A method for detecting SNP molecular marker related to goat GAB2 gene and growth traits and application thereof

Abstract

The application discloses a method for detecting a SNP molecular marker related to a goat GAB2 gene and growth traits and application. A functional mutation site is identified in a 3'UTR region of a goat GAB2 gene by a selection signal method for the first time according to sequencing data, and the functional mutation site is located at 17,256,044 of chromosome 29 of a goat reference genome ARS1 version, and a polymorphic base is G>A. It is found through detection and analysis that the mutation site shows significant genetic differentiation characteristics in goat populations in south and north China, and correlation analysis in a large-scale (653) growth phenotype recording population shows that the mutation site is highly related to growth and body size traits of the goat. The individual carrying the GG genotype is extremely significantly better than the individual carrying the AA genotype in body height, chest depth, hip width and hip height (P < 0.01).

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method and application for detecting SNP molecular markers related to the GAB2 gene in goats and its growth traits. Background Technology

[0002] Goats (Capra hircus) are important herbivorous livestock economic animals, holding an irreplaceable position in providing high-quality meat, dairy products, and wool products. Through long-term natural selection and artificial domestication, local goat populations have developed a unique north-south differentiation trend. Southern goats, having long been accustomed to hot and humid subtropical and tropical climates, have gradually established breeding goals centered on meat production performance, growth rate, and fat deposition. Northern goats, adapted to cold and dry climates, are primarily known for their wool production performance. This genetic differentiation driven by environmental adaptability and different breeding directions has resulted in significant differences in growth, development, and body shape traits between northern and southern goat populations. Growth traits such as body height, chest depth, rump width, rump height, and fat deposition are key indicators determining the meat yield and economic benefits of meat goats. However, growth traits are typically complex quantitative traits controlled by multiple genes, with moderate to high heritability and susceptibility to interference from external factors such as nutrition, management, and environment. Traditional goat breeding methods mainly rely on phenotypic and progeny testing, which have limitations such as long selection cycles, high breeding costs, and low accuracy in early selection, making it difficult to achieve rapid and accurate screening of superior individuals.

[0003] With the continuous development of genomics and molecular biology technologies, marker-assisted selection (MAS) technology has provided a new approach for precision breeding of livestock. By mining and utilizing single nucleotide polymorphism (SNP) molecular markers closely associated with important economic traits, breeders can perform genotyping screening in early stages of an individual's life, even at the embryonic stage, thereby significantly shortening generation intervals and improving breeding efficiency. In previous genome-wide selection signal scanning studies, researchers found that several genes related to growth and development were selected to varying degrees in southern and northern goat populations. Among them, the GAB2 (GRB2-associated binding protein 2) gene region located on goat chromosome 29 showed a significant selection signal. GAB2, as a pleiotropic skeletal protein, plays a key role in multiple cell signal transduction pathways, and studies have shown that it is closely related to skeletal muscle development and adipocyte maturation in mammals. However, how to translate this candidate gene into an operable and efficient molecular marker detection method in goat breeding practice still lacks specific methods and application technologies.

[0004] Furthermore, the 3' Untranslated Region (3'UTR) of a gene typically contains microRNA (miRNA) binding sites. SNPs occurring in the 3'UTR can interfere with the translation or degradation of target genes at the posttranscriptional level by altering the affinity of miRNAs for binding to target genes, thereby exerting fine-grained regulation of phenotypes. These SNP sites, located in functional regulatory regions and possessing well-defined biological mechanisms, exhibit higher genetic stability and selection accuracy than ordinary linkage markers. However, the discovery of functional SNPs in the 3'UTR of the goat GAB2 gene, the analysis of their association with growth traits, and the development of corresponding molecular detection methods are still in their infancy. Summary of the Invention

[0005] In order to overcome the shortcomings and deficiencies of the existing technology, the purpose of this invention is to provide a SNP molecular marker for detecting the relationship between the GAB2 gene in goats and growth traits.

