A light-controlled rpa-cr ispr / cas12a detection kit for klebsiella pneumoniae detection and application thereof

Abstract

The present application relates to a kind of RPA detection kit for klebsiella pneumoniae and its application, adopt light control CRISPR / Cas12a technology and recombination enzyme polymerase amplification (RPA) are combined, provide a kind of fast, sensitive, efficient klebsiella pneumoniae detection method.The method is by designing specific RPA primer, combined with light control cage CRISPR / Cas12a system, realize the accurate identification of klebsiella pneumoniae rcsA gene, and in ultraviolet irradiation is removed cage crRNA inhibition, to trigger Cas12a cutting activity, so that the detection result is shown by fluorescence signal.This system not only improves sensitivity, and have good specificity, can effectively distinguish klebsiella pneumoniae and other common pathogens, suitable for clinical detection, laboratory detection and on-site rapid detection.Through the optimization of experimental conditions, including amplification time, primer concentration, irradiation time and other factors, the present application provides a kind of simple and highly operable detection method, can realize sensitive, specific pathogen identification in clinical sample, with wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, specifically a light-controlled CRISPR / Cas12a recombinase polymerase amplification (RPA) detection kit for the rapid detection of Klebsiella pneumoniae. This kit combines RPA amplification technology with the CRISPR / Cas12a system, activating caged CRISPR RNA (crRNA) under ultraviolet light to trigger a specific cleavage reaction of the Cas12a nuclease, thereby achieving highly sensitive and specific molecular detection. This technology is rapid, simple, and low-cost, and can be widely used for rapid diagnosis of pathogenic microorganisms in clinical settings. Background Technology

[0002] Klebsiella pneumoniae ( Klebsiella pneumoniae Klebsiella pneumoniae is an important pathogen causing hospital-associated infections, widely distributed in the respiratory tract, urinary tract, and other sites, and can cause pneumonia, urinary tract infections, and a variety of other infections. Especially in immunocompromised patients, Klebsiella pneumoniae infection can easily lead to serious complications and even threaten life. Therefore, early and accurate diagnosis of Klebsiella pneumoniae infection is of great significance for timely treatment and improving patient survival rates.

[0003] Currently, detection methods for Klebsiella pneumoniae mainly include traditional culture methods, PCR technology, and immunochromatography. Although PCR technology has significant advantages in sensitivity and specificity, its operation is complex, time-consuming, and requires sophisticated equipment, failing to meet the needs of rapid clinical diagnosis. While immunochromatography is simple to operate, its sensitivity is low, unable to provide effective detection at low concentrations of the strain or in early-stage infections. In recent years, the emergence of CRISPR / Cas technology has provided new ideas for the rapid detection of pathogenic microorganisms. In particular, CRISPR / Cas12a nucleases can achieve highly sensitive detection by recognizing specific target sequences and cleaving reporter molecules. However, existing CRISPR / Cas12a detection technologies mostly rely on complex reagents and operations, and often require sophisticated equipment.

[0004] To address the aforementioned issues, this invention provides a one-tube detection method combining RPA amplification technology with a light-controlled CRISPR / Cas12a system. This method enables sensitive detection of Klebsiella pneumoniae in a short time, is simple to operate, requires minimal equipment, and exhibits strong anti-interference capabilities. By introducing a light-controlled mechanism into the CRISPR / Cas12a reaction system, ultraviolet light is used to activate caged crRNA, thereby triggering a specific cleavage reaction of Cas12a. This further improves the sensitivity and specificity of the detection, ensuring accurate identification of Klebsiella pneumoniae DNA in complex clinical samples. Summary of the Invention

[0005] This invention aims to address the following problems existing in Klebsiella pneumoniae detection methods: time-consuming detection process, complex operation, insufficient specificity and sensitivity, and uncontrollable reaction. To this end, this invention provides a light-controlled one-tube RPA-CRISPR / Cas12a detection kit and its detection method, which enables rapid, accurate, and controllable detection of Klebsiella pneumoniae, and has the advantages of simplicity, sensitivity, and high specificity.

[0006] To achieve this objective, the present invention provides the following technical solution: Technical solution 1. RPA Primer Design: RPA primers were designed specifically for the rcsA gene of Klebsiella pneumoniae. The optimal primer pair, rcsA Pair3, was determined through screening. This primer pair is used to amplify a 150-300 bp fragment of the rcsA gene, providing an accurate target for subsequent CRISPR / Cas12a detection.

