Compositions, kits and methods for detecting mycobacterium tuberculosis using specific primers and probes

Abstract

The application provides a composition of specific primers and probes for detecting Mycobacterium tuberculosis, a kit and a method thereof. The composition of specific primers and probes for detecting Mycobacterium tuberculosis comprises a forward primer, a reverse primer and a probe, the nucleotide sequence of the forward primer is shown in SEQ ID No. 1, the nucleotide sequence of the reverse primer is shown in SEQ ID No. 2, and the nucleotide sequence of the probe is shown in SEQ ID No. 7; the forward primer and the reverse primer are degenerate primers. The primer and probe composition has good universality and can effectively detect the presence of Mycobacterium tuberculosis, and provides a fluorescent quantitative PCR detection method with high sensitivity for Mycobacterium tuberculosis.

Description

Technical Field

[0001] This invention relates to the field of medical testing, and more specifically to compositions, kits and methods for detecting specific primers and probes for Mycobacterium tuberculosis. Background Technology

[0002] Tuberculosis (TB) is a significant public health problem, caused by the Mycobacterium tuberculosis complex. Therefore, there is a substantial clinical need for TB testing, and sensitive detection and accurate diagnosis are crucial aspects of TB prevention and control.

[0003] Genomic DNA testing of Mycobacterium tuberculosis, often referred to as molecular testing for tuberculosis, is characterized by high sensitivity and specificity, making it suitable for rapid screening, auxiliary diagnosis, and efficacy evaluation. Samples are typically sputum, bronchoalveolar lavage fluid, or tissue specimens, and results must be interpreted in conjunction with clinical manifestations and other examinations. This method is fast, providing results on the same day, making it particularly suitable for acute and severe cases or those requiring early isolation; it is highly sensitive, detecting cases with negative sputum smears but actual infection (e.g., bacterial count <1000 CFU / mL), reducing the risk of missed diagnoses; and it is highly specific, targeting only the nucleic acid sequence of Mycobacterium tuberculosis, avoiding cross-reactivity with non-tuberculous mycobacteria; its application is broad, including suspected tuberculosis cases with negative smears / cultures, patients for whom qualified sputum samples cannot be obtained, surveillance, and screening of high-risk groups.

[0004] Currently, the targets for tuberculosis DNA detection are usually high-copy genomic insertion sequences in Mycobacterium tuberculosis, i.e., repetitive DNA sequences, to improve detection sensitivity. The most commonly used sequences are IS6110 and IS1081. IS6110 is a naturally occurring transposon sequence capable of self-replication, belonging to the IS3 family, and typically presents with 8-20 copies, although zero copies can also occur. IS1081 was first discovered in Mycobacterium bovis, belonging to the IS256 family, and typically presents with 5-7 copies; in Mycobacterium tuberculosis humans, the copy number is only 6, and some strains also have deletions. Therefore, clinical tuberculosis diagnostic kits typically use primers targeting IS6110 for quantitative PCR detection. Some companies have also designed kits that simultaneously detect IS6110 and IS1081 to improve sensitivity and detection rate; for example, the widely used Cepert Xpert MTB / RIF Ultra tuberculosis detection kit targets both IS6110 and IS1081. However, because some strains contain both IS6110 and IS1081, the results of gene detection targeting these two inserted sequences still need improvement. Furthermore, the detection efficiency of quantitative PCR, upon which gene detection relies, is also affected by other factors, such as primer and probe design, annealing temperature, primer concentration in the reaction system, and template quality. Therefore, developing a more specific and sensitive method for detecting Mycobacterium tuberculosis is crucial. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide a composition, kit, and method for detecting specific primers and probes for Mycobacterium tuberculosis. The primer and probe composition in this method has good versatility and, when combined with conventional or real-time quantitative PCR technology, can rapidly and effectively detect the presence of Mycobacterium tuberculosis with high sensitivity.

