Snps, primers and application for genetic sex identification of scatophagus argus

Abstract

The application relates to a SNP molecular marker for identifying the genetic sex of Pseudobothrus ephippium, a primer and application thereof, and belongs to the field of molecular biology. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, wherein the 101th position in the sequence of SEQ ID NO. 1 has an SNP site, a male individual shows G / A heterozygous genotype, and a female individual shows G / G homozygous genotype. The application further provides a PCR primer capable of identifying the genetic sex of Pseudobothrus ephippium. An individual capable of amplifying a 523 bp specific DNA fragment is a male, and an individual without amplification product is a female.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to an SNP molecular marker, primer, and its application for genetic sex identification of the yellow pufferfish. Background Technology

[0002] Chrysanthemum Yellow Oriental Pufferfish ( Takifugu flavidus The pufferfish (Pterodon spp.) is one of my country's important marine economic fish species, characterized by its rapid growth, delicious flesh, and high economic value, making it a promising aquaculture prospect in coastal areas of my country. Studies have shown that male and female pufferfish exhibit significant sexual dimorphism in terms of growth rate, body size, and sexual maturity time. Therefore, conducting genetic sex identification and sex-controlled breeding is of great significance for increasing aquaculture yield, optimizing germplasm resources, and enhancing economic benefits.

[0003] Currently, sex determination in the yellow pufferfish primarily relies on gonadal anatomy or histological observation. This method can only be implemented after the gonads have developed to a certain stage, resulting in a long testing cycle and requiring individual dissection and sampling. It cannot achieve early genetic sex determination in juvenile fish and is insufficient for large-scale breeding and molecular-assisted breeding applications. Although molecular marker technology has been widely used in fish genetic sex determination in recent years, research on the genetic sex determination mechanism of the yellow pufferfish remains limited. Its sex-determining regions and stable, reliable genetic sex molecular markers have not yet been established, restricting the development of sex-controlled breeding and molecular breeding technologies.

[0004] Therefore, developing a molecular marker and its detection method that can rapidly, accurately, and stably identify the genetic sex of the yellow pufferfish is of great theoretical and practical significance for the early identification of genetic sex, screening of superior parents, sex-controlled breeding, and genetic improvement of the yellow pufferfish. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker, primers, and their applications for genetic sex identification of the yellow pufferfish. This method is simple to operate, rapid in detection, and highly accurate, and can be widely applied to genetic sex identification, sex-controlled breeding, and molecular-assisted breeding of the yellow pufferfish.

[0006] This invention provides a SNP molecular marker for genetic sex determination in the yellow pufferfish. The sequence of the SNP molecular marker is shown in SEQ ID NO.1. The SNP molecular marker is located at 6584904 bp on chromosome 4 of the yellow pufferfish. amhr2 Single nucleotide polymorphism (SNP) sites in the gene region. Male individuals exhibit a G / A heterozygous genotype, while female individuals exhibit a G / G homozygous genotype.

[0007] The nucleotide sequence of the SNP molecular marker: TTTGTTGTGAAGATGGACAGAGCCTTCCAGGAGCTCAGGGGACATGTAGCGCAACGTGCCCCACTGAACGAGGTTCTGTAGTTAGAGTCAAGAGCTGCACRTTTTGCACATTGTGTTTTACGGCCAAAGCAGAAAAACGCACACAATTGCCCGAGCGATGGTTTTCACGCGTGTTTTAGGCGCGACGTCTCTGCTCACCAA. where R is a degenerate base, equal to G / A.

[0008] The present invention also provides the application of the SNP molecular marker in identifying the genetic sex of the yellow pufferfish. The method is as follows: by amplifying the DNA of the individual to be identified where the SNP molecular marker is located, individuals with a G / A heterozygous genotype at position 101 in the sequence shown in SEQ ID NO.1 are males, and individuals with a G / G homozygous genotype are females.

[0009] The present invention also provides PCR primers for amplifying the SNP molecular marker, the primers being capable of amplifying the SNP molecular marker.

[0010] Furthermore, the nucleotide sequences of the PCR primers are as follows: Forward (SEQ ID NO.2): 5'-TAGAGTCAAGAGCTGCACA-3' Reverse (SEQ ID NO.3): 5'-ACACACACCGTGTCTATGGAG-3'.

[0011] This invention also provides the application of the above primers in identifying the genetic sex of the Yellow-skinned Amur pufferfish. The application method is to use the primers to perform PCR amplification on the DNA of the sample to be identified. Individuals that can amplify a specific DNA fragment of 523 bp are male, and those without amplification products are female, thereby achieving rapid identification of the genetic sex of the Yellow-skinned Amur pufferfish.

[0012] The nucleotides of the primers described further are as shown in SEQ ID NO.2-3.