[0007] 2. Cage-like crRNA design: crRNA1 was designed based on the PAM site (TTTN) in the amplified region of the rcsA gene, with the sequence UAAUUUCUACUAAGUGUAGAUCUCAGUGACAAUGUCGGUAA (41 nt). Three 6-nitrocapsaicinoxymethyl thymidines (NPOM-dT) were inserted into the spacer region to construct a controllable cage-like crRNA. Its activity was inhibited under light-free conditions and restored after UV irradiation.

[0008] 3. Light-controlled CRISPR / Cas12a system: This system combines CRISPR / Cas12a with photosensitive modified caged crRNA binding to the Cas12a protein. UV light activates the caged crRNA, triggering the Cas12a nuclease to specifically cleave the target DNA. Once activated, Cas12a trans-cleaves the reporter molecule, separating the fluorophore from the quencher and generating a fluorescent signal for sensitive detection.

[0009] 4. Reporter molecule: The FAM-BHQ1-labeled ssDNA probe (sequence 5'-FAM-TTATT-BHQ1-3') is used as the reporter molecule. After Cas12a is activated, it will cleave the probe and release a fluorescent signal to monitor the reaction process in real time.

[0010] 5. Reaction System: The reaction system provided by this invention consists of RPA amplification buffer, CRISPR reaction buffer, magnesium ion solution, Cas12a protein, caged crRNA, and reporter molecules, etc. All components are processed in one reaction tube, which simplifies the operation steps and facilitates rapid on-site detection.

[0011] The core components of the detection kit of the present invention RPA primer pair: targeting Klebsiella pneumoniae rcsA Genetically engineered RPA primer pairs rcsA Pair3 include: Forward primer (F): TAACCCCAAAAGACCTTGATGTTATTC (27 bp); Reverse primer (R): TCACCTGCTTATTATGCGTTTGTATTT (27 bp) Cage-type crRNA: crRNA1 was designed based on the PAM site (TTTN) in the rcsA Pair3 amplification region, with the sequence UAAUUUCUACUAAGUGUAGAUCUCAGUGACAAUGUCGGUAA (41 nt). A regulated cage-type crRNA was constructed by embedding three NPOM-dT modifications in the spacer region.

[0012] Cas12a protein: possesses RNA-mediated DNA-specific recognition and trans-cleavage activity of single-stranded DNA.

[0013] Reporter molecule: FAM-BHQ1-labeled ssDNA probe with the sequence 5'-FAM-TTATT-BHQ1-3' (5 nt). The probe is cleaved upon activation by Cas12a, releasing a fluorescent signal.

[0014] Auxiliary reagents: RPA reaction buffer: containing 2×RPA buffer and enzyme-free water; CRISPR reaction buffer: 10×NEBuffer; Magnesium ion solution: used to initiate the RPA amplification reaction; Positive control: genomic DNA of standard strain of Klebsiella pneumoniae; Negative control: enzyme-free water.

[0015] Detection method steps 1. Sample DNA extraction: Genomic DNA is extracted from the sample to be tested (such as clinical strains, specimens or environmental samples) using a commercial DNA extraction kit.

[0016] 2. Reaction system preparation: Prepare a 17 μL reaction system in a PCR tube, with the following components: Table 1 Components of the reaction system 3. Sample addition: Add 2 μL of the DNA to be tested (or positive / negative control DNA) to the reaction system and mix gently.

[0017] 4. RPA amplification: Incubate the reaction tube in a 37°C constant temperature device for 20 minutes to perform RPA isothermal amplification.

[0018] 5. Photoactivation: Irradiate the reaction tube with 365 nm ultraviolet light for 30 seconds to activate the activity of caged crRNA.

[0019] 6. Fluorescence detection: Continue incubation at 37°C for 30 minutes, and collect fluorescence signals in real time using a fluorescence detector (once per minute).

[0020] 7. Result Interpretation: If the fluorescence signal is significantly enhanced (fluorescence threshold ≥2710 RFU), it is judged as positive for Klebsiella pneumoniae; if the fluorescence signal is not significantly different from the negative control, it is judged as negative.

[0021] Optimization of reaction conditions This invention ensures detection performance by optimizing the following reaction conditions: RPA amplification optimization: The amplification efficiency and fluorescence signal intensity are optimal when the primer concentration is 400 nM and the amplification time is 20 minutes.

