A SNP molecular genetic marker associated with milk production traits in buffalo and its application

Abstract

This invention discloses a SNP molecular genetic marker associated with milk production in buffalo and its application. The SNP molecular genetic marker is located at 28,942,786 bp on chromosome 1 of the buffalo genome, with a base of C or T at this locus. Further research shows that this SNP molecular genetic marker is associated with milk production in buffalo. The milk production trait can be identified by detecting the genotype of this molecular genetic marker. Three genotypes exist at this locus: CC, CT, or TT. Individuals with the CC and CT genotypes have significantly higher milk production than those with the TT genotype. In breeding, retaining individuals with the CC genotype of the SNP molecular marker can improve the milk production performance of offspring buffalo. Therefore, the molecular marker provided by this invention can be used to cultivate new high-milk-producing buffalo breeds, providing an effective genetic technology means for the genetic improvement of milk production traits in buffalo, and has significant application value in the buffalo farming industry.

Description

Technical Field

[0001] This invention belongs to the field of livestock molecular marker preparation technology, specifically, it relates to an SNP molecular genetic marker related to milk production traits in buffalo and its application. Background Technology

[0002] In livestock breeding, milk production is one of the most valuable economic traits, determined by multiple minor genes, and is a typical quantitative trait controlled by multiple genes. In buffalo, buffalo milk is highly nutritious and flavorful, making it a premium specialty milk. However, buffalo milk production is low. Ultimately, increasing buffalo milk production requires research into the genomic genetic material. Therefore, determining the relationship between genetic markers or single nucleotide polymorphisms (SNPs) and milk production traits through candidate genes is of significant research importance.

[0003] Molecular markers are one of the most widely used and effective breeding techniques in livestock and poultry genetic improvement. They offer advantages such as being unaffected by external environmental factors, simple and accurate identification, shortening time intervals, and enabling early selection to significantly improve selection efficiency. Patent CN119710024A discloses a molecular marker associated with buffalo lactation traits, discovering a locus in the APOA1 gene that is associated with high / low milk yield, peak milk yield, milk fat percentage, milk fat content, milk protein percentage, and milk protein content in buffalo lactation. This provides candidate genes for selecting buffalo breeds with superior traits and obtains the optimal haplotype combination (CAGC / CAGC) based on multiple molecular markers. Simultaneously, it can screen individuals with higher milk yield, higher milk fat percentage, higher milk protein percentage, and higher milk protein content, greatly improving the accuracy of selection and overcoming the limitations of methods that can only screen for high / low milk yield, thus advancing the selection of milk production performance. Patent CN103898106A discloses SNP markers associated with milk production traits in buffalo. The SNP markers are located at the following positions in the buffalo LPAAT gene: G886-A886, T1471-A1471, A2472-G2472, T2813-C2813, C3393-T3393, and C5540-T5540. All of these mutations are significantly associated with milk production in buffalo (p<0.05). The mutation at position 1386, A1386-G1386, is extremely significantly associated with milk production in buffalo. Patent CN111996262A also discloses the application of five SNP loci in buffalo milk production traits or molecular breeding analysis, providing support for upstream and downstream breeding processes and offering advantages such as high measurement accuracy; it can improve the milk production performance of dairy buffaloes. It is evident that molecular marker-assisted selection technology is widely used in buffalo genetic improvement, providing a rapid method for improving milk production traits with moderate heritability. Further exploration of molecular markers significantly associated with buffalo milk production traits remains of great significance in providing resource support for the modern scientific breeding of buffaloes. Summary of the Invention

[0004] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide a SNP molecular genetic marker related to milk production traits in Nili-Rafi buffalo.

[0005] A second objective of this invention is to provide a primer set for detecting the aforementioned SNP molecular markers.

[0006] A third objective of this invention is to provide a kit comprising the aforementioned primer set.

[0007] The fourth objective of this invention is to provide the application of the above-mentioned SNP molecular markers, primer sets, or kits in buffalo breeding.

[0008] The fifth objective of this invention is to provide the application of the above-mentioned SNP molecular markers, primer sets, or kits in screening buffaloes with high milk production.

[0009] The sixth objective of this invention is to provide a method for breeding buffaloes with high milk production.

