Japanese medaka orf2 / tcb1 intergenic region genetic sex snp molecular marker and application thereof

Abstract

The application discloses a Japanese Acanthophacetus ORF2 / Tcb1 intergenic region genetic sex SNP molecular marker, a primer group, a kit, an identification method and application thereof. The SNP molecular marker has C / T single nucleotide polymorphism; when the site is a TT homozygote, the Japanese Acanthophacetus is female, and when the site is a CT heterozygote, the Japanese Acanthophacetus is male. The application also provides upstream and downstream primers for specifically amplifying the marker, and a kit containing the primer group to realize integrated detection of sample nucleic acid extraction, specific amplification and genotype interpretation. Through verification of 120 samples, the identification accuracy of the application reaches 100%. Compared with traditional dissection, body surface observation and other means, the application only needs to minimally invasively collect a small amount of tissue, does not need to sacrifice individuals, is simple to operate, fast to detect, can quickly determine the genetic sex at the juvenile fish stage, and can be used in the fields of Japanese Acanthophacetus breeding family construction, regulation of the male / female ratio of a breeding population, and good seed auxiliary breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a genetic sex-related SNP molecular marker in the intergenic region of the ORF2 / Tcb1 gene of the Japanese blimp, as well as primer sets, kits, identification methods and applications based on this marker. Background Technology

[0002] The Japanese bluffalo (Chirolophis japonicus) belongs to the order Perciformes, family Stichaeidae, and genus Chirolophis. It is widely distributed in the shallow rocky reefs and intertidal zones of the Yellow Sea, Bohai Sea, and northern Japan. It is a cold-temperate omnivorous economic fish with delicious flesh and high fat content, making it highly valuable for aquaculture development.

[0003] Currently, the techniques used for sex identification in Japanese blimps are mainly divided into two categories: traditional phenotypic identification and routine molecular genetic identification. In actual aquaculture and basic testing, observation of the external genital opening, dissection of the gonads, and gonadal tissue sections are the most commonly used traditional identification methods. However, these methods can only distinguish the sex of the fish's external gonads, and have insurmountable limitations: for juvenile individuals whose gonads have not yet developed and differentiated, it is impossible to accurately determine their inherent genetic sex based on external characteristics or dissection; at the same time, dissection and gonadal sectioning require the sacrifice of experimental individuals, and once superior germplasm resources are found, they cannot be preserved as breeding parents for family breeding. Traditional molecular detection methods such as chromosome karyotype analysis and quantitative expression of key gonadal genes are cumbersome and costly, and are only suitable for laboratory research on the basic mechanisms of sex differentiation, and cannot meet the production needs of rapid screening of large numbers of samples in aquaculture seedling production.

[0004] Limited by existing sex identification technology, aquaculture practitioners cannot predict the male-to-female ratio of the population in the early stages of seedling cultivation. It is difficult to construct all-female or all-male breeding pedigrees according to production needs, resulting in low overall breeding efficiency. This fundamentally hinders the large-scale and industrialized development of artificial breeding of Japanese blimp.

[0005] Drawing on established research approaches in modern fish molecular breeding, screening and developing species-specific sex-linked SNP molecular markers is a preferred technical approach for systematically analyzing the genetic regulation system of fish sex determination and achieving rapid, minimally invasive, in vivo sex determination. Based on these dual industrial and scientific needs, the development of a high-accuracy, minimally invasive, easy-to-operate, and fast molecular tool for genetic sex identification specifically for the Japanese blubber nymph (Eriocheir sinensis) is of significant theoretical and practical value for improving the breeding system of superior Japanese blubber nymphs and promoting the high-quality development of the Japanese blubber nymph aquaculture industry. Summary of the Invention

[0006] In a first aspect, this invention provides a genetic sex-specific SNP molecular marker for the ORF2 / Tcb1 intergenic region of the Japanese blimp, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1 or SEQ ID NO:2, and the SNP site is located at position 301 from the 5' end of the sequence, where a C / T single nucleotide polymorphism exists. When the genotype at this site is homozygous for TT, the Japanese blimp is female; when the genotype at this site is heterozygous for CT, the Japanese blimp is male.

