A multiplex PCR primer set, method and application for simultaneously detecting three main pathogenic bacteria of potato black leg disease

Abstract

The application provides a multiplex PCR primer set, method and application for simultaneously detecting three main pathogenic bacteria of potato blackleg disease. leuA The primer set is designed based on sequence differences of AP family permease encoding genes of Pectobacterium chesnutense, Pectobacterium brasiliense and Pectobacterium parmentieri ANKRD protein encoding genes, and comprises three pairs of specific primers. Through reaction condition optimization, a triple PCR detection method for simultaneously detecting the three dominant pathogenic bacteria is established. The method can determine single infection or complex infection state of the three pathogenic bacteria in a sample through a single multiplex PCR reaction, and field samples do not need to be subjected to pathogenic bacteria isolation and culture, and can be directly used for molecular identification. The application has the characteristics of high detection efficiency, simple operation, strong specificity, high sensitivity and good repeatability, is suitable for field batch sample detection and quality screening of virus-free seed potato, and can provide reliable technical support for early diagnosis, pathogen monitoring and comprehensive prevention and control of potato blackleg disease.

Description

Technical Field

[0001] This invention relates to the field of molecular detection technology for bacterial diseases of potatoes, specifically to a method capable of simultaneously detecting *Pectinobacterium tumefaciens* (black rot pectinobacter). Pectobacterium atrosepticum ), Brazilian pectinobacterium ( Pectobacterium brasiliense ) and Parmentier pectinobacter ( Pectobacterium parmentieri Multiplex PCR primer sets, detection methods, and applications of three major pathogens of potato black shank. Background Technology

[0002] The main pathogen causing potato blackleg is *Pectobacterium niger* (a member of the *Pectobacterium* genus). Pectobacterium atrosepticum Pba), Brazilian pectinobacterium ( Pectobacterium brasiliens e, Pbr), Parmentier pectinobacter ( Pectobacterium parmentieri The three pathogens (Ppa) can infect plants individually or in combination. Diseased plants develop black rot and wilting at the base of the stem, and soft rot and decay of the tubers. In severely affected fields, the disease rate can reach over 40%. These pathogens can cause serious yield and economic losses during both the potato growing and storage periods, severely restricting the healthy development of my country's potato industry.

[0003] Currently, the symptoms of diseases caused by the three pathogenic bacteria in the field are highly similar, making accurate differentiation of pathogens impossible based on phenotypic symptoms alone. Traditional isolation, culture, and biochemical identification methods are cumbersome and time-consuming. Conventional single-strand PCR can only detect one pathogen at a time, which is time-consuming, labor-intensive, and costly in batch sample testing, making it difficult to meet the practical needs of screening virus-free seed potatoes and monitoring diseases in the field. Existing research mainly focuses on single-species single-strand PCR detection systems, and there are no reports of multiplex PCR detection technologies that can simultaneously detect the three dominant pathogenic bacteria mentioned above. The main characteristics and performance comparison of existing potato black shank detection technologies are as follows: Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a multiplex PCR primer set, method and application for simultaneous detection of three pathogens of potato black shank, which solves the technical problems of low throughput, long cycle and high cost of existing detection methods. This method has the advantages of high detection efficiency, simple operation, low cost, strong specificity, high sensitivity and good repeatability, and is suitable for rapid screening of batch samples in the field and quarantine detection of seed potatoes.

[0005] This invention is implemented as follows: A set of multiplex PCR primers for the simultaneous detection of three major pathogens of potato black shank includes the following three primer pairs: Primer pair for *Pectinobacter niger*: Forward primer 5'-GGGAGCATCATCGGTAGTGG-3', as shown in SEQ ID No:1; The reverse primer 5'-GAGCTCCAAGGCACTCATA-3' is shown in SEQ ID No:2; Brazilian pectinobacterium primer pair: Forward primer 5'-GGAAGTGGTGTTCCGTCAGA-3', as shown in SEQ ID No:3; The reverse primer 5'-GCAAGTTCAGCACAGGCAAT-3' is shown in SEQ ID No:4; Parmentier pectinobacter primer pair: Forward primer 5'-ATGGAGGCCATGTCATACCTTT-3', as shown in SEQ ID No:5; The reverse primer 5'-AGGAACGCAACTATCGCTGG-3' is shown in SEQ ID No:6.

[0006] Furthermore, the amplification product of the *Pectinobacter niger*-specific primer pair is 902 bp; the amplification product of the *Pectinobacter brasiliensis*-specific primer pair is 369 bp; and the amplification product of the *Pectinobacter parmentifer*-specific primer pair is 632 bp. The three amplification products exhibit distinguishable migration rates in agarose gel electrophoresis.

