A specific DNA fragment for identifying apple snails, an identification reagent and an identification method

Abstract

The present application relates to the field of biological detection, in particular to a specific DNA fragment for identifying apple snail, identification reagent and identification method. The present application provides a genomic DNA fragment as shown in SEQ ID NO: 1, which is unique to the target species apple snail, has high specificity, reduces the false positive rate of detection, and significantly improves the detection rate and accuracy. The present application provides a reagent and method for identifying apple snail, which is designed based on the above specific genomic DNA fragment, uses enzyme-mediated double exponential amplification technology, and has the advantages of simple operation, fast detection speed, low equipment requirement, etc.

Description

Invention Field This invention relates to the field of biological detection, specifically to a reagent and method for identifying specific DNA fragments from the spotted golden apple snail. Background Technology

[0001] Spotted apple snail ( Pomacea maculata The spotted golden apple snail (Pomacea canaliculata) is a freshwater snail native to South America. It is listed by the International Union for Conservation of Nature (IUCN) as one of the world's 100 invasive alien species and is also included in my country's first list of invasive alien species. With a wide range of food sources, the spotted golden apple snail not only damages crops and aquatic plants but also preys on small snails and other aquatic animals, causing serious damage to the ecosystems and economies of the affected areas. Furthermore, the spotted golden apple snail is characterized by its high reproductive rate, strong adaptability, and lack of natural predators, all of which contribute to its rapid invasion and colonization.

[0002] Rapid identification of invasive pests is crucial for their early prevention and integrated control. Currently, commonly used molecular identification markers mainly consist of specific segments of conserved mitochondrial genes (Cox1, 18S, etc.). However, their accuracy is still insufficient when detecting invasive species with complex genetic populations, rapid evolutionary rates, and varying risks of outbreaks, such as pathogenic microorganisms. Therefore, the development of novel markers that utilize multi-omics big data, including genomics, is urgently needed.

[0003] Currently, the commonly used molecular identification markers are mainly specific segments of conserved mitochondrial genes (Cox1, 18S, etc.). However, their accuracy is still insufficient when detecting invasive species with complex genetic populations, rapid evolution rates, and large differences in the risk of causing disasters, such as pathogenic microorganisms. New markers that utilize genomic and other multi-omics big data for screening are urgently needed.

[0004] Currently, commonly used molecular identification methods mainly include RAPD (Randomly Amplified Polymorphic DNA), RFLP (Restriction Fragment Length Polymorphism), AFLP (Amplified Fragment Length Polymorphism), SSCP (Single Strand Conformation Polymorphisms), and DNA sequence analysis. RAPD technology is a basic molecular identification and genetic polymorphism analysis method. Its advantages include requiring relatively few DNA samples, simple experimental operation, short cycle time, and the ability to screen a large number of samples simultaneously. However, due to its low annealing temperature, it suffers from poor specificity and reproducibility. RFLP technology, based on polymerase chain reaction (PCR), involves cutting specific fragments and then detecting them using agarose gel electrophoresis. It is characterized by its intuitiveness, sensitivity, good reproducibility, and high specificity. However, because this method is based on known sequences, it cannot obtain satisfactory results for species with unknown sequences, making it less suitable for population polymorphism studies. SSCP technology uses non-denaturing polyacrylamide as a medium to electrophores appropriately sized single-stranded DNA (ssDNA) fragments, which are then visualized to observe differences in migration rates between the ssDNA fragments. However, this technology may not detect all mutation sites, and the results are easily affected by electrophoresis temperature, buffer composition, and electrophoresis conditions.

[0005] In summary, existing detection methods suffer from drawbacks such as long operation time, high operational requirements, and poor detection accuracy, and some methods are also expensive. Therefore, it is imperative to develop a fast, highly specific, and low-cost method for identifying Pomacea canaliculata. Summary of the Invention

[0006] The primary objective of this invention is to provide a specific DNA fragment, identification reagent, and identification method for identifying golden apple snails. This invention solves the problems of existing mollusc detection methods, such as high professional knowledge requirements, cumbersome operation, long time, and many limiting conditions.