[0022] Optical control CRISPR / Cas12a optimization: The highest specific cleavage efficiency was achieved when the caged crRNA concentration was 300 nM and the Cas12a protein concentration was 300 nM.

[0023] Photoactivation optimization: Irradiation with 365nm ultraviolet light for 30 seconds completely activated caged crRNA with no obvious non-specific activation.

[0024] This invention, by combining RPA amplification technology with a light-controlled CRISPR / Cas12a system, not only improves the sensitivity and specificity of detection, but also simplifies the operation process and reduces equipment requirements, making it widely applicable in clinical settings, especially suitable for the rapid diagnosis of Klebsiella pneumoniae. Attached Figure Description

[0025] Figure 1 This is a schematic diagram showing the results of RPA primer screening and specificity verification. Among them, Figure 1 A represents the electrophoresis results of amplification products using different RPA primer pairs; Figure 1 B represents the specificity verification electrophoresis results of the preferred primer pair (rcsA Pair3) under different template conditions; where M is the molecular weight marker and NC is the negative control.

[0026] Figure 2 This is a schematic diagram illustrating the construction and feasibility verification results of a light-controlled single-tube RPA-CRISPR / Cas12a detection system. Among them, Figure 2 A represents the fluorescence detection curves under different crRNA conditions; Figure 2 B represents the comparison of fluorescence signals at the corresponding endpoint; Figure 2 C represents the fluorescence detection result under conditions where the key reaction components of the system are missing; Figure 2 D is the gel electrophoresis analysis diagram of the corresponding amplification / cutting results; Figure 2 E represents the corresponding fluorescence imaging result; where M is the molecular weight marker and NC is the negative control.

[0027] Figure 3 This diagram illustrates the reaction results of a light-controlled one-tube RPA-CRISPR / Cas12a detection system under different illumination conditions. Figure 3 A represents the fluorescence detection curves under different illumination conditions; Figure 3 B represents the fluorescence imaging results after the reaction is complete; Figure 3 C represents the gel imaging result after the reaction is complete; where M is the molecular weight marker.

[0028] Figure 4 This is a schematic diagram showing the parameter optimization results of a light-controlled single-tube RPA-CRISPR / Cas12a detection system. Among them, Figure 4 A, Figure 4 C represents a comparison of detection results under different amplification times and primer concentrations; Figure 4 B shows a comparison of test results under different ultraviolet irradiation time conditions; Figure 4 D、 Figure 4 E represents a comparison of detection results under different Cas12a protein concentrations and different caged crRNA concentrations; NC represents the negative control.

[0029] Figure 5 This is a schematic diagram illustrating the sensitivity and specificity evaluation results of the light-controlled single-tube RPA-CRISPR / Cas12a detection system. Among them, Figure 5 A represents the sensitivity detection results under gradient dilution conditions of Klebsiella pneumoniae genomic DNA; Figure 5 B represents the specific detection results under different pathogen template conditions; NC represents the negative control.

[0030] Figure 6 This is a schematic diagram illustrating the results of clinical sample testing and control validation. Among them, Figure 6 A represents the electrophoresis results of the clinical sample identification using the control method (PCR); Figure 6 B. Figure 6 C represents the detection results of the detection system of this invention on clinical samples; where NC is the negative control and S1–S50 are the clinical sample numbers.

[0031] Figure 7 This is a schematic diagram of the receiver operating characteristic (ROC) curve of the detection system of the present invention, used to characterize the detection performance.

[0032] Figure 8 This is a schematic diagram of the results of the temperature effect study, used to characterize the consistency of the detection results of the detection system of the present invention under different operating temperature conditions.

[0033] Figure 9This diagram illustrates the environmental impact study results of the positive control aliquot, used to characterize the comparison of the detection results of the detection system of this invention before and after environmental decontamination treatment.

[0034] Figure 10 This is a schematic diagram of the anti-interference experiment results, used to characterize the comparison of the detection results of the detection system of the present invention under different interference template conditions.

[0035] Figure 11 This is a schematic diagram comparing the impact of primers from different sources on the detection results. Among them, Figure 11 A shows a comparison of fluorescence detection results; Figure 11 B shows a comparison of the electrophoresis results of the amplification products. Detailed Implementation

[0036] It should be understood that the following embodiments are used to illustrate the technical solution of the present invention and its feasibility, and are not intended to limit the scope of protection of the present invention. Those skilled in the art can make conventional and equivalent substitutions or changes to the total reaction volume, concentration of each component, incubation time, light conditions, and detection equipment without departing from the concept of the present invention, and all such substitutions or changes should fall within the scope of protection of the present invention.