[0007] Furthermore, a multiplex PCR method for simultaneously detecting three pathogens of potato black shank includes the following steps: a. Preparation of nucleic acid templates for the samples to be tested; the nucleic acid templates may be extracted and purified genomic DNA, or crude extracts obtained by grinding / pressing potato diseased plant tissues; b. Using the nucleic acid prepared in step a as a template, amplification was performed using the aforementioned multiplex PCR primer set; the PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 15 s, 58℃ annealing for 20 s, 72℃ extension for 1 min, for a total of 35 cycles; and 72℃ final extension for 10 min. c. Perform gel electrophoresis on the PCR amplification products and determine the types of pathogens contained in the sample based on the size of the electrophoretic bands.

[0008] Furthermore, when the nucleic acid template is crude extract of potato tissue without DNA extraction, the pre-denaturation time at 95°C in step b is 8–12 min.

[0009] Further, the total volume of the PCR amplification system described in step b is 25 μL, and the system components include: 12.5 μL of 2×Rapid TaqMasterMix, 1 μL each of 10 μmol / L Pectinobacterium parvum upstream and downstream primers, 0.5 μL each of 10 μmol / L Pectinobacterium niger upstream and downstream primers, 0.5 μL each of 10 μmol / L Pectinobacter brasiliensis upstream and downstream primers, 1 μL of DNA to be detected, and the remainder is made up with sterile double-distilled water.

[0010] Furthermore, the gel electrophoresis described in step c is 1% agarose gel electrophoresis, with an electrophoresis voltage of 180V and an electrophoresis duration of 20min.

[0011] Furthermore, the presence of a 902 bp specific band indicates a positive result for *Pectinobacter nigra*, a 632 bp specific band indicates a positive result for *Pectinobacter parmentifer*, and a 369 bp specific band indicates a positive result for *Pectinobacter brasiliensis*.

[0012] Furthermore, the multiplex PCR primer set described herein is used in the preparation of a detection kit for the simultaneous detection of *Pectinobacterium tumefaciens*, *Pectinobacter brasiliensis*, and *Pectinobacter parmentifer*.

[0013] The present invention has the following advantages: This invention enables the simultaneous detection of three pathogens in a single multiplex PCR reaction, with a detection time of only about 1 hour. Field samples can be directly detected without prior isolation, purification, or culture, significantly simplifying the process and reducing reagent and labor costs. Furthermore, this invention requires only a conventional PCR instrument and gel electrophoresis equipment, eliminating the need for expensive specialized equipment such as quantitative real-time PCR instruments. The detection cost is significantly lower than that of real-time quantitative PCR methods, making it suitable for widespread application in grassroots testing institutions and production lines. This invention further establishes a direct PCR detection scheme for juice without DNA extraction. After field sample collection, pathogen isolation and culture, as well as pathogen DNA extraction, are unnecessary; PCR detection can be performed directly. By extending the pre-denaturation time to 10 minutes, the DNA extraction step is eliminated while ensuring balanced amplification of the three targets, reducing the entire detection process to less than 1 hour. This further reduces detection costs and significantly lowers operational complexity, fully meeting the practical needs of rapid screening of large batches of field samples.

[0014] This invention utilizes the APC family permease encoding genes of *Pectinobacter niger* and *Pectinobacter brasiliensis*, respectively. leuAGenes and the ankyrin repeat domain protein-coding gene of *Pectinobacter parmentifer* were used as molecular detection targets. Through primer combination screening and reaction system optimization, a synchronous amplification system was established with extremely high specificity, showing no cross-amplification with seven closely related or unrelated strains, including *Pectinobacter carotenoides*, *Pectinobacter multifunctionalis*, *Pectinobacter punjab*, *D. d'adani*, *D. zebufo*, *Ralstonia solanacearum*, and *Pseudomonas putida*. The detection limit reached 1×10⁻⁶. 3 The method has a sensitivity sufficient for field sample detection, with copies / μL. Intra-batch and inter-batch repeatability tests showed consistent results, with clear and stable amplified bands, indicating good reproducibility. Validation was performed on 22 field potato diseased plant samples from different regions. The detection results were completely consistent with the single-PCR retest results (100% concordance rate). Furthermore, a single reaction simultaneously reflected the complete pathogen composition information of single infection (63.6%) and multiple infection (36.4%) in the field samples, providing reliable technical support for early diagnosis of potato blackleg, quality testing of virus-free seed potatoes, and field pathogen monitoring. Attached Figure Description

[0015] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0016] Figure 1 The image shows the PCR identification results of the recombinant plasmid standard in this embodiment of the invention, where M: Trans 2K DNA Marker; 1: pEASY-Pba plasmid detection; 2: pEASY-Pbr plasmid detection; 3: pEASY-Ppa plasmid detection; 4: negative control.