[0010] The above-mentioned objective of this invention is achieved through the following technical solution: This invention provides a SNP molecular genetic marker associated with milk production traits in buffalo. The SNP molecular genetic marker is located at 28,942,786 bp on chromosome 1 of the buffalo genome, and the base at this site is C or T. The reference genome version number is GCF_019923935.1.

[0011] This invention, through analysis of the genomic DNA of Nili-Rafi buffalo, identified a C / T polymorphism at a base position of 28,942,786 bp on chromosome 1 (genomic version number GCF_019923935.1). Genotyping of this molecular marker revealed three genotypes: CC, CT, and TT. Further research showed a strong correlation between these genotypes and milk production; individuals with the CC and CT genotypes produced significantly more milk than those with the TT genotype. Therefore, the molecular marker provided by this invention can be used for the breeding of new high-milk-producing buffalo breeds.

[0012] Furthermore, the SNP molecular genetic marker is located at the 86th bp of the nucleotide sequence described in SEQ ID NO.1.

[0013] The present invention also provides a primer set for detecting the above-mentioned SNP molecular genetic markers.

[0014] The primer set provided by this invention can amplify the nucleotide sequence shown in SEQ ID NO.1, and the SNP molecular genetic marker associated with the milk production trait of buffalo is located at the 86th bp of the nucleotide sequence shown in SEQ ID NO.1.

[0015] Furthermore, the nucleotide sequences of the primer set are shown in SEQ ID NO.2-4.

[0016] The present invention also provides a kit comprising the above-described primer set.

[0017] The present invention also provides the application of the above-mentioned SNP molecular genetic markers, primer sets, or kits in buffalo breeding, wherein the breeding is for breeding buffaloes with high milk production.

[0018] Furthermore, the breeding involves selecting individuals with the SNP genotype CC for preservation.

[0019] The present invention also provides the application of the above-mentioned SNP molecular genetic markers, primer sets, or kits in screening / identifying buffaloes with high milk production.

[0020] The present invention also provides the application of the above-mentioned SNP molecular genetic markers, primer sets, or kits in detecting the milk production trait of buffalo.

[0021] The present invention also provides a method for breeding buffalo with high milk production, wherein the method involves detecting the above-mentioned SNP molecular markers and selecting individuals with the genotype CC for breeding.

[0022] This invention promotes buffalo breeding by preserving buffalo individuals with the CC genotype and culling those with the TC or TT genotypes. Specifically, the CC genotype is prioritized for preservation during breeding, and the CC genotype is used as breeding stock for crossbreeding with other buffalo. Artificial insemination using semen from CC genotype bulls significantly improves breeding efficiency, resulting in a buffalo population with superior milk production. This avoids the occurrence of TT-type buffalo in offspring when using TC genotype buffalo for breeding selection, providing an effective genetic technology for improving the milk production trait in buffalo.

[0023] Furthermore, the detection method includes one or more of the following: PCR amplification and direct sequencing, probe method, gene chip method, or high-resolution melting curve method.

[0024] Furthermore, the PCR amplification direct sequencing method involves amplifying the buffalo genome using the aforementioned primer set and then performing Sanger sequencing on the amplification results.

[0025] Furthermore, the buffalo breed is the Nili-Raffi buffalo.

[0026] Specifically, the present invention provides a method for breeding buffaloes with high milk production, wherein genomic DNA is extracted from buffalo blood samples, and PCR amplification is performed using primer combinations with nucleotide sequences as shown in SEQ ID NO.2-4 to obtain the genotype of the molecular marker chr1:28942786. Buffalo individuals with the genotype CC are retained, while buffalo individuals with the genotype TC or TT are culled for buffalo breeding.

[0027] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a SNP molecular genetic marker associated with milk production traits in buffalo and its application. The SNP molecular genetic marker described in this invention is located at position 28,942,786 bp on chromosome 1 of the buffalo genome, with a base sequence of C or T, and a genome version number of GCF_019923935.1. Further research results show that the SNP molecular genetic marker provided in this invention is associated with milk production traits in buffalo. The milk production trait can be identified by detecting the genotype of this molecular marker. This SNP locus has three genotypes: CC, CT, and TT. Individuals with the CC and CT genotypes have significantly higher milk production than those with the TT genotype. In breeding, by retaining individuals with the CC genotype of the SNP molecular marker and culling individuals with the TC or TT genotypes, the milk production performance of offspring buffalo can be improved. Therefore, the molecular marker provided in this invention can be used for the breeding of high-quality dairy buffalo breeds, providing an effective genetic technology means for the genetic improvement of milk production traits in buffalo, and has significant application value in the buffalo farming industry. Attached Figure Description