[0007] ORF2 (reverse transposon open reading frame 2) is a key enzyme protein encoded by retrotransposons, possessing both endonuclease and reverse transcriptase activities. ORF2 plays a dual role in genome evolution, structural variation, and germline genetic diversity: on the one hand, it generates new genetic variations through reverse transcription insertion; on the other hand, its abnormal activation can lead to genomic instability, closely related to neurodegenerative diseases, cancer, and aging. Currently, the regulation of ORF2 protein activity and its selective inhibition in the host germline are among the hot research topics in transposon biology. Tcb1 transposase is a catalytic protein encoded by DNA transposons, belonging to the hAT superfamily. It recognizes terminal inverted repeat sequences of transposons and catalyzes a "cut-and-paste" transposition reaction. hAT superfamily transposases are widely distributed in eukaryotes, and their catalytic function typically relies on conserved DDE / D catalytic domains, achieving transposon excision and reintegration through the formation of synaptic complexes. Existing studies suggest that the Tcb1 transposase possesses high transposition activity and relatively lenient target site preference, thus holding potential for application in genetic engineering. However, the most widely used and well-supported hAT superfamily tools in vertebrates such as fish are still represented by Tol2, and the conclusion that Tcb1 is a highly efficient transgenic tool requires further original research support. Its natural dormant state may also provide a model for studying the co-evolution of transposon reactivation and host defense. To date, a literature search has not yielded any reports on the genetic identification of males and females of the Japanese blimp based on the enzyme activity characteristics of ORF2 protein or Tcb1 transposase.

[0008] In a second aspect, the present invention provides a primer set for amplifying the SNP molecular marker described in the first aspect, the primer set comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO:3 and the nucleotide sequence of the downstream primer being shown in SEQ ID NO:4.

[0009] F: 5'-TGTAGAACAACACGAGACGGATC-3' (SEQ ID NO: 3);

[0010] R: 5'-GCTGAGGAACCAGACCACCTT-3' (SEQ ID NO: 4).

[0011] In a third aspect, the present invention provides a kit for identifying the genetic sex of the Japanese blubber shrike, the kit comprising the primer set described in the second aspect.

[0012] As a preferred technical solution, the kit also includes PCR amplification reaction system reagents, nucleic acid extraction reagents, positive controls, and negative controls, enabling a complete experimental process for rapid nucleic acid extraction, specific amplification, and result determination of Japanese blister beetle samples, without the need for additional purchased reagents, thus significantly improving the convenience, stability, and accuracy of detection.

[0013] As a preferred technical solution, the PCR amplification reaction system reagents include 2×Taq PCR premix and sterile ultrapure water; wherein the 2×Taq PCR premix contains Taq DNA polymerase, dNTP mixture, magnesium ions, and PCR buffer, and the component ratio is adapted to the specific amplification conditions of the primer set of the present invention, which can effectively ensure the efficient amplification of sex-specific gene fragments of Japanese blister beetles, avoid problems such as non-specific amplification, weak amplification bands, and false negatives, and is compatible with conventional PCR amplification instruments, with strong adaptability and good repeatability.

[0014] In a fourth aspect, the invention provides the application of the genetic sex SNP molecular markers of the ORF2 / Tcb1 intergenic region of the Japanese blimp described in the first aspect in the identification of genetic sex in the Japanese blimp.

[0015] In a fifth aspect, the present invention provides a method for identifying the genetic sex of Japanese blimp, comprising detecting the genotype of the genetic sex SNP molecular marker in the intergenic region of ORF2 / Tcb1 described in the first aspect in the genome of the Japanese blimp to be tested, and determining the genetic sex based on the genotype; when the genotype is homozygous for TT, it is determined to be a female fish, and when the genotype is heterozygous for CT, it is determined to be a male fish.

[0016] As a preferred technical solution, the method includes the following steps: using the DNA of the Japanese blister beetle to be tested as a template, performing PCR amplification using the kit of the third aspect of the present invention to obtain PCR amplification products; performing sequencing analysis on the PCR amplification products to determine the genotype of the SNP molecular markers in the genome of the Japanese blister beetle to be tested.