[0006] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers for detecting the goat GAB2 gene and its association with growth traits.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A molecular marker for detecting the SNP associated with growth traits in the goat GAB2 gene is located at nucleotide position 17,256,044 on chromosome 29 of the goat reference genome. The base at this position is G or A. The nucleotide sequence containing the upstream and downstream sequences of this SNP position is shown in SEQ ID NO.1. This position is located at position 176 of this sequence.

[0009] A reagent or kit for detecting SNP molecular markers associated with growth traits in the goat GAB2 gene, comprising primers for amplifying the SNP site at nucleotide sequence 176 bp in SEQ ID NO.1.

[0010] The primers described can be designed according to primer design principles to detect SNP molecular markers related to growth traits in goats' GAB2 gene, thereby predicting the growth traits of goats.

[0011] The above-mentioned reagents or kits for detecting SNP molecular markers related to growth traits in goats and / or detecting SNP molecular markers related to growth traits in goats are used in the detection, prediction, or assisted prediction of growth traits in goats.

[0012] The above-mentioned reagents or kits for detecting SNP molecular markers related to growth traits in goat GAB2 gene and / or goat GAB2 gene and growth traits are used in goat resource identification, improvement or molecular marker-assisted breeding.

[0013] A molecular marker-assisted selection breeding method for meat goats includes the following steps:

[0014] SNP molecular markers of breeding goats in the core goat herd were identified. Individuals with the base at position 176bp of the SNP marker shown in SEQ ID NO.1 were selected, while individuals with the base at position AA and GA were eliminated. This was done to increase the frequency of the G gene at this locus generation by generation, thereby improving the growth traits of offspring goats.

[0015] The NCBI database accession number for the goat reference genome is GCF_001704415.2, and the version number is ARS1.2.

[0016] Application of reagents that downregulate GAB2 gene expression in regulating the proliferation of goat preadipocytes.

[0017] Application of reagents that downregulate GAB2 gene expression in improving goat meat yield.

[0018] The reagents used to downregulate GAB2 gene expression include the chi-miR-33b-3p mimic, whose nucleotide sequence is as follows:

[0019] CAGUGCCUCGGCAGUGCAGCC.

[0020] The reagent for downregulating GAB2 gene expression also includes a reagent for transferring the chi-miR-33b-3p mimic into cells; preferably Lipo8000.

[0021] The reagent that downregulates GAB2 gene expression can inhibit the proliferation of goat preadipocytes and can improve meat yield when applied to meat goat breeding.

[0022] The present invention has the following advantages and effects compared with the prior art:

[0023] (1) This invention, for the first time, utilizes sequencing data and a signal selection method to identify a functional mutation site in the 3'UTR region of the goat GAB2 gene, specifically located at position 17,256,044 on chromosome 29 of the goat reference genome ARS1 version, with a polymorphic base of G>A. Detection and analysis revealed that this mutation site exhibits significant genetic differentiation characteristics in goat populations in both southern and northern my country. Furthermore, association analysis in a large-scale (653 animals) growth phenotype record population showed a high correlation between this mutation site and goat growth and body shape traits. Specifically, individuals carrying the GG genotype showed significantly better body height, chest depth, hip width, and hip height than individuals carrying the AA genotype (P < 0.01). This provides a crucial and significant candidate genetic marker for the accurate assessment of goat growth and body shape traits and for early molecular selection.

