Snps related to sperm survival rate of black feathered muscovy duck, detection primer set and application

Abstract

The application discloses a SNP molecular marker related to sperm survival rate of black-feathered Mandarin duck, a detection primer group and application. The SNP molecular marker is located at the base of the 174422th locus of a GWHBJBF00000002 chromosome of the black-feathered Mandarin duck, and C / T single nucleotide polymorphism exists in the SNP molecular marker locus. The application obtains the SNP locus significantly related to the sperm survival rate of the male black-feathered Mandarin duck through whole genome resequencing and whole genome association analysis screening, and further adopts KASP gene genotyping technology for verification, so as to establish a sperm survival rate molecular assisted selection method which is rapid, accurate and low in cost, and to improve the breeding efficiency of the male black-feathered Mandarin duck.

Description

Technical Field

[0001] This invention relates to the field of animal molecular breeding technology, specifically to SNP molecular markers, detection primer sets, and applications related to sperm survival rate in Muscovy ducks. Background Technology

[0002] Muscovy ducks are an important specialty meat duck genetic resource in my country. The reproductive performance of male ducks directly affects the propagation efficiency of breeding duck populations and the production of commercial ducklings. Sperm viability is one of the important indicators for evaluating the quality and reproductive performance of male duck semen, and its level is directly related to sperm survival ability, fertilization potential, and artificial insemination results.

[0003] Currently, the evaluation of male duck sperm viability mainly relies on phenotypic methods such as microscopic observation and staining after semen collection. This method suffers from drawbacks including a cumbersome testing process, significant susceptibility to environmental and testing conditions, and high costs. Furthermore, sperm viability is a complex quantitative trait, and relying solely on traditional phenotypic selection makes it difficult to identify breeding male ducks with superior reproductive performance early on, thus limiting breeding efficiency.

[0004] With the development of whole-genome resequencing and molecular marker technologies, early molecular-assisted selection using single nucleotide polymorphism (SNP) markers associated with sperm viability can screen the genetic potential of breeding ducks before they exhibit stable reproductive phenotypes. However, there is currently no good method for screening the reproductive potential of Muscovy duck breeding stock.

[0005] Therefore, developing an SNP marker that is significantly correlated with Muscovy duck sperm survival rate, is easy to detect, and is suitable for molecular marker-assisted breeding, in order to improve the reproductive performance and breeding efficiency of black-feathered Muscovy duck males, is an urgent problem to be solved in this invention. Summary of the Invention

[0006] In view of the above-mentioned prior art, the purpose of this invention is to overcome the problems that the sperm survival rate of male Muscovy ducks mainly relies on phenotypic detection, the detection process is relatively cumbersome, and it is difficult to achieve early genetic selection. In this invention, a SNP molecular marker related to the sperm survival rate of Muscovy ducks, a detection method for the SNP molecular marker, and its application in sperm survival rate identification and molecular marker-assisted breeding are provided.

[0007] To achieve the above objectives, the present invention provides an SNP molecular marker related to sperm survival rate of Muscovy ducks. The SNP molecular marker is located at the base at position 174422 on chromosome GWHBJBF00000002 of Muscovy ducks, and the SNP molecular marker site has a C / T single nucleotide polymorphism.

[0008] Specifically, the genotypes of this SNP locus include: C / C genotype, C / T genotype, and T / T genotype.

[0009] The genomic sequence used to locate this SNP site is the 401 bp sequence of chromosome 174222-174622 of the Muscovy duck GWHBJBF00000002. Specifically, the genomic sequence used to locate this SNP site is shown in SEQ ID No:1 or SEQ ID No:2. That is, SEQ ID No:1 corresponds to the sequence with allele C, and SEQ ID No:2 corresponds to the sequence with allele T.

[0010] That is, the SNP site is located at position 201 of the sequence shown in SEQ ID No:1 or SEQ ID No:2, corresponding to position 174422 of chromosome GWHBJBF00000002 in the reference genome.