[0007] This invention proposes the use of gene fragments, including those shown in SEQ ID NO: 1, in the identification of Pomacea canaliculata.

[0008] This invention proposes a product for identifying Pomacea canaliculata, comprising: a reagent for detecting whether a sample to be tested contains a gene fragment as shown in SEQ ID NO: 1.

[0009] This invention proposes a primer pair and probe for identifying Pomacea canaliculata. The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 3; the probe has a nucleotide sequence as shown in SEQ ID NO: 4; and a fluorescent group is attached to the 5' or 3' end of the probe.

[0010] This invention proposes an isothermal amplification kit for identifying Pomacea canaliculata, the kit containing isothermal amplification reagent and probe excision reagent; the isothermal amplification reagent contains the aforementioned primer pairs and probes; the probe excision reagent contains DSN enzyme.

[0011] Optionally, the isothermal amplification reagent includes a primer mixture and a reaction enzyme mixture.

[0012] Optionally, the concentration of the upstream primer is 1 μmol / L and the concentration of the downstream primer is 1 μmol / L.

[0013] Optionally, the primer mixture also contains T7 RNA polymerase and NTPs.

[0014] Optionally, the concentration of T7 RNA polymerase in the primer mixture is 0.5 to 1.5 mg / mL, preferably 1.25 mg / mL; and the concentration of NTPs is 0.2 to 1 mmol / L, preferably 0.6 mmol / L.

[0015] Optionally, the reaction enzyme mixture includes T4 recombinase, Staphylococcus aureus DNA polymerase, T7 RNA polymerase, single-stranded DNA binding protein, dNTPs, creatine kinase, and phosphocreatine.

[0016] Optionally, based on a 20 μL reaction system, the content of each component in the reaction enzyme mixture is as follows: probe 1 ~ 10 nmol, T4 recombinase 1 ~ 4 μg, Staphylococcus aureus DNA polymerase 1 ~ 4 μg, single-stranded DNA binding protein 4 ~ 16 μg, dNTPs 1 ~ 10 nmol, creatine kinase 0.2 ~ 2 μg, and phosphocreatine 0.2 ~ 2 μmol.

[0017] Optionally, based on a 20 μL reaction system, the content of each component in the reaction enzyme mixture is as follows: probe 4 nmol, T4 recombinase 2 μg, Staphylococcus aureus DNA polymerase 2 μg, single-stranded DNA binding protein 8 μg, dNTPs 4 nmol, creatine kinase 1 μg, and phosphocreatine 0.4 μmol.

[0018] Optionally, the reaction enzyme mixture also contains PEG8000.

[0019] Optionally, based on a 20 μL reaction system, the amount of PEG8000 added is 0.8 ~ 3.2 μg, preferably 1.6 μg; Optionally, when the reaction enzyme mixture is a lyophilized powder, it also contains a lyophilization protectant.

[0020] Optionally, the freeze-drying protectant is selected from at least one of mannitol and trehalose.

[0021] Optionally, based on a 20 μL reaction system, the amount of mannitol added to the enzyme mixture is 0.05 ~ 0.2 μg, preferably 0.1 μg.

[0022] Optionally, based on a 20 μL reaction system, the amount of trehalose added to the enzyme mixture is 0.5 ~ 2 μg, preferably 1 μg.

[0023] Optionally, the probe excision reagent also contains: DSN enzyme.

[0024] Optionally, the DSN enzyme content in the probe excision reagent is 0.05 ~ 0.2 U, preferably 0.1 U.

[0025] This invention proposes a method for identifying Pomacea canaliculata, using the aforementioned isothermal amplification kit.

[0026] Optionally, the identification method includes the following steps: DNA samples of the mollusc to be tested are added to the isothermal amplification reagent. After the isothermal amplification reaction, probe excision reagent is added and mixed, and then the fluorescence signal is detected. If there is a fluorescence signal, the mollusc to be tested is Pomacea canaliculata; if there is no fluorescence signal, the mollusc to be tested is not Pomacea canaliculata.