[0037] Materials and reagents (1) Target gene: Klebsiella pneumoniae rcsA gene was used as the detection target.

[0038] (2) RPA reagent: Recombinase polymerase amplification (RPA) kit was used.

[0039] (3) CRISPR system: using Cas12a protein, corresponding buffer and fluorescent reporter molecule.

[0040] (4) Photo-controlled component: caged crRNA obtained by introducing photosensitive modification into the crRNA spacer region is used for photo-triggered activation.

[0041] (5) Detection equipment: constant temperature equipment / ordinary PCR instrument for incubation at 37℃; fluorescence detection can be performed using qPCR instrument or real-time fluorescence detector to record kinetic curves; electrophoresis imaging is used for amplification and cutting verification.

[0042] Example 1: RPA primer design, screening and specificity verification 1.1 Primer design: Based on the Klebsiella pneumoniae rcsA gene sequence, four candidate combinations of RPA primers were designed using online primer design tools and in accordance with RPA primer design principles.

[0043] 1.2 RPA Amplification and Screening: The reaction system was prepared according to the RPA kit instructions (example system volume 50 μL), with magnesium ions preferably added last to reduce non-specific amplification. The reaction tubes were incubated at 37℃ for 20 min; the amplification products were analyzed by 2% agarose gel electrophoresis (130 V, 45 min), and the amplification efficiency and band specificity of each primer combination were compared.

[0044] 1.3 Results: such as Figure 1 As shown in A, all candidate primers can amplify the target fragment, with Pair3 exhibiting the best amplification efficiency and clearest bands; Figure 1 As shown in B, Pair3 showed no amplification bands for non-target templates and had good specificity, so Pair3 was the preferred primer pair for subsequent detection.

[0045] Example 2: crRNA screening and caged crRNA construction 2.1 crRNA design: PAM (TTTN) sites were identified in the Pair3 amplification region, and three candidate crRNAs were designed for Cas12a target recognition.

[0046] 2.2 Cas12a fluorescence screening system: Prepare the Cas12a fluorescence reaction system (example volume 20 μL), including: reaction buffer, Cas12a protein, candidate crRNA, fluorescent reporter molecule and enzyme-free water; add RPA amplification product as target DNA, monitor fluorescence at 37℃ for 30 min (collected once per minute), and evaluate crRNA performance by fluorescence kinetic curve and endpoint signal intensity.

[0047] 2.3 Results and Cage Modification: such as Figure 2 A, Figure 2 As shown in B, all three crRNAs can trigger signal output, with crRNA1 showing the best performance. Therefore, crRNA1 was selected as the preferred crRNA. Furthermore, three photosensitive modifications (e.g., NPOM-dT) were introduced into its spacer region to prepare a light-activated caged crRNA for use in subsequent one-tube systems.

[0048] Example 3: Construction of a light-controlled one-tube RPA-CRISPR / Cas12a detection system 3.1 Integrated Reaction System The RPA amplification component and the CRISPR detection component are pre-placed in the same reaction tube to achieve a one-tube integrated reaction. An example configuration is as follows: RPA mixture: for isothermal amplification (can contain 2×RPA buffer, forward and reverse primers, magnesium acetate and enzyme-free water to make up the difference); CRISPR mixture: for target recognition and signal output (may contain 10× buffer, Cas12a protein, caged crRNA, fluorescent reporter molecule and enzyme-free water supplementation).

[0049] The two parts are mixed in the same reaction tube and briefly centrifuged before entering the reaction process.

[0050] Note: The total reaction volume can be set to the range of 15–20 μL depending on the application scenario; the key is that the integrated design of "completing amplification and phototriggered detection in the same reaction vessel" remains unchanged.

[0051] 3.2 Reaction Flow (1) Incubate at 37℃ for RPA amplification (preferably 20 min); (2) The reaction tube was irradiated with 365 nm ultraviolet light to activate the caged crRNA, relieve its inhibition of target sequence recognition / pairing and mediate the cleavage of target DNA and reporter molecules by Cas12a (preferably 30 s). (3) Continue fluorescence monitoring at 37°C (preferably 30 min, record once per minute).