[0006] This invention, through the analysis of more than 500 whole genomes worldwide, discovered a new family of high-copy insertion sequences in the Mycobacterium tuberculosis genome, IS607, which does not contain deletions. A quantitative PCR system was designed targeting the IS607 family target sequences to improve the detection efficiency of Mycobacterium tuberculosis DNA, thereby enabling rapid and effective detection of tuberculosis.

[0007] To achieve the above objectives, the present invention provides a composition of specific primers and probes for detecting Mycobacterium tuberculosis, comprising a forward primer, a reverse primer, and a probe, wherein the nucleotide sequence of the forward primer is shown in SEQ ID No. 1, the nucleotide sequence of the reverse primer is shown in SEQ ID No. 2, and the nucleotide sequence of the probe is shown in SEQ ID No. 7;

[0008] The forward and reverse primers are degenerate primers;

[0009] The nucleotide sequences of the forward and reverse primers contain degenerate bases, where K indicates that the bases at that position are equal in proportion to G and T, S indicates that the bases at that position are equal in proportion to G and C, and R indicates that the bases at that position are equal in proportion to A and G.

[0010] In the above composition, preferably, the fluorescent group labeled at the 5' end of the probe is selected from one of FAM, HEX, VIC, CY5, TET, and NED, and the quenching group labeled at the 3' end of the probe is selected from one of TAMRA, MGB, and BHQ.

[0011] In the above composition, preferably, the target site of the forward and reverse primers is IS607.

[0012] According to specific embodiments of the present invention, the forward and reverse primers can be used not only for universal real-time PCR detection of Mycobacterium tuberculosis, but also for conventional PCR and subsequent agarose electrophoresis to obtain results, as well as for quantitative PCR detection using molecular beacon methods, etc.

[0013] The present invention also provides a kit for detecting Mycobacterium tuberculosis, comprising the above-described composition.

[0014] Preferably, the kit described above also includes a Tag PCR Mix.

[0015] The present invention also provides a method for detecting Mycobacterium tuberculosis for non-disease diagnostic purposes, wherein the detection method uses the above-described composition or the above-described kit to perform real-time quantitative PCR amplification using total DNA and / or free DNA of the sample to be tested as a template.

[0016] According to a specific embodiment of the present invention, the reaction conditions for the real-time PCR amplification are: 95℃ pre-denaturation for 30s; 95℃ denaturation for 15s, 60℃ annealing for 30s, for 40 cycles.

[0017] According to a specific embodiment of the present invention, the reaction system for the real-time PCR amplification is 20 μL in total volume, including: 10 μL of 2×Tag PCR Mix, 0.75 μL each of forward and reverse primers, 0.5 μL of probe, 3 μL of DNA from the sample to be tested, and ultrapure water to a final volume of 20 μL.

[0018] According to a specific embodiment of the present invention, the sample to be tested includes one or more of the following: sputum, bronchoalveolar lavage fluid, cerebrospinal fluid, pus, serous cavity effusion, and blood; preferably, the blood is plasma.

[0019] According to a specific embodiment of the present invention, the detection method is further used in conjunction with forward primers, reverse primers and probes for detecting IS6110 and / or IS1081;

[0020] The nucleotide sequence of the forward primer of IS6110 is shown in SEQ ID No. 12;

[0021] The nucleotide sequence of the reverse primer of IS6110 is shown in SEQ ID No. 13;

[0022] The nucleotide sequence of the probe of IS6110 is shown in SEQ ID No. 14;

[0023] The nucleotide sequence of the forward primer of IS1081 is shown in SEQ ID No. 15;

[0024] The nucleotide sequence of the reverse primer of IS1081 is shown in SEQ ID No. 16;

[0025] The nucleotide sequence of the probe of IS1081 is shown in SEQ ID No. 17.

[0026] The present invention also provides the use of the above-described composition or the above-described kit in the preparation of a detection reagent for detecting Mycobacterium tuberculosis.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] This invention analyzes 525 Mycobacterium tuberculosis whole genome insertion sequences and discovers the IS607 family, which does not have deletions. Based on the conserved sequences of the IS607 family, degenerate primers and Taqman probes are designed to compensate for the situation where tuberculosis genomic DNA cannot be detected in samples due to the deletion of IS6110 and IS1081, thus preventing missed detections and improving the positive detection rate of Mycobacterium tuberculosis.