[0017] The DNA from the Japanese blister beetle can be extracted using conventional methods in this technical field, including the phenol-chloroform method and various DNA extraction kits. The PCR amplification reaction program is as follows: pre-denaturation at 90–95°C for 3–5 min; denaturation at 90–95°C for 30–35 s, annealing at 55–60°C for 30–35 s, extension at 70–72°C for 30–40 s, 30–35 cycles; and final extension at 70–72°C for 5–10 min. The PCR amplification reaction system includes 10×PCR Buffer (Mg2+). +The following reagents were prepared: 2–2.5 µl of Plus, 1.6–2 µl of dNTP Mixture (2.5 mM each), 1.2–1.5 µm of forward and reverse primers (5 U), 0.2–0.25 µl of Taq enzyme HS (5 U / µl), 2–2.5 µl of template DNA (<500 ng), and 11.8–12.5 µl of sterile water. The sequencing included sequencing using the Sanger method.

[0018] As preferred technical solutions, methods for detecting the genotype of the ORF2 / Tcb1 intergenic SNP molecular marker in the genome of the Japanese blubber nymph described in the first aspect also include PCR-RFLP (restriction fragment length polymorphism), HRM high-resolution melting curve method (fluorescent qPCR genotyping), allele-specific PCR (AS-PCR), KASP competitive allele-specific PCR (high-throughput fluorescent genotyping), SNaPshot single-base extension genotyping (multiplex SNP universal), high-throughput sequencing genotyping (GBS simplified genome / targeted capture sequencing), and TaqMan fluorescent probe method. These methods are all existing technologies and will not be elaborated further here.

[0019] In a sixth aspect, the invention provides the application of the ORF2 / Tcb1 intergenic sex SNP molecular marker described in the first aspect in the assisted breeding of Japanese blimp.

[0020] Through the above technical solutions, the present invention achieves the following technical effects:

[0021] This invention uses molecular genetics and molecular biology methods to screen and obtain genetic sex SNP molecular markers in the ORF2 / Tcb1 intergenic region that are closely linked to the genetic sex of Japanese blimp. Based on the genotyping results of these markers, it can be clearly determined that Japanese blimps follow an XY sex determination system.

[0022] The ORF2 / Tcb1 intergenic sex SNP locus provided by this invention enables rapid identification of the genetic sex of early-stage Japanese blimps. It is not only applicable to assisted breeding of Japanese blimps in artificial breeding programs, but also provides a core molecular tool for the discovery of sex-determining genes and the elucidation of sex differentiation regulatory mechanisms, possessing significant scientific research value. At the industrial application level, this marker can be used for constructing breeding families and precisely controlling the sex ratio in aquaculture populations, contributing to the improvement of the artificial breeding system for Japanese blimps and promoting the large-scale and sustainable development of its aquaculture industry.

[0023] Compared with traditional methods such as observation of the reproductive opening and identification of the gonads by dissection, the identification method of this invention is highly targeted and can achieve a typing accuracy of 100%. It only requires the collection of a small amount of fish tissue to complete the test, which is minimally invasive to the test individuals and does not require the sacrifice of samples. The overall operation process is simple and the testing cycle is short. It is suitable for screening large batches of samples in hatcheries and is easy to popularize and promote in the aquaculture industry. Attached Figure Description

[0024] Figure 1 The image shows an agarose gel electrophoresis image of the PCR amplification products; lane M is the DL500 marker, and lanes 1-40 represent 40 Japanese blimp samples.

[0025] Figure 2 The images show peak diagrams from the Sanger sequencing method; the top image shows the peak diagram for the TT genotype, and the bottom image shows the peak diagram for the CT genotype. In the images, the arrows indicate SNP sites. Detailed Implementation

[0026] The present invention will now be described in detail with reference to specific embodiments, but this does not limit the scope of the invention. Unless otherwise specified, the materials and reagents used in this embodiment are commercially available.

[0027] Example 1:

[0028] This embodiment provides a genetic sex-specific SNP molecular marker in the ORF2 / Tcb1 intergenic region for use in the genetic sex identification of Japanese blubber nymphs. High-throughput sequencing analysis of female and male Japanese blubber nymphs revealed a single SNP marker between them. This SNP site is located in the ORF2 / Tcb1 intergenic region on chromosome 11 of the Japanese blubber nymph, denoted as SNP11_ORF2 / Tcb1, at position 301 bp of SEQ ID NO:1. Association analysis of this site confirmed its effectiveness as a molecular marker for identifying genetic sex.