[0027] Optionally, the DNA sample of the mollusc to be tested and the primer mixture are added to the reaction enzyme mixture. After the isothermal amplification reaction, the probe excision reagent is added and the fluorescence signal is detected. If there is a fluorescence signal, the mollusc to be tested is Pomacea canaliculata; if there is no fluorescence signal, the mollusc to be tested is not Pomacea canaliculata.

[0028] Optionally, the temperature of the isothermal amplification reaction is 20 ~ 35℃; Optionally, the isothermal amplification reaction time is 1 to 5 minutes.

[0029] Compared with the prior art, the technical solution of this invention has the following advantages: This invention screens and obtains a specific genomic DNA fragment unique to the target species, Pomacea canaliculata. This fragment differs from traditional mitochondrial markers, exhibiting higher specificity, reducing the false positive rate, and improving the detection rate and accuracy. It enables accurate detection under various conditions, including different larval stages, survival status, and incomplete specimens.

[0030] This invention also proposes a reagent and method for identifying the spotted golden apple snail, designed based on the aforementioned specific genomic DNA fragment. In a preferred embodiment, this invention applies isothermal nucleic acid amplification technology to the identification of mollusc species and the differentiation of closely related species. This invention employs enzyme-mediated double exponential amplification (EmDEA) technology, which uses multi-enzyme collaboration (endonuclease, polymerase) to double amplify the target nucleic acid and fluorescent probe, achieving extremely high detection sensitivity and specificity in a short time, greatly shortening the reaction time, suitable for rapid detection of various samples, requiring less than 30 minutes.

[0031] The method of this invention does not require repeated temperature changes and has significant advantages over PCR in terms of detection speed and portability. It is characterized by simple and rapid operation, low equipment requirements, and good sensitivity and specificity, and has good development prospects.

[0032] The RNA fluorescent probe designed based on the specific sequence of the target gene in this invention has extremely high hybridization efficiency with the target sequence, thus improving the sensitivity and specificity of the reaction.

[0033] The reagents and methods of this invention can distinguish between Pomacea canaliculata and its closely related species, improving the detection rate and accuracy of Pomacea canaliculata and enabling rapid and accurate on-site detection. This reduces the equipment requirements for on-site testing and lowers the operational threshold, allowing non-professionals to easily use the reagents and methods of this invention. It provides frontline personnel with a new method for rapidly identifying Pomacea canaliculata and its similar species, which is of great significance for the early warning and control of Pomacea canaliculata in my country. Attached Figure Description

[0034] Figure 1 Electrophoresis results of different species amplified using specific primers for *Pomacea canaliculata*, including: 1. *Pomacea canaliculata* P. maculata 2. Small-tubed golden apple snail P. canaliculata 3. Pear-shaped ring-shaped snail B. purificata 4. Corner Moon Clam L. cornuum 5. Short-fleshed spear mussel L. glayana ; 6. Japanese clam C. japonica 7. Guangxi Gouquan S. guangxiensis ; Figure 2 This is a graph showing the specific amplification curves of the primers used for isothermal amplification detection. Figure 3 This is an amplification curve showing the sensitivity of isothermal amplification detection. Figure 4 Amplification curves for preliminary primer set screening; Figure 5 This is an amplification curve of the primer set secondary screening. PC is a positive plasmid; NC is a negative control (enzyme-free water). Detailed Implementation

[0035] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the specification.

[0036] For detailed implementation methods of this invention, please refer to the embodiments. Unless otherwise specified, the experimental methods and reagents described in the embodiments are conventional experimental methods and reagents. The following embodiments are for illustration and explanation only, and are not intended to limit the invention in any way.

[0037] A first aspect of this invention proposes the application of a gene fragment, as shown in SEQ ID NO: 1, in the identification of *Pomacea canaliculata*. The gene fragment shown in SEQ ID NO: 1 differs from traditional mitochondrial markers, such as the traditional Cox1 gene marker, which is present in all species. Its species specificity mainly stems from differences in the sequence of certain bases, and its resolution decreases with increasing species diversity and complexity. This invention, through screening the genome, obtains a specific DNA fragment unique to the target species *Pomacea canaliculata*, exhibiting higher specificity and significantly reducing the false positive rate when used for *Pomacea canaliculata* identification.