[0011] This invention also provides two allele-specific upstream primers and one universal downstream primer designed for the aforementioned SNP molecular markers. The nucleotide sequence of the specific upstream primer designed for the C allele is shown in SEQ ID No:3 (specifically: GAAGGTGACCAAGTTCATGCTGCCAGGGCTTTGGTGTCG), and its first segment is a universal FAM fluorescent tag sequence. The nucleotide sequence of the specific upstream primer designed for the T allele is shown in SEQ ID No:4 (specifically: GAAGGTCGGAGTCAACGGATTGCCAGGGCTTTGGTGTCA), and its first segment is a universal VIC fluorescent tag sequence. The nucleotide sequence of the universal downstream primer is shown in SEQ ID No:5 (specifically: CAGCAACTGCCCCGAACC).

[0012] Furthermore, the present invention also provides a method for assisted breeding based on the above-mentioned SNP molecular markers, which utilizes the above-mentioned SNP molecular markers to conduct early identification of sperm viability in male Muscovy ducks and molecular marker-assisted breeding, specifically including the following steps: Step 1: Collect samples from the individuals to be tested. Blood samples were collected from the wing veins of male Muscovy ducks to be tested, and genomic DNA was extracted.

[0013] Step 2: Perform SNP genotyping Genotyping of the GWHBJBF00000002:174422 locus was performed using the aforementioned KASP-specific primers and PCR reaction system.

[0014] Step 3: Determine the genotype The individual under test was determined to have the C / C, C / T, or T / T genotype based on the KASP fluorescence signal.

[0015] Step 4: Select based on genotype When selecting male Muscovy ducks for reproductive performance, C / C genotype individuals are given priority as candidate males, while C / T genotype individuals are reduced or eliminated to increase the frequency of alleles associated with higher sperm survival rates in the population.

[0016] Through the above technical solution, the present invention has at least the following beneficial effects: 1. This invention screened and obtained SNP molecular markers that are significantly associated with sperm survival rate of Muscovy ducks.

[0017] This invention, through whole-genome resequencing and genome-wide association analysis, identified the GWHBJBF00000002:174422 C / T SNP locus in a male Muscovy duck population. This locus showed a significant association with sperm viability, with an EMMAX model p-value of 1.638 × 10⁻⁶. -10 It can serve as a candidate molecular marker for sperm survival rate in Muscovy ducks.

[0018] 2. Molecular markers have a clear correspondence between genotype and phenotype.

[0019] KASP validation results showed that the average sperm survival rate of individuals with the C / C genotype was 82.81%, while that of individuals with the C / T genotype was 65.86%. The average sperm survival rate of individuals with the C / C genotype was about 16.94 percentage points higher than that of individuals with the C / T genotype, indicating that this locus has good potential for sperm survival rate identification.

[0020] 3. The detection method is fast and accurate, and suitable for batch testing.

[0021] This invention uses KASP technology for SNP genotyping. The reaction system is small and the operation is simple. It can be detected using a conventional fluorescence PCR instrument and is suitable for batch genotyping of multiple individuals.

[0022] 4. It can be used for early molecular marker-assisted selection.

[0023] Traditional sperm viability evaluation requires collecting semen from male ducks after they reach the breeding stage for testing. However, this invention only requires collecting blood to extract DNA for genotyping, which can screen candidate male ducks with potentially high sperm viability at an early stage, thereby shortening the breeding cycle and reducing the cost of phenotyping.

[0024] 5. It helps improve the breeding efficiency of male black-feathered Muscovy ducks.

[0025] Applying the SNP markers of this invention to the breeding of male black Muscovy ducks can incorporate sperm survival rate into the molecular marker-assisted breeding system, providing a new technical means for the genetic improvement of the reproductive performance of black Muscovy ducks. Detailed Implementation

[0026] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0027] The present invention will be described in detail below through specific embodiments.

[0028] The black-feathered Muscovy ducks used in this invention were provided by Taizhou Fengda Agricultural and Animal Husbandry Technology Co., Ltd. This black-feathered Muscovy duck population was bred using pure black male Muscovy ducks from France as the paternal line and local Muscovy ducks from Gutian, Longyan, and Putian in Fujian Province as the maternal line. It was developed through hybridization, backcrossing, and progressive hybridization, combined with multi-generational individual selection, family selection, in-family selection, and molecular-assisted breeding techniques. This population possesses genetic characteristics such as pure black plumage, moderate body size, relatively fast growth rate, high lean meat percentage, and excellent meat quality, and has gradually formed a stable genetic foundation. Example 1: Screening of SNP loci related to sperm survival rate in male Muscovy ducks

[0029] Semen was extracted from 100 male Muscovy ducks, and corresponding semen quality phenotypic data were obtained. Semen quality testing was conducted according to the "Poultry Semen Quality Testing Methods NY / T 4047-2021". Semen quality indicators included: semen volume, semen pH, sperm motility, sperm density, and sperm viability. Sperm viability was the key trait studied in this invention.