[0029] SNP molecular markers are as follows:

[0030] GTTACCTGTCCATTTGAATTTATTCAAGATATTGACTTGTGCAATGCAATTACGTATTGTGGCTTCACTGAGTATTGTGTTGTGCCACTGCACCAGAGTCGTTGTCCACCAGCTGCAGGGTCTGGCCACTGAGCCAGTGGCCAGACTAATTACAAACACGTTGGTTTGAGTCTAAAC ATGAGATTTGTAGAACACGAGACGGATCCTCAAAGTCTCGTTCAGTTTAGTCTTTTGTCCTCAAATGAATCCACTGAATAGTTTCATTTCCTTCAGTGGTCAGGCCGTGTCTCTTCACAC[C / T]GTCCACCCCCTTTGTGAAGTCCTTCTTCTTCTTAGGAGACCTGAACCTC CCCGTGACCAGCCTGCTGTGGTGTCTGGCTGAAAACGCCATCCTTCCTCTATTGTAATCAGACAGGTTTTTCCACAGTGCAACAATGTTGCTTGCCTATGCAGAGAGAACAGCCCATGAGAAGAAGAAAAATAAATCCATGCGTGTGAATATGCATGACATGGCACAAAGGAAAA ATAACAAGACAATGAATGTTTCTCACTGTGTGATTGTCGATGGCCAAGGTGGTCTGGTTCCTCAGCTCCAAGAGGCACTCCGCCAAGGTCTCCACCCTCTCTATTCCCGGCCTGCAAGCGCTATCCACAACCTAAACAAAAATACAGAGATGAGCAACACAACTTGAGAACAGT(SEQ ID NO:1 / SEQ ID NO:2)

[0031] The bolded bases represent SNP sites in the ORF2 / Tcb1 intergenic region. If the site is homozygous (TT genotype), the genetic sex is female; if the site is heterozygous (CT genotype), the genetic sex is male. When the SNP site has a C base, it is SEQ ID NO:1; when the SNP site has a T base, it is SEQ ID NO:2.

[0032] Example 2

[0033] This embodiment provides primer pairs for amplifying the ORF2 / Tcb1 intergenic SNP molecular marker for genetic sex identification in Japanese blubber gnats. Based on the SNP site sequence information, specific primers for detecting this SNP site were designed using Primer Premier 6 primer design software, and the specific sequences are shown in SEQ ID NO:3-4. Specifically:

[0034] Upstream primer F: 5'-TGTAGAACAACACGAGACGGATC-3' (SEQ ID NO:3);

[0035] Downstream primer R: 5'-GCTGAGGAACCAGACCACCTT-3' (SEQ ID NO:4).

[0036] Example 3

[0037] The method for identifying the genetic sex of the Japanese blimp provided in this embodiment includes the following steps:

[0038] (1) Sample DNA extraction

[0039] DNA was extracted from the samples using a marine animal tissue genomic DNA extraction kit, purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number DP324. The specific steps were as follows: 30 mg of muscle tissue from the fish to be tested was minced and placed in a centrifuge tube containing 200 μl of cell lysis buffer (Buffer GA). The tube was vortexed for 15 seconds, then 20 μl of proteinase K (20 mg / ml) solution was added, vortexed to mix, and centrifuged to remove water droplets from the inner wall of the tube cap. Incubate at 56°C until the tissue is completely dissolved. Add 200 μl of binding buffer (Buffer GB), mix thoroughly by inverting, and incubate at 70°C for 10 min until the solution becomes clear. Add 200 μl of anhydrous ethanol, mix thoroughly by inverting, and add the solution and flocculent precipitate from the previous step to an adsorption column CB3. Add 500 μl of protein removal buffer (Buffer GD), centrifuge at 12000 rpm (13400×g) for 30 seconds, discard the waste liquid, and place the adsorption column CB3 into a collection tube. Add 600 μl of wash buffer (Buffer PW) to the adsorption column CB3, centrifuge at 12000 r (13400×g) for 30 seconds, discard the waste liquid, centrifuge at 12000 rpm (13400×g) for 2 min, and discard the waste liquid. Transfer the CB3 adsorption column into a clean centrifuge tube, add 50-200 μl of elution buffer (Buffer TE) to the middle of the adsorption membrane, incubate at room temperature for 2-5 min, centrifuge at 12000 rpm (13400×g) for 2 min, and collect the solution into a centrifuge tube to recover the DNA.