[0024] (2) This application revealed the specific mechanism by which this mutation site regulates goat growth and fat deposition traits through cellular and molecular level experiments. Dual-luciferase reporter assay, EdU incorporation assay, and gene expression detection showed that the G>A mutation is located in the core binding region of chi-miR-33b-3p and the 3'UTR of the GAB2 gene. Among them, the wild-type G allele can be specifically targeted by chi-miR-33b-3p and inhibit GAB2 expression, thereby significantly downregulating the mRNA and protein expression levels of key adipogenic marker genes (PPARγ, C / EBPα, and FABP4), and significantly inhibiting the proliferation and adipogenic differentiation of preadipocytes (P < 0.01); while the mutant A allele can effectively block the targeted inhibitory effect of chi-miR-33b-3p. This indicates that the mutation site can sensitively respond to the targeted regulation of miRNAs. The G allele mediates an inhibitory effect on the proliferation and differentiation of preadipocytes, while the A allele maintains or promotes adipogenic differentiation by blocking this inhibitory effect. This site can serve as a key functional molecular marker for the regulation of growth traits and adipogenesis by the goat GAB2 gene. This invention not only enables precise molecular assessment of goat body size development potential and fat deposition characteristics, but also provides crucial genetic breeding clues for balancing high meat production performance (GG type body size advantage) with adaptability to hot and humid climates (strong selection characteristics of the A allele in southern regions, such as maintaining lung cell homeostasis and finely regulating adipogenesis). It has significant economic application value and scientific research significance for the protection of local goat genetic resources in my country, precise molecular marker-assisted selection, and industrial genetic improvement. Attached Figure Description

[0025] Figure 1 Different selection signal methods for southern and northern goats (F ST , θ πThe selected scan region (17.20 ~ 17.21 Mb) of ratio and XP-EHH on chromosome 29 is located within the goat GAB2 gene region.

[0026] Figure 2 This is a schematic diagram of the wild-type and mutant types of the GAB2 gene 3'-UTR sequence; WT represents wild-type and MU represents mutant type.

[0027] Figure 3 This is a phenotypic difference map of the discovery set of g.17256044GA locus and its association with goat body height, hip width, and hip height.

[0028] Figure 4 This is a validation set phenotypic difference plot showing the association between the selected g.17256044GA locus and goat body height, hip width, and hip height.

[0029] Figure 5 This is a dual-luciferase reporter gene assay diagram; ***P < 0.01 (t-test); n is not significant. Among them, MC-WT is the wild-type control group, MC-MUT is the mutant control group, chi-miR-33b-3p-WT is the wild-type chi-miR-33b-3p overexpressing the GAB2 gene, and chi-miR-33b-3p-MUT is the mutant chi-miR-33b-3p overexpressing the GAB2 gene.

[0030] Figure 6 This is a graph showing the proliferation and differentiation of goat preadipocytes after overexpression of chi-miR-33b-3p; **** or ** P < 0.01 (t-test).

[0031] Figure 7 This study investigated the effects of chi-miR-33b-3p interference on cell proliferation-related marker genes (PPARγ, C / EBPα, and FABP4) and their protein levels; ** P < 0.01 (t-test). Detailed Implementation

[0032] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0033] Example 1: Sample Analysis and Acquisition of SNP Locus Data

[0034] 1.1 Blood sample collection and genomic DNA extraction

[0035] This invention collected blood samples from goats at a farm in Zhanjiang City, Guangdong Province. During sampling, 5 mL of blood was collected from the goat's jugular vein using a veterinary lancet and placed in an EDTA anticoagulant tube. The anticoagulant tube was then transported back to the laboratory in an insulated box with ice packs and stored at -20°C. Genomic DNA was extracted from the blood samples using a blood genomic DNA extraction kit from Kangwei Century (Jiangsu) Biotechnology Co., Ltd. The qualified genomic DNA was sent to Beijing Compson Biotechnology Co., Ltd. for secondary quality control and library construction, and then subjected to PE150 whole-genome resequencing on the BGI Genomics platform. Raw data was obtained in FASTQ format. High-depth whole-genome resequencing was performed on 20 samples, with an average sequencing depth of 11.32×. Low-depth whole-genome resequencing was performed on 72 samples, with an average sequencing depth of 1.06×.

[0036] 1.2 Analysis of raw sequencing data and genome alignment

[0037] High-depth sequencing data and low-depth sequencing data are subjected to the same quality control process.

[0038] (1) Use Fastp software to filter the original data file.

[0039] (2) The quality-controlled data were aligned using BWA software (reference genome is ARS1, GCA_001704415.1).