[0038] The nucleotide sequence of SEQ ID NO: 1 is as follows: caaggctcgggaaaagccagcgctgagatttttttagtacatgtgacatgtgtttttgtgttgctgtttgcctgaccgactaaatggggcagttgttcagagtgatattttacagcttgcttgt ctctttgtatccttttcctaacatttacagatacgaaggatcgagcaaatgctatagatttataaactggttatattcactgatgcaaagaattattgtacttcccagttaaaagactgtctcagta ataaaacacaactatttattgtcgctggaaaaaaacttatgacttcccttttacaaaggtaataaaaggaaatacctttttcgacgatttcacttaagataaaatcgcttcggtcaagattgttg cgctctataagtctggaattaatatacattattcttattccagaataggtttctgtcaaatacatttttaattttacttgaaaccatacattttcttttcttttcttttcttttcttttcttttc In this embodiment of the invention, the specific sequence of Pomacea canaliculata shown in SEQ ID NO: 1 was compared with the genomic data of various mollusks. The results showed that the sequence could only be matched with Pomacea canaliculata, indicating that the selected Pomacea canaliculata-specific fragment has obvious specificity.

[0039] A second aspect of this invention provides a product for identifying *Pomacea canaliculata*, comprising a reagent for detecting whether a sample contains a gene fragment as shown in SEQ ID NO: 1. This identification product can be applied using various methods, such as conventional PCR amplification or isothermal amplification.

[0040] A third aspect of this invention proposes a primer pair and probe for identifying *Pomacea canaliculata* using an isothermal amplification method. The primer pair includes an upstream primer with the nucleotide sequence shown in SEQ ID NO: 2 and a downstream primer with the nucleotide sequence shown in SEQ ID NO: 3; the probe has the nucleotide sequence shown in SEQ ID NO: 4; and a fluorescent group is attached to the 5' or 3' end of the probe. The probe used in this embodiment is an RNA probe. RNA is easily degraded, has minimal interference with subsequent reactions, and can significantly improve detection sensitivity. The sequences of the primers and probe are shown in Table 1.

[0041] Table 1 The fluorescent group can be selected from FAM, TAMRA, Cy3, Cy5, etc.

[0042] The isothermal amplification method proposed in this invention for identifying primer pairs and probes for *Pomacea canaliculata* is highly efficient in hybridization with the RNA fluorescent probe designed based on the specific sequence of the target gene, significantly shortening the reaction time and improving the sensitivity and specificity of the reaction. After the probe complex is cleaved by a double-stranded specific nuclease, the fluorescent group emits a reporter fluorescence, and the result is determined by the fluorescence signal using a fluorescence detector.

[0043] A fourth aspect of this invention provides an isothermal amplification kit for identifying *Pomacea canaliculata*. The kit contains an isothermal amplification reagent and a probe excision reagent. The isothermal amplification reagent contains the aforementioned primer pair and probe, and the probe excision reagent contains DSN enzyme. This isothermal amplification kit eliminates the need for repeated temperature changes during use, offering significant advantages over conventional PCR in terms of detection speed and portability. It is characterized by its simplicity, speed, high sensitivity, and specificity, and thus shows promising development prospects.

[0044] As an improvement of this invention, the isothermal amplification reagent includes separately packaged primer mixtures and reaction enzyme mixtures. Aliquoting the primers and reaction enzymes reduces the risk of contamination and cross-contamination, extends shelf life, improves the reproducibility and consistency of the experiment, and facilitates experimental procedures.

[0045] As an improvement to this embodiment of the invention, in the primer mixture, the concentration of the upstream primer is 0.5 ~ 2 μmol / L and the concentration of the downstream primer is 0.5 ~ 2 μmol / L.

[0046] As an improvement of this invention, in the primer mixture, the concentration of the upstream primer can be 0.8 μmol / L, 0.9 μmol / L, 1 μmol / L, 1.1 μmol / L, 1.2 μmol / L, 1.3 μmol / L, or 1.5 μmol / L, and the concentration of the downstream primer can be 0.8 μmol / L, 0.9 μmol / L, 1 μmol / L, 1.1 μmol / L, 1.2 μmol / L, 1.3 μmol / L, or 1.5 μmol / L.