[0052] 3.3 Comparative Example: To verify the feasibility of missing components, component deletion controls were set up, including but not limited to: missing UV irradiation, missing template, missing Cas12a, missing caged crRNA, or missing fluorescent reporter molecules. The fluorescence signals of each group were compared with the electrophoresis / imaging results. Results are as follows: Figure 2 C– Figure 2 As shown in E: Only when the key components are complete and generate significant signal output and cutting performance after being activated by ultraviolet light can the system be proven to be a "photo-triggered start" one-tube detection system.

[0053] 3.4 Comparison of Illumination Conditions: For validation of light-controlled specificity, a single-tube system containing caged crRNA was treated under different illumination conditions (e.g., 365 nm UV light, 470 nm blue light, incandescent light, midday natural light, and light-protected conditions). Fluorescence detection was then performed, supplemented by gel analysis. Results are as follows: Figure 3 A, Figure 3 B. Figure 3 As shown in C, significant fluorescence enhancement and cleavage were observed only under 365 nm ultraviolet light conditions, while the system remained negative under other conditions, indicating that the system has clear photo-triggered characteristics.

[0054] Example 4: Optimization of Key Reaction Parameters 4.1 RPA Amplification Condition Optimization: Amplification time (10, 15, 20, 30, 40 min) and primer concentration (160, 240, 320, 400, 480, 560 nM) were optimized using a gradient approach, with fluorescence intensity as the primary evaluation index. Results are as follows: Figure 4 A, Figure 4 As shown in C, the optimal signal was achieved when the primer concentration was 400 nM and the amplification time was 20 min.

[0055] 4.2 Optimization of photoactivation time: The irradiation time of 365 nm ultraviolet light (10, 15, 20, 30, 60 s) was optimized. The results are as follows: Figure 4 As shown in B: the highest fluorescence output can be obtained by irradiation for 30 s.

[0056] 4.3 Optimization of Cas12a and caged crRNA concentrations: Gradient optimization was performed on Cas12a (100–500 nM) and caged crRNA (100–400 nM), respectively. The results are as follows... Figure 4 D、 Figure 4 As shown in E, the system performs best when both are at 300 nM.

[0057] Example 5: Sensitivity and Specificity Assessment 5.1 Sensitivity: Using enzyme-free water as a diluent, Klebsiella pneumoniae genomic DNA was serially diluted 10-fold (1.15 × 10⁻⁶). -2 Up to 1.15×10 -6 (ng / μL) was used as a template for detection. The results are as follows: Figure 5 As shown in A, at 1.15 × 10 -6 Fluorescence signals can still be detected at concentrations of ng / μL.

[0058] 5.2 Specificity: Genomic DNA of Klebsiella pneumoniae and seven common clinical pathogens (Haemophilus parainfluenzae, Pseudomonas aeruginosa, Streptococcus pneumoniae, Enterococcus faecalis, Enterococcus faecium, Staphylococcus aureus, and Escherichia coli) were selected as templates for detection. Results are as follows: Figure 5 As shown in B, only Klebsiella pneumoniae produced a positive fluorescent signal, while the other bacterial species showed no cross-reaction.

[0059] Example 6: Clinical Sample Validation and PCR Control 6.1 Clinical Samples: 30 strains of Klebsiella pneumoniae and 20 strains of non-Klebsiella pneumoniae were collected from clinical isolates, and genomic DNA was extracted for detection.

[0060] 6.2 PCR Control Method: Parallel control verification was performed using the PCR method. Example PCR system (25 μL): 2×EsTaq MasterMix, forward and reverse primers, template DNA, and water; amplification program was performed according to the manufacturer's instructions; products were analyzed by 2% agarose gel electrophoresis (see [link to product details]). Figure 6 A).

[0061] 6.3 Consistency and Diagnostic Performance: such as Figure 6 B. Figure 6As shown in Figure C, the detection results of the light-controlled one-tube system of this invention on 50 clinical samples were completely consistent with those of PCR; ROC curve analysis is as follows. Figure 7 As shown, excellent diagnostic performance can be obtained at a fluorescence threshold of 2710.

[0062] Example 7: Effect of Operating Temperature Detection was performed using positive samples (Klebsiella pneumoniae DNA), negative samples (e.g., Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa DNA), and blank controls under 0°C (operated on ice) and room temperature (18–25°C) conditions. Results are as follows: Figure 8 As shown, the positive and negative concordance rates were 100% under both temperature conditions, indicating that the system is stable at common production / operation temperatures.