[0028] Figure 1 This is a sequencing peak diagram of the buffalo chr1:28942786 locus. Detailed Implementation

[0029] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0030] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0031] Example 1: Identification of SNP loci closely related to milk production traits in buffalo This invention involves 5X genome resequencing of 205 Nili-Rafi buffalo. The raw high-depth resequencing data was quality filtered using Trimmomatic v0.39. BWA v0.7.18 software was used to align the quality-filtered sequencing data with the buffalo GCF_019923935.1 reference genome sequence, ultimately generating a SAM file conforming to the standard alignment format. SAMtools v1.20 software was used to convert the SAM file into a binary BAM file and sort the BAM files. The MarkDuplicates module of GATK v4.5 was used to annotate PCR repeats, and SAMtools v1.20 software was used to generate an index file for the BAM format file. SNP calling was performed using GATK v4.5 software to obtain SNPs across the entire genome.

[0032] Daily milk production records were collected from 205 buffaloes during their complete lactation period, and statistical analysis was performed to obtain the milk production over 280 days. Genome-wide association analysis (GWAS) was conducted using a mixture of linear models in GEMMA v0.98 software. The GEMMA analysis consisted of two steps: First, the kinship matrix was calculated using the command `gemma -bfile example -gk 2 -o kin`, where the .fam file in the input file needed to have its phenotypic values ​​replaced with the true phenotypic values. Second, GWAS analysis was performed using a mixture of linear models using the command `gemma -bfileexample -k output / kin.example.txt -lmm 1 -c gemmacov.txt -o GE_GWAS`. `gemmacov.txt` was a covariate file consisting of the 10 principal components (PC1 to PC10). The resulting file was `GE_GWAS.assoc.txt`, which contained the p-values ​​for the association between each SNP and the phenotypic traits. A smaller p-value, i.e., a larger -log(P), indicated a higher association between the SNP and the trait.

[0033] Association analysis revealed a C / T polymorphism at 28,942,786 bp on chromosome 1 of the Nili-Rafi buffalo (genome version number GCF_019923935.1), and this site may be closely related to the milk production trait of buffalo.

[0034] Example 2: Amplification of the C>T mutation site in chr1:28942786 I. Experimental Methods This embodiment provides a method for amplification and genotyping of the C>T mutation site at chr1:28942786, specifically including the following steps: 1. Primer Design: A primer combination was designed targeting the C / T polymorphism site at SEQ ID NO.1, and the nucleotide sequence of the designed primer combination is as follows: The nucleotide sequence of the SNP molecular marker is: GCAGCTTCTGAATATGCAGCTTGTCGGCATGAACTCTGGATGCACCTTGCTGCTGCTGCTGCTGCTAAGTCGCTTCAGTCGTGTCCGACTCTGTGCGACCCCATAGACGGCAGCCCACCAGGCTCCGCCGTCCCTGGGATTCTCCAGGCA (SEQ ID NO.1). Upstream primer F: 5'-CAGCTTGTCGGCATGAACTCT-3' (SEQ ID NO.2); Downstream primer R: 5'-TCGGACACGACTGAAGCGACT-3' (SEQ ID NO.3); Extension primer: 5'-AGCTTGTCGGCATGAACTCTGG-3' (SEQ ID NO.4); Using buffalo genomic DNA as a template, the nucleotide fragment containing the SNP to be tested was amplified.

[0035] 2. DNA Quality Control: Genomic DNA was extracted from whole blood of Nili-Rafi buffalo using a DNA extraction kit. All DNA samples were analyzed using a NanoDrop 2000 instrument for OD value determination and 1.25% agarose gel electrophoresis to assess whether they met the SNP genotyping DNA quality requirements. (1) The DNA electrophoresis results showed a single band, and the gDNA was intact without severe degradation; (2) The OD260 / 280 value is between 1.8 and 2.0, and the OD260 / 230 value is between 1.8 and 2.0.