[0047] As an improvement of this invention, the primer mixture also contains T7 RNA polymerase and NTPs for in vitro transcription.

[0048] As an improvement of this invention, the concentration of T7 RNA polymerase in the primer mixture is 0.5 ~ 1.5 mg / mL, preferably 1.25 mg / mL, and the concentration of NTPs is 0.2 ~ 1 mmol / L, preferably 0.6 mmol / L.

[0049] The kit of this invention uses enzyme-mediated double exponential amplification (EmDEA) technology, which uses multi-enzyme collaboration (nuclease and polymerase) to double amplify the target nucleic acid and fluorescent probe. It has high accuracy, timeliness and simplicity, and can achieve extremely high detection sensitivity and specificity in a short time. The required time is less than 20 minutes, which is suitable for rapid detection of a variety of samples and accelerates the realization of "one test for one species" of plant and animal pests.

[0050] As an improvement of this embodiment of the invention, based on a 20 μL reaction system, the content of each component in the reaction enzyme mixture is as follows: probe 1 ~ 10 nmol, T4 recombinase 1 ~ 4 μg, Staphylococcus aureus DNA polymerase 1 ~ 4 μg, single-stranded DNA binding protein 4 ~ 16 μg, dNTPs 1 ~ 10 nmol, creatine kinase 0.2 ~ 2 μg, and phosphocreatine 0.2 ~ 2 μmol.

[0051] As an improvement of this embodiment of the invention, based on a 20 μL reaction system, the content of each component in the reaction enzyme mixture is as follows: probe 4 nmol, T4 recombinase 2 μg, Staphylococcus aureus DNA polymerase 2 μg, single-stranded DNA binding protein 8 μg, dNTPs 4 nmol, creatine kinase 1 μg, and phosphocreatine 0.4 μmol.

[0052] As an improvement in this embodiment of the invention, the reaction enzyme mixture also contains PEG8000, which functions to stabilize enzyme activity, improve enzyme solubility, reduce non-specific adsorption of the enzyme to the reaction vessel wall, and increase the viscosity of the reaction solution. Optionally, based on a 20 μL reaction system, the amount of PEG8000 added is 0.8 ~ 3.2 μg, preferably 1.6 μg.

[0053] As an improvement to this invention, a lyophilization protectant can be added to the enzyme mixture to prepare a lyophilized powder, which is convenient for room temperature storage and extends its shelf life. The lyophilization protectant is selected from at least one of mannitol and trehalose.

[0054] As an improvement of this embodiment of the invention, based on a 20 μL reaction system, the amount of mannitol added to the enzyme mixture is 0.05 ~ 0.2 μg, preferably 0.1 μg.

[0055] As an improvement of this invention, based on a 20 μL reaction system, the amount of trehalose added to the enzyme mixture is 0.5 ~ 0.2 μg, preferably 1 μg.

[0056] As an improvement of this invention, the probe excision reagent further contains DSN enzyme. The content of each component in the probe excision reagent is: DSN enzyme (0.10 U).

[0057] As an improvement to this embodiment of the invention, the composition of the kit of this embodiment is shown in Table 2: Table 2 As a specific embodiment of the present invention, the composition of the kit of the present invention is shown in Table 3: Table 3 The fifth aspect of this invention provides a method for identifying *Pomacea canaliculata*, using the aforementioned isothermal amplification kit. Specifically, the method includes the following steps: adding a DNA sample of the mollusc to the isothermal amplification reagent; after the isothermal amplification reaction, adding a probe excision reagent and mixing; then detecting the fluorescence signal. If a fluorescence signal is present, the mollusc is *Pomacea canaliculata*; if no fluorescence signal is present, the mollusc is not *Pomacea canaliculata*. Optionally, the DNA sample of the mollusc to be tested and the primer mixture are added to the reaction enzyme mixture. After the isothermal amplification reaction, the probe excision reagent is added and the fluorescence signal is detected. If there is a fluorescence signal, the mollusc to be tested is Pomacea canaliculata; if there is no fluorescence signal, the mollusc to be tested is not Pomacea canaliculata.