[0040] (3) Use Samtools to sort the compared BAM files.

[0041] (4) Use GATK to remove duplicate segments.

[0042] 1.3 Detection of variant sites and genotyping

[0043] (1) GATK HaploytypeCaller generates gvcf files for each sample according to autosomal number.

[0044] (2) GATK CombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0045] (3) GATK Genotype GVCFs were used for population SNP calling based on chromosomes.

[0046] (4) GATK MergeVcfs merges the vcf files of autosomal populations.

[0047] (5) GATK SelectVariants filters SNPs in vcf files of a population.

[0048] (6) GATK Variant Filtration to mark false positive SNP sites.

[0049] (7) The grep command filters the marked SNP sites.

[0050] (8) Plink software filters SNP sites (geno0.1--maf0.05--hwele-06).

[0051] (9) Genotype filling was performed using glimpse2 software, resulting in 20,802,514 high-quality SNPs.

[0052] Example 2: Genome-wide selection signal analysis of southern and northern goat populations

[0053] To further identify selection characteristics that differentiate southern and northern goats, we conducted a genome-wide selection signal analysis between a representative southern goat population (70 individuals) and a northern goat population (69 individuals). We employed various statistical methods: we used VCFtools v0.1.15 to estimate F... ST The θπ ratio and Tajima's D were calculated, and XP-EHH was calculated using Selscanv1.2.0. All indicators were calculated with a 50-kb sliding window and a 20-kb step size. Genomic regions falling in the top 1% of each statistic and overlapping across different methods were considered candidate selection scan regions. To validate strong selection signals, we performed XP-CLR analysis using XP-CLR v1.0.

[0054] Experimental results are as follows Figure 1 As shown, the selection signal analysis results revealed the highest Fst value (windowed Fst = 0.34, θπ ratio = 0.95, XP-EHH = 2.82) observed in a region on chromosome 29 containing the GAB2 gene. This region also showed a high XP-CLR score and a low Tajima's D value.

[0055] Example 3: Association Analysis of Molecular Markers with Goat Growth Traits

[0056] 3.1 Screening of associated SNP sites

[0057] In screening for potential causative mutations within the GAB2 gene region, we identified a mutation site located at position 17,256,044 (G / A) on chromosome 29 in the 3'UTR region of the GAB2 gene. This SNP site was located in the 3'UTR region of the GAB2 gene, with the mutant A allele being dominant in the southern goat population (AF=91.14%), while relatively low in the northern goat population (AF=39.86%). To verify the relationship between these sites and goat growth traits, a total of 657 goats with growth phenotype records were selected as the discovery set to identify and statistically analyze genotypic differences. Due to experimental batches, data gaps, and quality control screening, the specific number of samples involved for each site was not entirely the same.

[0058] The experimental results are shown in Tables 1-2 and Figure 3 As shown, in the discovery set, the GAB2 gene g.17256044G>A locus was significantly associated with all three traits: height, hip height, and hip width (P<0.05). Specifically, hip width was significantly better in the GA (+0.93 cm, P=0.0324) and GG (+1.42 cm, P=0.0105) genotypes than in the AA genotype; height was significantly better in the GA (+2.86 cm, P=0.0131) and GG (+3.71 cm, P=0.0217) genotypes than in the AA genotype; and hip height was significantly better in the GA genotype than in the AA genotype (+2.82 cm, P=0.0209). This indicates that the G allele is a favorable allele.

[0059] Table 1. Effects of key molecular markers and different genotypes on growth traits in goats.

[0060]

[0061] Table 2. Association analysis of the concentrated GAB2 gene g.17256044G>A site with growth traits in goats.