[0030] Of the 100 experimental male ducks, 98 individuals had complete semen quality records, while the remaining 2 were not included in the subsequent association analysis due to missing semen quality data.

[0031] The descriptive statistical results of each semen quality trait are shown in Table 1.

[0032] Table 1

[0033] Whole-genome resequencing was performed on the aforementioned 100 male Muscovy ducks. Specifically, genomic DNA was extracted from venous blood samples collected from the wings of the experimental male ducks. After the extracted DNA passed concentration and quality tests, whole-genome resequencing and KASP genotyping were performed.

[0034] After quality control, reference genome alignment, variant detection, and genotype quality filtering, high-quality SNP data are obtained from the sequencing data.

[0035] This study yielded approximately 5,453,115 high-quality SNP loci. Example 2: Screening of SNP sites

[0036] Genome-wide association analysis was performed on the high-quality SNPs obtained in Example 1 using the EMMAX mixed linear model.

[0037] EMMAX is an abbreviation for Efficient Mixed-Model Association eXpedited, a highly efficient mixed linear model association analysis method that reduces the influence of population structure and individual kinship on association results by considering population kinship and genetic structure in the association analysis. The specific operational steps are performed according to the method disclosed by Kang HM et al. in "Variance component model to account for sample structure in genome-wide association studies" (Nature Genetics, 2010, 42:348-354).

[0038] The association results were filtered using a strict significance threshold.

[0039] The results showed that the SNP at position 174422 on chromosome GWHBJBF00000002 was significantly associated with sperm viability, with a P-value of 1.638 × 10⁻⁶. -10 .

[0040] This site represents a C / T polymorphism.

[0041] Gene annotation revealed that the region adjacent to this site is associated with genes related to HSF1, MAF1, and mitochondrial cytochrome c1.

[0042] Among them, HSF1 is heat shock factor 1, which participates in cellular heat stress response and protein homeostasis regulation; MAF1 is involved in transcriptional regulation; and mitochondrial cytochrome c1 is related to mitochondrial electron transport and energy metabolism.

[0043] Therefore, it is speculated that the genomic region where this site is located may participate in the regulation of sperm viability by influencing processes such as heat stress response, protein homeostasis, transcriptional regulation, and mitochondrial function. Example 3: Design of KASP primers for the GWHBJBF00000002:174422 site

[0044] KASP typing primers were designed based on the target region shown in SEQ ID No:1 or SEQ ID No:2 (i.e., positions 174222-174622 on chromosome GWHBJBF00000002 of the Muscovy duck genome).

[0045] The sequence of the target region shown in SEQ ID No:1 or SEQ ID No:2 is as follows: GCCTTGAGCTGCCGGTGCCGAATGAACAGGGCAGAAATCAGCCCCCGTCCCGGGCAGACCCGGGCAGCAGACCCGGAGCTCTGGTGCGTGCCTGACGCCCTCCGAGCACAGAGAGCGCTGCCAGGAGCGGGCACTGCGTGGGGACGGGGCCCTGGCACCCCTCAGCAACTGCCCCGAACCCGAAAAGCACCAGGACGGGAG[C / T]GACACCAAAGC CCTGGCACAAAGGCAGCGCTGCCCAGGGGGTGCCCTGCAGCAGGAGGGGTCGGCGGGGAGCTCGAGGGGAGCAGGAGCCGAGGGCGGGGGGGGGCCAGGGCCCGGTCCCGGCCCCGCAGGGGGGGAGGAGGCGGGGGACGGCCCCAGCAGAGCTAATTTTAAACGGGGCCGTGATGGAAAGCAGAGCC (where [C / T] in this sequence is an SNP molecular marker. That is, the sequences shown in SEQ ID No:1 and SEQ ID No:2 differ only at position 201 of the above sequences, where the two alleles are C and T, and sequences SEQ ID No:1 and SEQ ID No:2 are sequences corresponding to one of the alleles respectively).