[0058] As an improvement to this invention, DNA samples from molluscs can be extracted using a thermal lysis method. This method is simple, rapid, efficient, widely applicable, and requires no expensive equipment.

[0059] As an improvement to this invention, the isothermal reaction temperature can be 20-35°C. Under normal circumstances, room temperature is sufficient to meet the amplification requirements.

[0060] As an improvement to this embodiment of the invention, the isothermal reaction time can be 1 to 5 minutes.

[0061] As an improvement to this invention, the fluorescence signal can be detected using a BIORAD quantitative PCR instrument. In non-laboratory conditions, a simple portable constant-temperature rapid PCR instrument, such as the uReader 1600 handheld fluorescence detector, can also be used.

[0062] In one specific embodiment, 3 μL of primer mixture is added to the lyophilized enzyme system mixture, and after dissolution, 7 μL of DNA sample of the mollusc to be tested is added. The mixture is allowed to stand at room temperature for 2 min, and finally 10 μL of probe excision reagent is added, mixed, centrifuged, and then tested on the instrument.

[0063] Example 1 This embodiment is used to illustrate the bioinformatics specificity of the gene fragment shown in SEQ ID NO: 1.

[0064] To verify its bioinformatics specificity, this sequence was also compared with those of the genera *Pomacea* (taxid:72702), *Gastropoda* (taxid:6448), *Mollusca* (taxid:6447), and protostomes using BLAST. The results showed that this sequence could only be aligned to the genome of *Pomacea spectabilis*. This indicates that this sequence is specific to *Pomacea spectabilis*.

[0065] Example 2 This embodiment verifies the specificity of the gene fragment shown in SEQ ID NO: 1 using conventional PCR.

[0066] Seven types of mollusc DNA are used in conventional PCR, including the spotted golden apple snail. P. maculata Small-tubed golden apple snail P. canaliculata pear-shaped ring-shaped snail Bellamya purificata Corner Moon Clam Lamprotula cornuum Short-fleshed spear mussel Lanceolaria glayana , Japanese clam Corbicula japonica Guangxi Gouwan Sulcospira guangxiensis .

[0067] The primers used in routine PCR are shown in Table 4: Table 4: Common PCR Primers The reaction system is shown in Table 5: Table 5: PCR reaction system The reaction program was as follows: 95℃ for 3 min; 95℃ for 15 s, 56℃ for 20 s, 72℃ for 30 s, for a total of 30 cycles; 72℃ for 5 min. The marker used was GoldBand DL2,000 DNA Marker (Yisheng Biotechnology). PCR products were analyzed by 1% agarose gel electrophoresis (140V for 20 min) using a gel imaging system. The electrophoresis results of different species amplified with specific primers from *Pomacea canaliculata* are shown below. Figure 1 As shown.

[0068] like Figure 1 As shown, only the PCR product using the Pomacea canaliculata DNA template amplified a band, indicating that the Pomacea canaliculata sequence selected above is specific.

[0069] Example 3 This embodiment presents an isothermal amplification kit for identifying Pomacea canaliculata.

[0070] The kit contains isothermal amplification reagents and probe excision reagents, the specific composition of which is shown in Table 3, and the sequences of primers and probes are shown in Table 1.

[0071] The procedure is as follows: Extract DNA from the mollusc sample using thermal lysis. Add 3 μL of primer mix to the enzyme powder tube, dissolve the enzyme powder, and then add 7 μL of DNA template. Incubate at room temperature for 2 min, and finally add 10 μL of probe excision reagent, mix well, centrifuge, and then detect using a uReader 1600 handheld fluorescence detector.

[0072] Example 4 This embodiment verifies the specificity of the primers using an isothermal amplification method.