[0063] Example 8: Effects of Positive Control Packaging Environment and Disinfection The dispensing area underwent routine decontamination treatment (e.g., UV irradiation and disinfectant wiping), and samples were collected by swabbing pipette tubes and biosafety cabinet work surfaces. The dissolved swab solution was used as a blank control template for testing. Results are as follows: Figure 9 As shown, the positive and negative results were consistent before and after disinfection, and no false positives or false negatives caused by environmental factors were observed, indicating that the system has good tolerance to routine disinfection conditions.

[0064] Example 9: Verification of Anti-interference Capability Set up the following detection group: (1) Only add standard plasmids; (2) The standard plasmid and the interfering bacteria nucleic acid extract were mixed in equal volumes; (3) Only add interfering bacterial nucleic acid extract; (4) Blank control.

[0065] The fluorescence at the reaction endpoint was detected and statistically compared. Results are as follows: Figure 10 As shown: the fluorescence decreased slightly after the addition of interfering nucleic acid, but there was no significant difference; only the interfering nucleic acid showed no significant difference from the blank control, indicating that the system has good anti-interference ability.

[0066] Example 10: Repeatability Verification With 10 -4 The concentration standard plasmid was subjected to multiple independent and repeated assays. The endpoint fluorescence was collected, and the mean, standard deviation, and relative coefficient of variation (RSD) were calculated. The results showed that the RSD was <10%, indicating that the detection system had good repeatability and stable results.

[0067] Example 11: Primer Supplier Comparison Primers with the same sequence were synthesized by two commercial companies, and detection was performed under the same reaction conditions, supplemented by agarose gel electrophoresis analysis. Results are as follows: Figure 11 As shown, one of the companies' primers exhibited higher fluorescence signals and clearer amplification bands, making them a preferred primer source for system construction and mass production.

Claims

1. An RPA detection kit for detecting Klebsiella pneumoniae, characterized in that, The kit includes the following components: The RPA primer pair, including forward primer F and reverse primer R, is used to amplify the rcsA gene region; caged crRNA, modified with 6-nitrocapsaicinoxymethyl thymidine (NPOM-dT), can synergistically interact with Cas12a protein to cleave the rcsA gene amplification product after activation; Cas12a protein, which binds to caged crRNA, cleaves the target DNA; a reporter molecule is used to monitor the fluorescence signal generated by the cleavage reaction; and reaction buffers, including RPA buffer, CRISPR buffer, and magnesium ion reagent, are used to ensure optimized reaction conditions.

2. The reagent kit according to claim 1, characterized in that, The design parameters for the RPA primer pair are: Primer length is 27 bp; GC content is 30%-70%; amplicon length is 150-300 bp; Tm value is 50-70℃.

3. The reagent kit according to claim 1, characterized in that, The activation conditions for the caged crRNA are as follows: Irradiation with ultraviolet light at a wavelength of 365 nm for 30 seconds activates caged crRNA, thereby relieving the inhibition of crRNA activity by caged modification, restoring crRNA's ability to recognize target sequences, and thus activating the Cas12a cleavage response.

4. The reagent kit according to claim 1, characterized in that, The operating concentrations of each component are: RPA primer pair concentration: 400 nM; caged crRNA concentration: 300 nM; Cas12a protein concentration: 300 nM; reporter molecule concentration: 500 nM; magnesium ion reagent was added according to the RPA kit instructions, with magnesium acetate concentration of 280 mM, to bring the final concentration to 8 mM.

5. A method for detecting Klebsiella pneumoniae using the kit according to any one of claims 1-4, characterized in that, Includes the following steps: Step (1): Extract genomic DNA from the sample to be tested; Step (2): Prepare a reaction system containing RPA amplification components and CRISPR / Cas12a detection components in the same reaction tube, and add DNA sample; Step (3): After incubation at 37°C for 20 minutes, activate caged crRNA by irradiation with 365 nm ultraviolet light; Step (4): Continue incubation and monitor the fluorescence signal in real time. If the fluorescence increases, it is positive; if it remains negative, it is negative.

6. The method according to claim 5, characterized in that, The reaction system can be prepared at 0°C or room temperature.

7. The method according to claim 5, characterized in that, The samples to be tested include one or more of the following: clinical isolates, clinical specimens, and environmental samples.

8. The application of the kit according to claims 1-4 in the rapid detection of Klebsiella pneumoniae.

Images