[0046] The specific upstream primer sequence designed for SEQ ID No:1 (i.e., allele C) is shown in SEQ ID No:3 (specifically: GAAGGTGACCAAGTTCATGCTGCCAGGGCTTTGGTGTCG); the specific upstream primer sequence designed for SEQ ID No:2 (i.e., allele T) is shown in SEQ ID No:4 (specifically: GAAGGTCGGAGTCAACGGATTGCCAGGGCTTTGGTGTCA). The specific downstream primer sequences for SEQ ID No:1 and SEQ ID No:2 are shown in SEQ ID No:5 (specifically: CAGCAACTGCCCCGAACC). The 5' ends of both upstream primers contain FAM and VIC universal fluorescent tag sequences, respectively. Example 4: KASP genotyping

[0047] Primers as shown in SEQ ID No:3 (denoted as the first upstream primer), SEQ ID No:4 (denoted as the second upstream primer), and SEQ ID No:5 (denoted as the downstream primer) were diluted to 10 μM with TE buffer (pH 8.0).

[0048] The diluted first upstream primer, second upstream primer, and downstream primer were mixed in a volume ratio of 1:1:3 to obtain the KASP primer mixture.

[0049] Genomic DNA of the black-feathered Muscovy duck to be tested was extracted and uniformly diluted according to the lowest concentration of the sample to obtain a DNA template concentration of 10-20 ng / μL.

[0050] The reaction systems were constructed according to the amounts of each component shown in Table 2 (the total volume of each reaction system was 5 μL), wherein the amount of DNA template to be tested in each reaction system was 1.25 μL.

[0051] Table 2

[0052] Add the mixed reaction mixture to a 384-well PCR plate, seal the plate, vortex, and centrifuge. Then perform PCR according to the reaction procedure shown in Table 3. That is, the PCR reaction procedure is as follows: First stage: Pre-denaturation at 95℃ for 10 minutes; Second stage: Perform 10 cycles, each cycle including: 95℃ denaturation for 20s; gradient annealing / extension from 61℃ to 55℃ for 60s; The third stage involves 27 cycles, each cycle consisting of: 95°C denaturation for 20 seconds; 55°C annealing / extending for 60 seconds. Fourth stage: Read fluorescence signal at 25℃ for 30s.

[0053] Table 3

[0054] PCR amplification and fluorescence signal reading were performed using the QuantStudio™ 7 Flex System.

[0055] Cluster analysis was performed based on FAM and VIC fluorescence signals to obtain the genotype of each individual to be tested.

[0056] Verification Example Genomic DNA from 98 male Muscovy ducks with sperm viability phenotypes recorded in Example 1 was used as template DNA, and KASP typing was performed according to the method in Example 4. Individuals that test positive for C / C are classified as having the C / C genotype. Individuals that possess both C and T allele signals are identified as having the C / T genotype. If a T / T signal is detected, the genotype is determined to be T / T.

[0057] The results are shown in Table 4.

[0058] Table 4

[0059] As shown in Table 4, among the individuals for whom valid genotyping and sperm viability data were obtained, 87 were C / C genotype, 11 were C / T genotype, and no T / T genotype was detected. The results indicate that the sperm viability of individuals with the C / C genotype was generally higher than that of individuals with the C / T genotype, by an average of approximately 16.94 percentage points.

[0060] Based on the existing data, a statistical comparison of genotype and sperm survival rate was conducted. The difference between C / C and C / T genotypes reached a significant level (P < 0.05), indicating that the C / T polymorphism at the GWHBJBF00000002:174422 locus is associated with the sperm survival rate of male Muscovy ducks.

[0061] Application example: Application of SNP molecular markers in the assisted breeding of black-feathered Muscovy ducks Using the KASP detection method described in Example 4, the selected male Muscovy ducks were genotyped at the GWHBJBF00000002:174422 locus.

[0062] Interpretation of genotyping results: Individuals tested positive for the C / C genotype will be given priority for breeding as candidate male ducks with high sperm survival potential.