[0073] Six species of mollusc DNA were used: *Pomacea canaliculata*, *Pomacea canaliculata*, *Bellamya purificata*, *Lamprotula cornuum*, *Lanceolaria glayana*, *Corbicula japonica*, and *Sulcospira guangxiensis*. The primer sets used are shown in Table 1. The reagent composition is shown in Table 3. The detection method was the same as in Example 3.

[0074] The isothermal amplification detection primer specific amplification curve is shown in the figure below. Figure 2 As shown in Table 6, the primer specificity TT values ​​are as follows: Table 6: TT values ​​for specific detection of EmDEA system primers and probes The positive control system was provided by Suzhou Jingrui Biotechnology Co., Ltd., and the negative control was enzyme-free water.

[0075] The experimental results showed that only the positive control and *Pomacea canaliculata* generated amplification curves and TT values. Specifically, the TT value for the *Pomacea canaliculata* DNA sample was 8.3, and the TT value for the positive plasmid was 5.0. The remaining samples and the negative control did not show amplification curves or TT values, indicating that the remaining samples were negative. These results demonstrate that the primers are specific to *Pomacea canaliculata*.

[0076] Example 5 This embodiment verifies the sensitivity of the method using an isothermal amplification method.

[0077] The initial concentration of the golden apple snail DNA template used was 18 ng / μL, and it was serially diluted 10-fold using RNase-free ddH2O, resulting in a total of 6 concentration gradients. The primer set used is shown in Table 1. The reagent composition is shown in Table 3. The detection method was the same as in Example 3.

[0078] Isothermal amplification detection sensitivity amplification curve is shown in the figure. Figure 3 As shown in Table 7, the detection sensitivity TT is as follows: Table 7: Detection TT values ​​of primer and probe sensitivity in the EmDEA system The positive control system for the positive plasmid was provided by Suzhou Jingrui Biotechnology Co., Ltd., and the negative control was enzyme-free water.

[0079] Experimental results showed that amplification curves and TT values ​​appeared when the DNA template concentration was 0.0165 ng / μL or higher, indicating that the lowest detectable DNA template concentration in this system was about 0.0165 ng / μL. Using too little DNA template concentration would affect the detection results.

[0080] Example 6 This example illustrates the primer screening process: (1) Preliminary screening: The isothermal amplification primer set is designed as shown in Table 8. The reaction system is configured according to the reagent composition in Table 3. The detection method is the same as in Example 3.

[0081] Table 8: Primer set for the EmDEA system Preliminary screening using *Pomacea canaliculata* DNA revealed that primer sets 1-6 and the positive control generated amplification curves as follows: Figure 4 As shown in the figure, the TT values ​​are generated as shown in Table 8.

[0082] Table 8: Preliminary screening TT values ​​for primers and probes in the EmDEA system The positive control system was provided by Suzhou Jingrui Biotechnology Co., Ltd., and the negative control was enzyme-free water.

[0083] Primer sets 2 and 4, with lower TT values, were selected for secondary screening. Four treatment groups were set up, as shown in Table 9. The amplification curves obtained are as follows. Figure 5 As shown in Table 9, the TT values ​​are as follows.

[0084] Table 9: TT values ​​for secondary screening of primers and probes in the EmDEA system The positive control system was provided by Suzhou Jingrui Biotechnology Co., Ltd., and the negative control was enzyme-free water.

[0085] The experimental results show that all three primer sets can stably amplify Pomacea canaliculata. Primer set 2 had the lowest TT values ​​in both tests, so primer set 2 was selected as the primer set used in the kit.

[0086] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments described herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Including the use of the gene fragment shown in SEQ ID NO: 1 in the identification of Pomacea canaliculata.

2. A product for identifying the spotted golden apple snail, characterized in that, The product includes a reagent for detecting whether a sample to be tested contains a gene fragment as shown in SEQ ID NO:

1.

3. A primer pair and probe for identifying the spotted golden apple snail, characterized in that, The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 3; the nucleotide sequence of the probe is shown in SEQ ID NO: 4; and a fluorescent group is attached to the 5' or 3' end of the probe.