[0062]

[0063] The nucleotide sequence of the 3'UTR transcript of the GAB2 gene is shown below:

[0064] CGCCCGCGCCAGGGAGGGGCCCGGAGGCCACUCUGCAGAGCCGGCCUGGCUGCUCGCCCUUCGCCUCUCCAGUGCGCCCUCCUGCCCACCUCCUCUCUCCUCUGCCACUCUGGGCCUUCAAAGCACUUGGCAUCAGGGACCCUGACCCCUUCCCCCUGGGAGGCGAGGGCCUGAUCGAGGCACUUCCUCUGCCCUCUCCGGGUCCACCUUUGAUUUUUAUCAGCAAUGGCCAUCCUACCUUAGUUAGAGCUCUUGCCAAAAAGCAUCCUUAAGCGUCCGCCUGCCCUUCAGACCCGAAUAUCUACCGGACGUGUGGGGGCGGGGCCACGGCUCUGGGCGGAUUCCUCACCUCACCGUCCGGCCUCCAGCUACUGGGCUCCCCGCCUCGGUCCCAGAAGAGGCCACAUCGUCCCGCUGACCAGGCACCCAAGGAUCAGCAGGCCAGUGUGGACGCGGACCUCUUCGUCCCUGUCUUCCUUGGCAGAGGCGGGGCGAGGCCACCUAAAGGCGGAGGAGCCGCGGAGGAAG;

[0065] The corresponding nucleotide sequence of the localization sequence (17255869-17256395) comprising the above-mentioned SNP site is shown as follows:

[0066] .

[0067] 3.2 Verification of SNP site specificity

[0068] To verify whether the selected SNP loci can be used to predict goat growth traits, an additional 522 goat samples with growth phenotype records, independent of the discovery set, were selected for independent identification and statistical verification. Due to experimental batches, data gaps, and quality control screening, the number of samples involved for each locus was not exactly the same.

[0069] The experimental results are shown in Tables 3-4 and Figure 4 As shown, in the independent validation set, the genetic effect of hip width was the most stable, with the GA (+0.88 cm, P=0.00551) and GG (+1.13 cm, P=0.00759) genotypes being significantly better than the AA genotype (P<0.01), and the direction of the effect was completely consistent with the discovery set (GG>GA>AA). In the validation set, the GA genotype was still significantly better than the AA genotype for both body height and hip height (body height +2.64 cm, P=0.00086; hip height +2.15 cm, P=0.0170).

[0070] Table 3. Effects of different genotypes of key molecular markers on growth traits in goats.

[0071]

[0072] Table 4. Association analysis between the GAB2 gene g.17256044G>A site in the validation set and growth traits in goats.

[0073]

[0074] Example 4: Overexpression experiment to verify the effect of mutant SNP sites on cell growth

[0075] 4.1 Detection of miRNA overexpression efficiency at GAB2 gene mutation sites

[0076] Since SNPs in the 3'UTR region typically regulate gene expression by altering miRNA binding affinity, we used RNAHybrid 2.2 software to predict the potential miRNA for this variant. The results showed that the GAB2 gene is a highly targeted gene of chi-miR-33b-3p (-34.1 kcal / mol). The prediction results indicate that the mutation at chromosome 29, 17,256,044 (G / A), is located within the core binding region of this miRNA, suggesting that this allele variation may alter the regulatory effect of the miRNA. Figure 2 ).

[0077] A dual-luciferase reporter assay was performed using HEK293T cells to verify the targeting relationship. Cells were cultured in DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (VISTECH, China) and 1% penicillin-streptomycin, and incubated at 37°C in a humidified incubator with 5% CO2. When the cells reached a certain confluence, they were passaged using 0.25% trypsin-EDTA (Gibco, USA) at a 1:n ratio.

[0078] For the luciferase reporter gene construct, a wild-type (WT) 3'-UTR fragment of the GAB2 gene containing the predicted binding site chi-miR-33b-3p (as shown in SEQ ID NO.3) was synthesized, digested with trypsin using 0.25% EDTA, and inserted downstream of the firefly luciferase gene in the pmirGLO dual-luciferase reporter vector (Promega, USA) (ligated after double digestion with NheI and XhoI). Mutant (MUT) versions of these vectors (as shown in SEQ ID NO.4) were constructed by site-directed mutagenesis to disrupt binding complementarity within the seed region.