[0017] Figure 2 The figure shows the optimization results of the final concentration of multiplex PCR primers in the embodiments of the present invention. In the figure, M: Trans 2K DNA Marker; 1: negative control; 2: the final concentration of primers is 0.4 μmol / L; 3: the final concentration of primers is 0.2 μmol / L; 4: the final concentration of primers is 0.1 μmol / L; 5: Ppa primer 0.4 μmol / L, Pba and Pbr primers 0.2 μmol / L.

[0018] Figure 3 The figure shows the optimization results of multiplex PCR annealing temperature in the embodiments of the present invention, where M: Trans 2K DNA Marker; 1: negative control; 2: 52℃; 3: 54℃; 4: 56℃; 5: 58℃; 6: 60℃; 7: 62℃.

[0019] Figure 4The figure shows the optimization results of multiplex PCR cycle number in the embodiments of the present invention, where M: Trans 2K DNA Marker; 1: 20 cycles; 2: 25 cycles; 3: 30 cycles; 4: 35 cycles; 5: 40 cycles; 6: negative control.

[0020] Figure 5 This is a diagram showing the results of a multiplex PCR specificity test in an embodiment of the present invention. In the diagram, M: Trans 2K DNA Marker; 1: Pba+Pbr+Ppa mixed template; 2: Pba+Pbr mixed template; 3: Pba+Ppa mixed template; 4: Pbr+Ppa mixed template; 5: Pba; 6: Ppa; 7: Pbr; 8: *Pectinobacterium carotenoides*; 9: *Pectinobacterium multifunctionalum*; 10: *Pectinobacter punjab*; 11: *Digibium dadanense*; 12: *Digibium zeyeri*; 13: *Ralstonia solanacearum*; 14: *Pseudomonas putida*; 15: Negative control.

[0021] Figure 6 This is a graph showing the results of a multiplex PCR sensitivity test in an embodiment of the present invention, where M: Trans 2K DNA Marker; 1-9: the concentrations of the mixed plasmid standards are 1×10⁻⁶ respectively. 8 1×10 7 1×10 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 1×10 0 copies / μL; 10: negative control.

[0022] Figure 7 The diagram shows the results of a multiplex PCR repeatability test in an embodiment of the present invention, where M: Trans 2K DNA Marker; 1-3: 3 parallel samples of the first batch; 4: negative control of the first batch; 5-7: 3 parallel samples of the second batch; 8: negative control of the second batch; 9-11: 3 parallel samples of the third batch; 12: negative control of the third batch.

[0023] Figure 8 The image shows the results of multiplex PCR detection of field disease samples in this embodiment of the invention. In the image, M: Trans 2K DNA Marker; 1: Positive control; 2-23: Potato disease samples collected in the field; 24: Negative control.

[0024] Figure 9This is a diagram showing the results of multiplex PCR detection of diseased sap samples in the field in an embodiment of the present invention. In the diagram, 2K DNA Marker; 1: positive control; 2-22: diseased tissue samples; 23-24: negative control. Detailed Implementation

[0025] The following will be combined with the appendix Figure 1-9 The technical solution of the present invention will be clearly and completely described in detail with specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0026] Example 1: Design and Screening of Multiplex PCR Primers This invention provides a primer set for the detection of three major pathogens of potato black shank disease—*Pectobacterium black rot*, *Pectobacter brasiliensis*, and *Pectobacter parmentillium*—using multiplex PCR: Black rot pectinobacterium (Pba) primer pair: Forward primer: 5'- GGGAGCATCATCGGTAGTGG -3', as shown in SEQ ID No:1; Reverse primer: 5'-GAGCTCCAAGGCACTCATA-3', as shown in SEQ ID No:2; Brazilian Pectinobacterium (Pbr) primer pair: Forward primer: 5'- GGAAGTGGTGTTCCGTCAGA-3', as shown in SEQ ID No:3; Reverse primer: 5'- GCAAGTTCAGCACAGGCAAT-3', as shown in SEQ ID No:4; Parmentier pectinobacter (Ppa) primer pair: Forward primer: 5'-ATGGAGGCCATGTCATACCTTT-3', as shown in SEQ ID No:5; Reverse primer: 5'-AGGAACGCAACTATCGCTGG-3', as shown in SEQ ID No:6.

[0027] The amplification product size of the *Pectinobacter niger*-specific primer pair was 902 bp; the amplification product size of the *Pectinobacter brasiliensis*-specific primer pair was 369 bp; and the amplification product size of the *Pectinobacter parmentifer*-specific primer pair was 632 bp. These three amplification products exhibited distinguishable migration rates in agarose gel electrophoresis, facilitating result interpretation.

[0028] The design process of the above primer pairs is as follows: (1) Identification of target genes: Through large-scale comparative analysis of the genome sequences of *Pectinobacterium black rot*, *Pectinobacter brasiliensis*, and *Pectinobacter parmentiferum*, the target genes of *Pectinobacterium black rot* were identified. APC Family permease encoding gene, *Brazilian pectinobacterium* leuA Genes and Parmentier pectinobacter ANKRD Genes serve as specific detection targets. The three target genes mentioned above are highly conserved within species but exhibit significant sequence differences between species.