4. A thermostatic amplification kit for identifying Pomacea canaliculata, characterized in that, The kit contains isothermal amplification reagent and probe excision reagent; the isothermal amplification reagent contains the primer pair and probe as described in claim 3; the probe excision reagent contains DSN enzyme; optionally, the isothermal amplification reagent includes a primer mixture and a reaction enzyme mixture.

5. The isothermal amplification kit according to claim 4, characterized in that, The concentration of the upstream primer in the primer mixture is 0.5 ~ 2 μmol / L, and the concentration of the downstream primer is 0.5 ~ 2 μmol / L; Optionally, the concentration of the upstream primer is 1 μmol / L, and the concentration of the downstream primer is 1 μmol / L; Optionally, the primer mixture also contains T7 RNA polymerase and NTPs; Optionally, the concentration of T7 RNA polymerase in the primer mixture is 0.5 to 1.5 mg / mL, preferably 1.25 mg / mL; and the concentration of NTPs is 0.2 to 1 mmol / L, preferably 0.6 mmol / L.

6. The isothermal amplification kit according to claim 4, characterized in that, The reaction enzyme mixture contains T4 recombinase, Staphylococcus aureus DNA polymerase, T7 RNA polymerase, single-stranded DNA binding protein, dNTPs, creatine kinase and phosphocreatine; Optionally, based on a 20 μL reaction system, the content of each component in the reaction enzyme mixture is as follows: probe 1 ~ 10 nmol, T4 recombinase 1 ~ 4 μg, Staphylococcus aureus DNA polymerase 1 ~ 4 μg, single-stranded DNA binding protein 4 ~ 16 μg, dNTPs 1 ~ 10 nmol, creatine kinase 0.2 ~ 2 μg, and phosphocreatine 0.2 ~ 2 μmol; Optionally, based on a 20 μL reaction system, the content of each component in the reaction enzyme mixture is as follows: probe 4 nmol, T4 recombinase 2 μg, Staphylococcus aureus DNA polymerase 2 μg, single-stranded DNA binding protein 8 μg, dNTPs 4 nmol, creatine kinase 1 μg, and phosphocreatine 0.4 μmol.

7. The isothermal amplification kit according to claim 4, characterized in that, The reaction enzyme mixture also contains PEG8000. Optionally, based on a 20 μL reaction system, the amount of PEG8000 added is 0.8 ~ 3.2 μg, preferably 1.6 μg. Optionally, when the reaction enzyme mixture is a lyophilized powder, it further contains a lyophilization protectant; optionally, the lyophilization protectant is selected from at least one of mannitol and trehalose; optionally, based on a 20 μL reaction system, the amount of mannitol added to the reaction enzyme mixture is 0.05 ~ 0.2 μg, preferably 0.1 μg; Optionally, based on a 20 μL reaction system, the amount of trehalose added to the reaction enzyme mixture is 0.5 ~ 2 μg, preferably 1 μg.

8. The isothermal amplification kit according to claim 4, characterized in that, The probe excision reagent also contains: DSN enzyme; Optionally, the DSN enzyme content in the probe excision reagent is 0.05 ~ 0.2 U, preferably 0.1 U.

9. A method for identifying the spotted golden apple snail, characterized in that, Identification was performed using the isothermal amplification kit as described in any one of claims 4 to 8.

10. The identification method according to claim 9, characterized in that, Includes the following steps: DNA samples of the mollusc to be tested are added to the isothermal amplification reagent. After the isothermal amplification reaction, the probe excision reagent is added and mixed. Then, the fluorescence signal is detected. If there is a fluorescence signal, the mollusc to be tested is Pomacea canaliculata; if there is no fluorescence signal, the mollusc to be tested is not Pomacea canaliculata. Optionally, the DNA sample of the mollusc to be tested and the primer mixture are added to the reaction enzyme mixture. After the isothermal amplification reaction, the probe excision reagent is added and the fluorescence signal is detected. If there is a fluorescence signal, the mollusc to be tested is Pomacea canaliculata; if there is no fluorescence signal, the mollusc to be tested is not Pomacea canaliculata. Optionally, the temperature of the isothermal amplification reaction is 20~35℃; Optionally, the isothermal amplification reaction takes 1 to 5 minutes.

Images