[0036] 3. Genotyping Detection: The SNP site is located at 86 bp of the PCR amplification fragment (its sequence is the same as SEQ ID NO.1), where the base is C or T. The PCR amplification system used in 50 μL of the reaction consists of: 1 μL genomic DNA template, 1 μL each of 10 pmol / μL forward and reverse primers, 4 μL dNTP Mixture, 0.25 μL 5 U / μL TaKaRa Taq, and 5 μL 10×PCR Buffer (Mg... 2+ The reagents were free of MgCl2 (25 mM) and MgCl2 (3 μL), with the remainder being double-distilled water. The PCR reaction conditions were: 94℃ denaturation for 30 s, 56.1℃ annealing for 30 s, and 72℃ extension for 1 min, for a total of 30 cycles. Before use, the reagents were placed on ice, and the reaction mixture was prepared on ice.

[0037] II. Experimental Results The PCR amplification products described above were analyzed using Sanger sequencing. The sequencing peak diagram is shown below. Figure 1 As shown, the genotypes of the SNP molecular markers are CC, CT, or TT.

[0038] Example 3: Application of the molecular markers provided in Example 1 in association analysis of milk production traits in buffalo. I. Experimental Methods 1. This invention detects the genotype of the chr1:28942786 C>T mutation site in 100 buffaloes.

[0039] 2. At the same time, the milk production of these 100 buffaloes was statistically analyzed to examine the impact of the chr1:28942786 C>T mutation site on the milk production of buffaloes.

[0040] II. Experimental Results The genotyping results are shown in Table 1. Among 100 buffalo individuals, 26 had the CC genotype, 52 had the CT genotype, and 22 had the TT genotype. The association analysis between genotype and milk production traits showed that, for the chr1:28942786 C>T locus, the milk production of individuals with the CC and CT genotypes was significantly greater than that of individuals with the TT genotype (P<0.01), indicating a close correlation between this genotype and the milk production trait in buffalo. Therefore, buffalo with high milk production can be screened based on the genotype at this locus.

[0041] Table 1. Association analysis results between chr1:28942786 locus gene polymorphism and buffalo milk yield.

[0042] Note: If the superscript letters of the numerical values ​​are the same, it indicates that the difference is not significant; if the letters are different, it indicates that the difference is significant.

[0043] Furthermore, the CC genotype is selected for preservation during buffalo breeding, and used as breeding stock for crossbreeding with other buffalo. In particular, artificial insemination using semen from CC genotype bulls can significantly improve breeding efficiency, resulting in a buffalo population with superior milk production, thus avoiding the occurrence of TT-type buffalo in offspring when using TC genotype buffalo for selective breeding. Therefore, this genotype can be used for the development of new high-milk buffalo breeds.

[0044] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.

[0045] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A SNP molecular genetic marker associated with milk production traits in Nili-Rafi buffalo, characterized in that, The SNP molecular genetic marker is located at 28,942,786 bp on chromosome 1 of the buffalo genome, with a base of C or T at this site. The reference genome version number is GCF_019923935.

1.

2. The SNP molecular genetic marker according to claim 1, characterized in that, The SNP molecular genetic marker is located at the 86th bp of the nucleotide sequence described in SEQ ID NO.

1.

3. A primer set for detecting the SNP molecular genetic marker of claim 1.

4. The primer set according to claim 3, characterized in that, The nucleotide sequences of the primer set are shown in SEQ ID NO.2-4.

5. A reagent kit, characterized in that, The kit includes the primer set as described in claim 2 or 3.

6. The application of the SNP molecular genetic marker of claim 1 or 2, the primer set of claim 3 or 4, or the kit of claim 5 in buffalo breeding, characterized in that, The breeding program aims to produce water buffaloes with high milk yields.

7. The application according to claim 6, characterized in that, The breeding process involves selecting individuals with the SNP genotype CC for preservation.

8. The application of the SNP molecular genetic marker of claim 1 or 2, the primer set of claim 3 or 4, or the kit of claim 5 in screening / identifying buffalo with high milk production.

9. A method for breeding water buffaloes with high milk production, characterized in that, The method involves detecting the SNP molecular genetic markers described in claim 1 and selecting individuals with the genotype CC for preservation.

10. The method according to claim 9, characterized in that, The detection methods include one or more of the following: PCR amplification and direct sequencing, probe method, gene chip method, or high-resolution melting curve method.

Images