[0079] The dual-luciferase assay was performed in 96-well plates. Cells in logarithmic growth phase were cultured at 1.5 × 10⁶ cells per well. 4Cells were seeded at a density of 100 g / well and incubated overnight. Co-transfection was performed using Lipo8000 transfection reagent (Beyotime, China), with 0.2 μg WT or MUT reporter plasmid and 0.2 μg miRNA mimic or negative control (NC) mimic per well. Six hours after transfection, the transfection medium was replaced with 100 μL of fresh complete medium. After culturing for another 48 hours, luciferase activity was detected using the Dual-Glo® luciferase detection system (Promega, E2980). First, 35 μL of luciferase substrate was added to detect firefly luciferase activity, followed by 30 μL of Stop & Glo® reagent to detect Renida luciferase activity. Relative luciferase activities were calculated by normalizing the firefly fluorescence signal to the Renida signal.

[0080] The nucleotide sequence of the negative control (NC) mimic is as follows:

[0081] UUCUCCGAACGUGUCACGUdTdT;

[0082] The nucleotide sequence of the chi-miR-33b-3p mimic is as follows:

[0083] CAGUGCCUCGGCAGUGCAGCC.

[0084] The results of the dual-luciferase reporter gene assay showed that in HEK-293T cells transfected with chi-miR-33b-3p, the luciferase activity of chi-miR-33b-3p-WT was significantly reduced (P<0.01), while there was no significant effect on the luciferase activity of the chi-miR-33b-3p-Mut mutant plasmid (P>0.05). Figure 5 In summary, the results confirm that chi-miR-33b-3p directly targets the 3'UTR of the GAB2 gene and inhibits its protein expression in HEK-293T cells.

[0085] 4.2 Effect of overexpression of chi-miR-33b-3p at the mutation site of the GAB2 gene on the proliferation of goat preadipocytes

[0086] The effect of chi-miR-33b-3p on the proliferation of primary goat preadipocytes was assessed using a 5-ethynyl-2'-deoxyuridine (EdU) incorporation assay to evaluate its functional role. A brief summary of the steps is as follows:

[0087] Goat preadipocytes (from Cyos) were used at a rate of 2 × 10⁻⁶. 5Cells were seeded at a density of [number] cells / mL in 96-well plates. Following the method described in 4.1, 0.2 μg of miRNA mimic or negative control (NC) mimic was transfected into the cells using Lipo8000 transfection reagent, followed by incubation with 20 μM EdU (Beyotime, China) for 2 hours. Subsequently, cells were fixed with 4% paraformaldehyde, permeabilized with 0.3% Triton X-100, and blocked with 3% BSA. A Click reaction was performed for 30 minutes, followed by nuclear staining with DAPI for 10 minutes. Images were acquired using a fluorescence microscope (excitation wavelength 470 nm, emission wavelength 525 nm), and the proportion of EdU-positive cells was calculated to determine the proliferation rate.

[0088] Experimental results are as follows Figure 6 As shown, the EdU incorporation experiment demonstrated that, compared with the NC mimics group, the transfection of chi-miR-33b-3p had a highly significant inhibitory effect on the proliferation of preadipocytes (P < 0.01).

[0089] 4.3 Detection of expression levels of key adipogenic differentiation marker genes

[0090] To validate differentiation phenotypes at the molecular level, the expression of key adipogenic differentiation marker genes (PPARγ, C / EBPα, and FABP4) in cells cultured in section 4.2 was detected using qRT-PCR and Western blot.

[0091] Total RNA was extracted from cells using RNAiso Plus reagent (Takara, Japan). RNA concentration and purity were determined using a spectrophotometer. Reverse transcription was performed using the Hifair® II First-Strand cDNA Synthesis Kit (Yeasen, China). Quantitative PCR was performed on an ABI ViiA 7 system using Hieff® qPCR SYBR Green premix (Yeasen, China). The reaction program was: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds. The relative expression levels of adipogenic marker genes (including PPARγ, C / EBPα, and FABP4) were calculated using the 2⁻ΔΔCt method, with β-actin as an internal control.