[0029] Mycobacterium tuberculosis contains 5-6 IS607 family insertion sequences. Using the degenerate primers of this invention, the genomic DNA of Mycobacterium tuberculosis in a sample can be detected more sensitively than using a single-copy gene sequence.

[0030] This invention eliminates the need to wait 4-8 weeks for test results, saving time; it requires no expensive large-scale instruments, nor special antibodies or fluorescent reagents, only a common PCR instrument and its reagents are needed to conduct experiments, and the test results are simple, clear, easy to interpret, and have a high positive rate.

[0031] This invention can be applied to the detection of Mycobacterium tuberculosis somatic DNA in sputum and Mycobacterium tuberculosis cell-free DNA (cfDNA) in plasma samples, which is of greater significance for the study of Mycobacterium tuberculosis infection in asymptomatic or non-sputum patients. Attached Figure Description

[0032] Figure 1 The CT values ​​of H37Rv genomic DNA amplified by real-time PCR using three sets of degenerate primers and probes are given.

[0033] Figure 2 This is the sensitivity amplification curve for Example 3.

[0034] Figure 3 This is a specific amplification curve for Example 3.

[0035] Figure 4 This is an agarose gel electrophoresis image of the amplified products of three sets of degenerate primers and probes for quantitative real-time PCR. Detailed Implementation

[0036] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0037] It should be noted that, unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0038] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0039] It should be understood that the terms “comprising,” “including,” and / or “containing” as used herein specify the presence of the stated features, integers, steps, components, or combinations thereof, but do not exclude the presence or addition of one or more other features, integers, steps, components, or combinations thereof.

[0040] The endpoints and any values ​​of the ranges disclosed in this invention are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this invention.

[0041] Example 1:

[0042] This embodiment provides a primer set and probes for detecting Mycobacterium tuberculosis using real-time quantitative PCR. The detection efficiency of real-time quantitative PCR is improved by designing and screening highly sensitive and specific primer and probe sequences, and by setting an efficient PCR cycling reaction program. This embodiment designs three sets of specific degenerate primers and detection probes targeting conserved sequence regions of the IS607 family. Through experiments, a set of highly sensitive and specific primer and probe sequences was selected. A special and efficient real-time quantitative PCR cycling reaction system was set up for this set of sequences to achieve sensitive Mtb-DNA real-time quantitative PCR detection.

[0043] The degenerate primer set and probe for high-sensitivity PCR detection of Mycobacterium tuberculosis have the following nucleotide sequences, and three primer-probe combinations were designed: IS607-1, IS607-2, and IS607-3.

[0044] IS607-1 F: 5'GCKTSGATRTCGGCTTTCA3' (SEQ ID No.1),

[0045] IS607-1 R: 5'TGGCRCGGCATTTCGG3' (SEQ ID No.2),

[0046] IS607-2 F: 5'ACCCGCACACTSGCATC3' (SEQ ID No.3),

[0047] IS607-2 R: 5'CAYGAGAACACVGCCG3' (SEQ ID No.4),

[0048] IS607-3 F: 5'CTGCCAGTTCCAGTACGC3' (SEQ ID No.5),

[0049] IS607-3 R: 5'GYGTGGTGGCCKGAAT3' (SEQ ID No.6),

[0050] Among them, K=G / T, S=G / C, R=A / G, Y=C / T, K=G / T, V=A / C / G.

[0051] Or it could be a complementary nucleotide sequence of these sequences.

[0052] Probe sequence:

[0053] IS607-1 Probe: 5'CGCCGCAAGGCCTACAACTGG3' (SEQ ID No.7),

[0054] IS607-2 Probe: 5'CCGTTGCGGCGCACCG3' (SEQ ID No.8),

[0055] IS607-3 Probe: 5'CGAAAGAGGCCTACGCCGA3' (SEQ ID No.9),

[0056] Or it could be a complementary nucleotide sequence of these sequences.