[0013] The beneficial effects of this invention compared with the prior art are as follows: This invention provides an SNP molecular marker for identifying the sex of the yellow pufferfish. The method is simple to operate, fast to detect, and highly accurate, and can be widely used in genetic sex identification, sex-controlled breeding, and molecular-assisted breeding of the yellow pufferfish. Attached Figure Description

[0014] Figure 1 For female and male individuals amhr2Comparison of Sanger sequencing peak diagrams for sex-specific SNPs in the middle; Figure 2 Electrophoretic results for male and female sex determination of the yellow-skinned Oriental pufferfish; Figure 3 This is a histological section of the gonads of a partial sample of the Yellow-skinned Oriental Pufferfish. Detailed Implementation

[0015] To better understand the technical solution of this invention, in conjunction with the appendix... Figures 1-3 The present invention will be further illustrated by specific embodiments. All experimental materials, reagents, and instruments used are commercially available. The following embodiments are for illustrative purposes only and are not intended to limit the scope of protection of the present invention. Any modifications, substitutions, or equivalent transformations made by those skilled in the art without departing from the spirit and substance of the present invention should fall within the scope of protection of the present invention.

[0016] Example 1 To verify the accuracy of the sex-specific molecular markers for the yellow pufferfish provided in this invention, genetic sex identification was performed on samples of the yellow pufferfish.

[0017] Thirty-six Oriental pufferfish were collected from a breeding farm in Lianyungang City, Jiangsu Province, as verification samples. The samples were dissected, and phenotypic sex was determined by observing gonadal morphology, which was then verified using gonadal histological sections. Gonadal tissue was fixed in 4% paraformaldehyde for 24 h, dehydrated using a sucrose gradient, embedded using OCT, and 8 μm frozen sections were prepared. Hematoxylin-eosin staining was used to observe the gonadal tissue structure under a microscope to accurately determine the individual's phenotypic sex. Figure 3 As shown.

[0018] Subsequently, fin tissues were collected from each individual fish, genomic DNA was extracted using a DNA extraction kit, and the quality and concentration of the DNA were detected using a nucleic acid concentration analyzer.

[0019] Using the extracted genomic DNA as a template, PCR amplification was performed using the sex-specific primers designed in this invention.

[0020] Forward primer (SEQ ID NO.2): 5'-TAGAGTCAAGAGCTGCACA-3' Reverse primer (SEQ ID NO.3): 5'-ACACACACCGTGTCTATGGAG-3' The PCR reaction system consisted of 50 μL: 25 μL Rapid PCR Mix, 2 μL each of forward and reverse primers (10 μmol / L), 1 μL DNA template (300–500 ng / μL), and 20 μL ultrapure water. The PCR amplification program was as follows: 94 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 55 °C annealing for 15 s, 72 °C extension for 30 s, for a total of 30 cycles; 72 °C extension for 5 min; and storage at 12 °C.

[0021] PCR products were detected by 1% agarose gel electrophoresis. The electrophoresis results are as follows: Figure 2 As shown in the diagram, all male individuals amplified a specific 523 bp DNA band, the sequence of which is shown in SEQ ID NO.4, while no amplification product was detected in any female individuals. Simultaneously, Sanger sequencing was performed to verify the target site, and the sequencing peak diagram is shown in the diagram. Figure 1 As shown, male individuals exhibit a G / A heterozygous peak at the Chr4:6584904 bp (GCA_003711565.2) locus, while female individuals exhibit a G / G homozygous peak.

[0022] In this embodiment, the PCR identification results established by the present invention are completely consistent with the gonadal histological determination results, and the accuracy rate of genetic sex identification reaches 100%, proving that the sex-specific molecular markers provided by the present invention can accurately and stably identify the genetic sex of the yellow pufferfish. This method has advantages such as simple operation, fast detection speed, high accuracy, low cost, and suitability for large-scale screening, and can be widely applied in fields such as genetic sex identification, parental screening, sex-controlled breeding, and molecular-assisted breeding of the yellow pufferfish.

[0023] Amplification of specific DNA bands (SEQ ID NO.4): .

[0024] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any equivalent substitutions, improvements, or modifications made based on the technical solutions of the present invention should fall within the scope of protection of the present invention.

Claims

1. A SNP molecular marker for genetic sex determination in the yellow-skinned pufferfish, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein there is an SNP site at position 101 in the sequence as shown in SEQ ID NO.1, male individuals exhibit a G / A heterozygous genotype, and female individuals exhibit a G / G homozygous genotype.

2. The application of the SNP molecular marker as described in claim 1 in identifying the genetic sex of the yellow pufferfish, characterized in that, The method is as follows: by amplifying the DNA containing the SNP molecular marker of the individual to be identified, individuals with a G / A heterozygous genotype at position 101 in the sequence shown in SEQ ID NO.1 are males, and individuals with a G / G homozygous genotype are females.

3. The PCR primers for amplifying the SNP molecular marker as described in claim 1, characterized in that, The primers are capable of amplifying the SNP molecular marker described in claim 1.

4. The PCR primers according to claim 3, characterized in that, The nucleotide sequences of the PCR primers are shown in SEQ ID NO. 2-3.

5. The application of the primers according to claim 3 in identifying the genetic sex of the yellow pufferfish, characterized in that, The application method involves using the primers to perform PCR amplification on the DNA of the sample to be identified. Individuals that can amplify a specific DNA fragment of 523 bp are male, while those without amplification products are female.

6. The application according to claim 5, characterized in that, The nucleotides of the primers are as shown in SEQ ID NO.2-3.

Images