[0063] For individuals tested to be C / T genotype, their priority for breeding should be reduced in the selection of breeding male ducks for reproductive performance, or a comprehensive selection should be made in combination with other reproductive performance indicators.

[0064] For the T / T genotype, this genotype was not detected in the specific embodiments of the present invention. Therefore, the sperm survival rate of this genotype is not limited.

[0065] As can be seen from the above embodiments, verification examples and application examples, the present invention obtains significant SNP sites related to sperm viability by performing whole-genome resequencing and whole-genome association analysis on male Muscovy ducks.

[0066] In the genome-wide association analysis, sperm viability was used as the target trait. An EMMAX mixed linear model was employed for association analysis. Under a strict significance threshold, the C / T locus GWHBJBF00000002:174422 reached a significant association level, with an EMMAX association analysis p-value of 1.638 × 10⁻⁶. -10 The candidate region containing this locus is adjacent to or annotated with genes related to HSF1, MAF1, and mitochondrial cytochrome c1. Combined with the known functions of these genes, this suggests that the region may be involved in biological processes such as heat stress response, protein homeostasis, transcriptional regulation, and mitochondrial energy metabolism, and may also be involved in the regulation of sperm viability. Further comparison of genotype analysis with sperm viability trait detection results confirmed a positive relationship between genotype and sperm viability.

[0067] Based on this, the present invention can use KASP technology to genotype the SNP molecular markers, thereby assessing the sperm survival rate of male black Muscovy ducks through the genotyping results. This can be effectively applied to the breeding of male black Muscovy ducks, providing a new technical means for assisted breeding and genetic improvement of reproductive performance of black Muscovy ducks.

[0068] The technical solution of this invention allows for early screening of candidate breeding male ducks solely through blood collection and genotyping, without the need for semen collection or sperm viability phenotyping. Simultaneously, the GWHBJBF00000002:174422 C / T SNP molecular marker proposed in this invention can be used for early molecular identification of sperm viability in male Black-feathered Muscovy ducks and for marker-assisted selection of reproductive performance. This invention uses whole-genome resequencing and genome-wide association analysis to screen for SNP loci significantly associated with sperm viability in male Black-feathered Muscovy ducks, and further validates these loci using KASP genotyping technology. This establishes a rapid, accurate, and low-cost molecularly-assisted selection method for sperm viability, thereby improving the breeding efficiency of male Black-feathered Muscovy ducks.

[0069] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0070] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0071] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A SNP molecular marker associated with sperm survival rate in Muscovy ducks, characterized in that, The SNP molecular marker is located at the base at position 174422 on chromosome GWHBJBF00000002 of the Muscovy duck, and this SNP molecular marker site exhibits a C / T single nucleotide polymorphism.

2. The SNP molecular marker according to claim 1, characterized in that, The SNP molecular marker corresponds to the 201st base in the nucleotide sequence shown in SEQ ID No:1 or SEQ ID No:

2.

3. A primer set for detecting the SNP molecular marker as described in claim 1 or 2, characterized in that, The primer set includes a C allele-specific upstream primer as shown in SEQ ID No:3, a T allele-specific upstream primer as shown in SEQ ID No:4, and a universal downstream primer as shown in SEQ ID No:

5.

4. The primer set according to claim 3, characterized in that, The 5' end of the C allele-specific upstream primer is attached to a first fluorescent group, and the 5' end of the T allele-specific upstream primer is attached to a second fluorescent group; and, The first fluorescent group is different from the second fluorescent group.

5. The primer set according to claim 4, characterized in that, The first fluorescent group is FAM, and the second fluorescent group is VIC.

6. The application of the SNP molecular marker as described in claim 1 or 2 in screening male Muscovy ducks with high sperm viability, characterized in that, The application involves selecting male Muscovy ducks with the SNP molecular marker C / C genotype.

7. The application according to claim 6, characterized in that, The screening process specifically includes: using primer sets as shown in SEQ ID No:3, SEQ ID No:4 and SEQ ID No:5 to amplify gene fragments containing SNP marker sites to obtain amplification products; using sequencing technology to genotype the obtained amplification products and screening for male Muscovy ducks with C / C genotypes.

8. The application according to claim 7, characterized in that, The gene fragment containing the SNP marker site is shown in SEQ ID No:1 or SEQ ID No:2.

Images