[0092] Total protein was extracted using RIPA lysis buffer supplemented with protease and phosphatase inhibitors. Protein concentration was quantified using a BCA protein assay kit (UElandy, China). Protein samples were denatured at 100°C for 10 min, separated by SDS-PAGE, and electrotransferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% skim milk at room temperature for 1 h, then incubated overnight at 4°C with primary antibodies (PPARγ, 1:2,000; FABP4, 1:2,000; or β-actin, 1:50,000). After washing with TBST, the membranes were incubated with HRP-labeled secondary antibody (1:10,000) at room temperature for 1 h. Protein bands were visualized using an ECL chemiluminescence system and analyzed using an imaging system.

[0093] Experimental results are as follows Figure 7 As shown, chi-miR-33b-3p significantly downregulated the mRNA and protein expression levels of these adipogenic genes (P<0.01).

[0094] These findings provide mechanistic evidence that specific variants that select for action on the 3'UTR of the GAB2 gene finely regulate the proliferation and adipogenesis of preadipocytes through allele-specific miRNA interference, ultimately leading to regional phenotypic differentiation in Chinese goats.

[0095] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A molecular marker for detecting the SNP associated with the goat GAB2 gene and growth traits, characterized in that: Located at nucleotide position 17,256,044 on chromosome 29 of the goat reference genome, the base at this position is G or A. The nucleotide sequence containing the upstream and downstream sequences of this SNP position is shown in SEQ ID NO.1, and the position is located at position 176 of this sequence.

2. A reagent or kit for detecting SNP molecular markers associated with the goat GAB2 gene and growth traits, characterized in that: Includes primers for amplifying the SNP site at 176 bp of the nucleotide sequence in SEQ ID NO.

1.

3. The reagent or kit for detecting SNP molecular markers related to growth traits of the goat GAB2 gene according to claim 2, characterized in that: The primers described can be designed according to primer design principles to detect SNP molecular markers related to growth traits in goats' GAB2 gene, thereby predicting the growth traits of goats.

4. The application of the reagent or kit for detecting SNP molecular markers related to growth traits of the goat GAB2 gene as described in claim 1 and / or any of the reagents or kits for detecting SNP molecular markers related to growth traits of the goat GAB2 gene as described in claims 2 to 3 in the detection, prediction or assisted prediction of goat growth traits.

5. The application of the reagent or kit for detecting SNP molecular markers related to growth traits of the goat GAB2 gene as described in claim 1 and / or any of the reagents or kits for detecting SNP molecular markers related to growth traits of the goat GAB2 gene as described in claims 2 to 3 in goat resource identification, improvement or molecular marker-assisted breeding.

6. A molecular marker-assisted selection breeding method for meat goats, characterized in that... Includes the following steps: SNP molecular markers of breeding goats in the core goat herd were identified. Individuals with the base at position 176bp of the SNP marker shown in SEQ ID NO.1 were selected, while individuals with the base at position AA and GA were eliminated. This was done to increase the frequency of the G gene at this locus generation by generation, thereby improving the growth traits of offspring goats.

7. Application of reagents that downregulate GAB2 gene expression in regulating the proliferation of goat preadipocytes.

8. The application of the reagent for downregulating GAB2 gene expression according to claim 7 in regulating the proliferation of goat preadipocytes, characterized in that: The reagents used to downregulate GAB2 gene expression include the chi-miR-33b-3p mimic, whose nucleotide sequence is CAGUGCCUCGGCAGUGCAGCC.

9. The application of the reagent for downregulating GAB2 gene expression according to claim 7 in regulating the proliferation of goat preadipocytes, characterized in that: The reagents for downregulating GAB2 gene expression also include reagents for transferring the chi-miR-33b-3p mimic into cells.

Images