DNA isothermal rapid amplification kit (WLB8201KIT, 48 kits / kit), the candidate F / R primer combination, 2% agarose gel and DNA marker.

[0068] The basic 50 μL reaction system includes: 29.4 μL A buffer, 2 μL F primer (10 μM), 2 μL R primer (10 μM), 14.1 μL DNA template and ddH2O combined, and 2.5 μL B buffer. For the positive template reaction, add 5 μL DNA template and 9.1 μL ddH2O; for the NTC reaction, add 14.1 μL ddH2O, without template.

[0069] The reaction conditions were 37-39 ℃ for 30 min. After amplification, 50 μL of RPA product was mixed with 8 μL of 6×DNALoading Buffer and incubated at 56 ℃ for 5 min. 5 μL of the mixture was then loaded onto a 2% agarose gel for electrophoresis.

[0070] Experimental results showed that after RPA amplification using the synthesized target fragment as a template, both combinations 1-2 and 2-2 exhibited clear amplification bands in agarose gel electrophoresis. Each combination was performed in duplicate, and the results showed good reproducibility of the amplification bands for combinations 1-2 and 2-2, suggesting that they can amplify the Oriental White Stork target fragment under positive template conditions. (See appendix) Figure 2 .

[0071] Example 3: Negative Verification and Determination of Optimal Combination

[0072] This embodiment is used to evaluate whether candidate primer combinations exhibit nonspecific amplification or primer dimer-related bands under template-free conditions. Negative experiments were performed using test strips and agarose gel electrophoresis.

[0073] The experimental results showed that the negative results for combinations 1-2 and 2-2 were relatively clean, with no obvious interfering bands observed. (See appendix) Figure 4 and attached Figure 5 Therefore, under the current experimental conditions, combinations 1-2 and 2-2 are more suitable as the preferred combinations for detecting Oriental White Stork RPA-nfo colloidal gold test strips compared to other candidate combinations.

[0074] Example 4: Positive Verification of RPA-nfo Colloidal Gold Test Strip

[0075] This embodiment is used to verify whether the preferred combinations 1-2 and 2-2 can achieve positive visual detection in the RPA-nfo colloidal gold test strip system. Experimental materials include a positive template of the Oriental White Stork synthetic target fragment recombinant plasmid, a colloidal gold DNA isothermal rapid amplification kit (WLN8203KIT, 48 kits / box), F / R primers and corresponding probes ProbePanel_1_1_Probe for combinations 1-2, F / R primers and corresponding probes ProbePanel_2_1_Probe for combination 2-2, and colloidal gold test strips.

[0076] The 50 μL colloidal gold reaction system includes: 29.4 μL AD buffer, 2 μL F primer (10 μM), 2 μL Biotin-R primer (10 μM), 0.6 μL nfo probe (10 μM), 13.5 μL ddH2O and template combined, and 2.5 μL B buffer. For the positive template reaction, 5 μL template and 8.5 μL ddH2O are added; for the NTC reaction, 13.5 μL ddH2O is added, but no template is added.

[0077] The reaction conditions are 42 ℃ for 15-20 min. After amplification, the amplification product is diluted 10-20 times with ddH2O or the specified diluent for the test strip, and then developed using colloidal gold test strips. The results are observed within 5 min.

[0078] In the experimental design, only the two preferred combinations, 1-2 and 2-2, were used for the positive test strip experiment, with three replicates for each primer-probe combination. See 3 and appendix. Figure 6 The experimental results showed that both combinations 1-2 and 2-2 produced clear two lines on the colloidal gold test strip under the Oriental White Stork positive template condition, namely the control line (C line) and the detection line (T line). Positive color development was observed in three replicates for each combination, indicating that the two combinations can achieve visualized detection of the Oriental White Stork target fragment in the RPA-nfo colloidal gold test strip system.

[0079] It should be further noted that the above embodiments are merely for understanding the technical solution of the present invention and are not intended to limit the scope of protection of the present invention. Any obvious adjustments or modifications made to the technical solution of the present invention that fall within the inventive concept are also within the scope of protection of the present invention.

Claims

1. An RPA-nfo primer-probe combination for rapid DNA detection in Oriental White Storks, characterized in that, The combination is either combination 1-2 or combination 2-2; The combination 1-2 includes: an upstream primer ProbePanel_1_2_F, the sequence of which is SEQ ID NO:5; a downstream primer ProbePanel_1_2_R, the sequence of which is SEQ ID NO:6, and the 5′ end of the downstream primer is modified with biotin; and a probe ProbePanel_1_1_Probe, the sequence of which is SEQ ID NO:4, and the 5′ end of the probe is modified with 6-FAM, contains an idSp site, and the 3′ end is closed with a C3 spacer; The combination 2-2 includes: an upstream primer ProbePanel_2_2_F, whose sequence is SEQ ID NO:10; a downstream primer ProbePanel_2_2_R, whose sequence is SEQ ID NO:11, and the 5′ end of the downstream primer is modified with biotin; and a probe ProbePanel_2_1_Probe, whose sequence is SEQ ID NO:9, and the 5′ end of the probe is modified with 6-FAM, contains an idSp site, and the 3′ end is closed with a C3 spacer.

2. A rapid DNA detection kit for Oriental White Storks, characterized in that, It includes the primer and probe combination as described in claim 1, as well as reagents and / or colloidal gold test strips for RPA-nfo amplification.

3. The reagent kit according to claim 2, characterized in that, The colloidal gold test strip is a lateral chromatography test strip.

4. A rapid DNA detection method for Oriental White Storks, characterized in that, Includes the following steps: (1) Prepare the DNA template to be tested; (2) Prepare a colloidal gold RPA-nfo reaction system, wherein the system contains any one of the primer-probe combinations described in claim 1; (3) Add the DNA template and carry out the amplification reaction under isothermal conditions; (4) After diluting the amplification product, add it to the colloidal gold test strip for color development; (5) Determine whether the sample contains Oriental White Stork DNA based on the color development of the control line and the detection line of the test strip.

5. The method according to claim 4, characterized in that, The isothermal amplification temperature is 37-42℃, and the amplification time is 15-20 minutes.

6. The method according to claim 5, characterized in that, The colloidal gold RPA-nfo reaction system is a 50 μL system, which consists of: 29.4 μL AD buffer, 2 μL 10 μM upstream primer, 2 μL 10 μM downstream primer, 0.6 μL 10 μM probe, 13.5 μL template and ddH2O, and 2.5 μL B buffer.

7. The method according to claim 5, characterized in that, The dilution mentioned in step (4) is to dilute 10-20 times with ddH2O or the diluent specified on the test strip.

8. The method according to claim 5, characterized in that, The judgment criteria for step (5) are as follows: if both the control line and the test line show color, it is considered positive; if only the control line shows color, it is considered negative; and if the control line does not show color, it is considered invalid.

Images