[0057] The IS607 family includes IS1536, IS1537, IS1538 and IS1602, whose sequences are shown as SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 and SEQ ID No. 13, respectively.

[0058] IS1536 (SEQ ID No. 10):

[0059]

[0060] IS1537(SEQ ID No.11):

[0061]

[0062] IS1538(SEQ ID No.12):

[0063]

[0064] IS1602(SEQ ID No.13):

[0065]

[0066] Example 2:

[0067] This embodiment provides a real-time quantitative PCR method for detecting Mycobacterium tuberculosis. The PCR amplification system is as follows, where 2×TagPCR Mix is ​​a commercially available PCR premix (in this embodiment, 2×qPCR TaqMan Probe MasterMix), whose main components include Tag enzyme, dNTPs, magnesium ions, and buffer. The reaction system is shown in Table 1.

[0068] Table 1

[0069]

[0070] The PCR amplification procedure is shown in Table 2:

[0071] Table 2

[0072]

[0073] Result Interpretation Criteria: The instrument collects the fluorescently labeled probe signal, which is then processed by software to present an amplification curve of the fluorescence channel. A positive result is defined as the appearance of an amplification curve with an upward trend in the fluorescence curve. The criteria for judging strong positive and weak positive results are based on a Ct value of 35. For strong positive results (Ct<35), one test is sufficient to indicate a positive result for the nucleic acid of this strain; for weak positive results (Ct>35), a retest is required. If the retest result is positive, it is considered positive. If the retest result is negative, the result needs to be interpreted by a doctor in conjunction with clinical symptoms.

[0074] Example 3:

[0075] This embodiment provides the screening and performance verification of optimal degenerate primer pairs and probes. Details are as follows:

[0076] 1. Screening of optimal degenerate primer pairs and probes

[0077] Genomic DNA was extracted from the inactivated bacterial culture of H37Rv standard strain (ATCC 27294) using a bacterial genome extraction kit. The DNA concentration was measured to obtain qualified H37Rv genomic DNA. Using the H37Rv genomic DNA as a template, three primer pairs (IS607-1, IS607-2, and IS607-3) and probes were validated. The optimal degenerate primer pairs and probes were selected by comparing CT values.

[0078] The CT values ​​of H37Rv genomic DNA amplified by three sets of degenerate primers and probes using quantitative real-time PCR are as follows: Figure 1As shown, IS607-1 consists of the IS607 degenerate primer set SEQ ID No. 1 and SEQ ID No. 2, and the probe SEQ ID No. 7; IS607-2 consists of the IS607 degenerate primer set SEQ ID No. 3 and SEQ ID No. 4, and the probe SEQ ID No. 8; IS607-3 consists of the IS607 degenerate primer set SEQ ID No. 5 and SEQ ID No. 6, and the probe SEQ ID No. 9. The results show that IS607-1 has the lowest Ct value and the highest detection sensitivity, making it the optimal degenerate primer pair and probe.

[0079] 2. Sensitivity Test

[0080] After calculating the H37Rv genomic DNA, the nucleic acid was diluted sequentially to 10 μL with nuclease-free pure water. 7 -10 2 copies / µL. The reaction solution was prepared according to the amplification system in Example 2. The amplification program in Example 2 was used as the reaction conditions. The optimal degenerate primer and probe combination IS607-1 (SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 7) was selected. The diluted nucleic acid was used as a template. 3 µL of template was taken from each reaction well for amplification. The sensitivity was determined by the amplification curve.

[0081] The sensitivity amplification curve of Example 3 is shown below. Figure 2 As shown, where 1:10 7 copies / µL, 2:10 6 copies / µL, 3:10 5 copies / µL, 4:10 4 copies / µL, 5:10 3 copies / µL, 6:10 2 The results show that the lowest template copy number detectable by IS607-1 is 10^12 copies / µL. 2 copies / µL.