[0040] (2) Amplify sequences containing SNP sites using the following primers.

[0041] Using the primer pairs provided in Example 2, the DNA of the Japanese blister beetle was amplified by PCR. The PCR amplification system was purchased from Baori Biotechnology (Beijing) Co., Ltd., catalog number R007A. The PCR reaction system is shown in Table 1. The nucleotide sequences shown in SEQ ID NO:1 and SEQ ID NO:2 were obtained, which are the sex-specific fragments of the Japanese blister beetle.

[0042] The amplification reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min.

[0043] Table 1. Reaction system for PCR amplification

[0044] (3) Classification determination

[0045] After PCR amplification, the amplification product was detected by 1% agarose gel electrophoresis, yielding a 408 bp fragment (see...). Figure 1 Then, the PCR products are directly sequenced using the Sanger method. The sequencing peaks are examined to determine the genotype of the mutation site. If the site is homozygous (TT genotype), the genetic sex is female; if the site is heterozygous (CT genotype), the genetic sex is male (see...). Figure 2 This proves that the Japanese blister beetle is an XY-type genetic determinant.

[0046] Example 4

[0047] The sex of Japanese blimps was determined using the primer pairs and detection methods for the SNP molecular markers in the ORF2 / Tcb1 intergenic region. 120 Japanese blimps were selected from the Dalian market and tested using the method described in Example 3. Simultaneously, sex was determined by direct observation of the gonads through dissection as a control, to verify whether the ORF2 / Tcb1 intergenic region SNP molecular markers and primers could be used for sex determination in Japanese blimps.

[0048] The results are shown in Table 2. The identification accuracy using the method in Example 3 was 100%, consistent with the results of gonadal sex identification. This indicates that the SNP molecular marker in the ORF2 / Tcb1 intergenic region can rapidly and accurately identify the genetic sex of the Japanese blimp. Specifically, the SNP at position 301 corresponds to the CT genotype in males and the TT genotype in females.

[0049] Table 2. Sex determination results of Japanese blubber blubber

[0050] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings, but the present invention is not limited to these embodiments. Various changes can be made within the scope of knowledge of those skilled in the art, as long as they do not depart from the spirit of the present invention. Furthermore, the various embodiments and features of the present invention can be arbitrarily combined without conflict.

Claims

1. A molecular marker for inherited sex-specific SNPs in the ORF2 / Tcb1 intergenic region of the Japanese blubber eagle, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:1 or SEQ ID NO:

2. The SNP site is located at position 301 from the 5' end of the sequence, and this site exhibits C / T single nucleotide polymorphism.

2. A primer set for amplifying the SNP molecular marker as described in claim 1, characterized in that, The primer set includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

4.

3. A kit for identifying the genetic sex of the Japanese blubber smelt, characterized in that, The kit includes the primer set as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes reagents for the PCR amplification reaction system.

5. A method for identifying the genetic sex of the Japanese blubber shrike, characterized in that, The genotype of the SNP molecular markers as described in claim 1 in the genome of the Japanese blimp is detected, and the genetic sex is determined based on the genotype; when the genotype is homozygous for TT, it is determined to be a female fish, and when the genotype is heterozygous for CT, it is determined to be a male fish.

6. The method according to claim 5, characterized in that, The method for detecting the genotype of SNP molecular markers includes the following steps: using the DNA of the Japanese blister beetle as a template, performing PCR amplification using the primer set described in claim 2 or the kit described in claim 3, obtaining PCR amplification products, and determining the genotype of the SNP molecular marker.

7. The method according to claim 6, characterized in that, The method for determining the genotype of SNP molecular markers is Sanger sequencing.

8. The application of the SNP molecular marker as described in claim 1 in identifying the genetic sex of the Japanese blimp.

9. The application of the SNP molecular marker as described in claim 1 in the assisted breeding of Japanese blimp.

Images