[0082] 3. Specificity test

[0083] Using H37Rv genomic DNA, Mycobacterium kansasense genomic DNA, Mycobacterium avium genomic DNA, Mycobacterium intracellulare genomic DNA, Mycobacterium praecox, and Mycobacterium Gordon's genomic DNA as templates, reaction solutions were prepared according to the amplification system in Example 2, and the amplification program in Example 2 was used as the reaction conditions. The optimal degenerate primer and probe combination IS607-1 (SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 7) selected after screening was used. Diluted nucleic acids were used as templates, and 3 μL of template was loaded into each reaction well for amplification. Specificity was determined by amplification curves.

[0084] The specific amplification curve of Example 3 is shown below. Figure 3 As shown, 1: H37Rv genomic DNA, 2: Mycobacterium Kansas genomic DNA, 3: Mycobacterium avium genomic DNA, 4: Mycobacterium intracellulare genomic DNA, 5: Mycobacterium praecoxibii genomic DNA, and 6: Mycobacterium Gordonii genomic DNA. The results indicate that the optimal degenerate primer and probe combination IS607-1 (SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 7) after screening exhibits high specificity and will not cause non-specific amplification of DNA templates that are not Mycobacterium tuberculosis.

[0085] 4. Electrophoresis detection of real-time PCR products

[0086] The amplified DNA fragments were detected by 2% agarose gel electrophoresis. Electrophoresis was performed at 100V for 40 minutes. The presence and size of the PCR products can be used to determine whether primer dimers and non-specific amplification were generated.

[0087] The agarose gel electrophoresis images of the amplified products from three sets of degenerate primers and probes for quantitative PCR are shown below. Figure 4 As shown, M: Marker; 1: IS607 degenerate primers SEQ ID No. 1, SEQ ID No. 2, probe SEQ ID No. 7; 2: IS607 degenerate primers SEQ ID No. 3, SEQ ID No. 4, probe SEQ ID No. 8; 3: IS607 degenerate primers SEQ ID No. 5, SEQ ID No. 6, probe SEQ ID No. 9. The results show that the products of IS607-1, IS607-2, and IS607-3 are all specific amplification products, with no primer dimers or non-specific amplifications produced.

[0088] 5. Comparison of sensitivity and specificity results of combined detection of IS607 with IS6110 and / or IS1081 targets, detection of IS6110 and / or IS1081 targets alone, and detection of IS607 alone.

[0089] The above method was used to test 139 clinical samples, including 109 patients with Mycobacterium tuberculosis, of which 70 were etiologically confirmed, 39 were clinically diagnosed, and 30 were healthy controls.

[0090] Using primer and probe combinations:

[0091] IS607-1: SEQ ID No.1, SEQ ID No.2, SEQ ID No.7;

[0092] IS6110:

[0093] F (SEQ ID No. 14): 5'GGATCCTGCGACGTAGGC3';

[0094] R (SEQ ID No. 15): 5'GCAGACCTCACCTATGTGTCG3';

[0095] Probe (SEQ ID No.16):5'ACAAAGGCCACGTAGGCGAACCCTGCC5');

[0096] IS1081:

[0097] F (SEQ ID No. 17): 5'ACCTTGATCGCCACCGG3';

[0098] R (SEQ ID No. 18): 5'GTCCTCGGCGGAGGTGAC3';

[0099] Probe (SEQ ID No. 19): 5'AACGCCGAGGGCTACCGAGAGAT3').

[0100] The detection sensitivity and specificity of IS607, IS6110, IS1081, IS607+IS6110, IS607+IS1081 and IS607+IS6110+IS1081 are shown in Table 3.

[0101] Table 3

[0102]

[0103] The results show that although the sensitivity of the present invention in detecting IS607 using IS607-1 is not as high as that of IS6110 and IS1081, it has higher sensitivity when used in combination with IS6110 and IS1081, supplementing some samples that could not be detected due to the absence of IS6110 and IS1081.

[0104] 6. Comparison of sensitivity and specificity results for detecting IS607 using degenerate primers and for detecting other non-IS element targets such as rpoB.

[0105] The above method was used to test 139 clinical samples, including 109 patients with Mycobacterium tuberculosis, of which 70 were etiologically confirmed, 39 were clinically diagnosed, and 30 were healthy controls.

[0106] Using primer and probe combinations:

[0107] IS607-1: SEQ ID No.1, SEQ ID No.2, SEQ ID No.7;

[0108] rpoB:

[0109] F (SEQ ID No. 20): 5'ATGGACCAGAACAACCCGC3';

[0110] R (SEQ ID No. 21): 5'GGCACGCTCACGTGACAG3';

[0111] Probe (SEQ ID No. 22): 5'CGACTGTCGGCGC3').

[0112] The detection sensitivity and specificity of IS607 and rpoB are shown in Table 4.

[0113] Table 4

[0114]

[0115] The results showed that the detection sensitivity of this invention, targeting IS607, was higher than that of targeting the non-IS element rpoB, exhibiting characteristics such as high sensitivity, good specificity, and rapid detection of Mycobacterium tuberculosis. Furthermore, the quantitative real-time PCR detection method for Mycobacterium tuberculosis reduces the workload and cost of clinical sample testing, demonstrating potential application value.

[0116] The above embodiments illustrate and describe the main features and advantages of the present invention in detail. However, the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention. All such equivalent modifications or substitutions are included within the scope defined by the claims of this application.

Claims

1. A composition of specific primers and probes for detecting Mycobacterium tuberculosis, comprising a forward primer, a reverse primer, and a probe, wherein, The nucleotide sequence of the forward primer is shown in SEQ ID No. 1, the nucleotide sequence of the reverse primer is shown in SEQ ID No. 2, and the nucleotide sequence of the probe is shown in SEQ ID No.

7. The forward and reverse primers are degenerate primers; The nucleotide sequences of the forward and reverse primers contain degenerate bases, where K indicates that the bases at that position are equal in proportion to G and T, S indicates that the bases at that position are equal in proportion to G and C, and R indicates that the bases at that position are equal in proportion to A and G.

2. The composition according to claim 1, wherein, The fluorescent group labeled at the 5' end of the probe is selected from one of FAM, HEX, VIC, CY5, TET, and NED, and the quenching group labeled at the 3' end of the probe is selected from one of TAMRA, MGB, and BHQ.

3. The composition according to claim 1, wherein, The target site of the forward and reverse primers is IS607.

4. A kit for detecting Mycobacterium tuberculosis, comprising the composition according to any one of claims 1-3.

5. The kit according to claim 4, wherein, The kit also includes Tag PCR Mix.

6. A method for detecting Mycobacterium tuberculosis for non-disease diagnostic purposes, wherein, The detection method uses the composition as described in any one of claims 1-3 or the kit as described in claim 4 or 5 to perform quantitative real-time PCR amplification using total DNA and / or free DNA of the sample to be tested as a template.

7. The detection method according to claim 6, wherein, The reaction conditions for the quantitative real-time PCR amplification were: 95℃ pre-denaturation for 30s; 95℃ denaturation for 15s; 60℃ annealing for 30s; 40 cycles.

8. The detection method according to claim 6, wherein, The samples to be tested include one or more of the following: sputum, bronchoalveolar lavage fluid, cerebrospinal fluid, pus, serous cavity effusion, and blood.

9. The detection method according to claim 6, wherein, The detection method is also used in conjunction with forward primers, reverse primers and probes for detecting IS6110 and / or IS1081; The nucleotide sequence of the forward primer of IS6110 is shown in SEQ ID No. 12; The nucleotide sequence of the reverse primer of IS6110 is shown in SEQ ID No. 13; The nucleotide sequence of the probe of IS6110 is shown in SEQ ID No. 14; The nucleotide sequence of the forward primer of IS1081 is shown in SEQ ID No. 15; The nucleotide sequence of the reverse primer of IS1081 is shown in SEQ ID No. 16; The nucleotide sequence of the probe of IS1081 is shown in SEQ ID No.

17.

10. The use of the composition according to any one of claims 1-3 or the kit according to claim 4 or 5 in the preparation of a diagnostic reagent for detecting Mycobacterium tuberculosis.

Images