[0029] (2) Primer design and screening: Multiple pairs of candidate primers were designed for the three target genes using Primer Premier 5.0 and Oligo 7.0 software. The candidate primer pairs were combined in different ways, and the amplification specificity and efficiency of each combination were compared through multiple PCR amplification experiments. Primer combinations with cross-interference or severely unbalanced amplification efficiency were eliminated, and the three pairs of primers were finally determined as the optimal combination.

[0030] As a preferred embodiment of the present invention, the primer set contains three pairs of specific upstream and downstream primers: Pba, Pbr, and Ppa.

[0031] This invention also relates to a multiplex PCR method for simultaneously detecting three pathogenic pectinobacteria of potato black shank, comprising the following steps: a. Prepare a nucleic acid template for the sample to be tested; the nucleic acid template may be extracted and purified genomic DNA, or a crude extract obtained by grinding / pressing potato diseased plant tissue; b. Using the nucleic acid prepared in step a as a template, amplification is performed using the aforementioned multiplex PCR primer set; when the nucleic acid template is the genomic DNA of the sample to be tested, the PCR amplification reaction conditions are: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 15 s, 58℃ annealing for 20 s, 72℃ extension for 1 min, for a total of 35 cycles; 72℃ final extension for 10 min; When the nucleic acid template is crude extract of potato tissue without DNA extraction, the pre-denaturation time at 95°C in step b is 8-12 min, with the optimal time being 10 min; c. Perform gel electrophoresis on the PCR amplification products and determine the types of pathogens contained in the sample based on the size of the electrophoretic bands.

[0032] As a preferred embodiment of the present invention, the 25 μL complete PCR system in step b consists of: 1 μL of DNA sample to be tested, 12.5 μL of 2×Rapid Taq MasterMix, 1 μL each of 10 μmol / L Ppa forward and reverse primers, 0.5 μL each of 10 μmol / L Pba forward and reverse primers, 0.5 μL each of 10 μmol / L Pbr forward and reverse primers, and sterile ddH2O to a final volume of 25 μL.

[0033] As a preferred technical solution of the present invention, step c uses 1% agarose gel electrophoresis at 180V for 20 minutes.

[0034] As a preferred technical solution of the present invention, the pathogen identification criteria in step c are: the presence of a 902 bp specific band indicates *Pectinobacterium nigra*, the presence of a 632 bp specific band indicates *Pectinobacterium parvum*, and the presence of a 369 bp specific band indicates *Pectinobacter brasiliensis*.

[0035] This invention also relates to the application of the above-mentioned multiplex PCR primer set and detection method in the simultaneous detection of Pba, Pbr and Ppa of potato blackleg, especially in the preparation of a detection kit for the simultaneous detection of the above three pathogens.

[0036] Example 2: Establishment of a multiplex PCR detection method and optimization of reaction conditions 2.1 Test strains and samples

[0037] Black rot pectinobacter ( Pectobacterium atrosepticum Pba), Brazilian pectinobacterium ( Pectobacterium brasiliense Pbr), Parmentier pectinobacterium ( Pectobacterium parmentieri Ppa), Carotene soft rot pectinobacter ( Pectobacterium carotovorum Pcc), multifunctional pectinobacterium ( Pectobacterium versatile Pve), Punjab pectinobacter ( Pectobacterium punjabense Ppun), Dadandiguis ( Dickeya dadantii Dda), Diggia corniculata ( Dickeya zeae Dze), Ralstonia solanacearum ( Ralstonia solanacearum Rs), Pseudomonas putida ( Pseudomonas putida Potato disease samples (such as Ppu) were collected, identified, and preserved by our laboratory. From 2025 to 2026, potato diseased plant samples were collected from Ningde, Zhangzhou, Quanzhou, and Longyan in Fujian Province for field application verification.

[0038] 2.2 Main Reagents and Instruments FastPure Bacteria DNA Isolation Mini Kit-BOX2 bacterial DNA extraction kit, 2×Rapid Taq Master Mix, etc. were purchased from Nanjing Novizan Biotechnology Co., Ltd.; Trans 2K DNA Marker, Trans1-T1 cloning competent cells, pEASY®-T5 Zero Cloning Kit, EasyPure Plasmid MiniPrep Kit plasmid miniprep kit, etc. were purchased from Beijing TransGen Biotech Co., Ltd.; EZNA® Gel Extraction Kit gel extraction kit was purchased from OMEGA. Gradient PCR instrument (Veriti) was purchased from Applied Biosystems, USA; NanoDrop 2000c ultra-micro nucleic acid and protein analyzer was purchased from Thermo Fisher Scientific (China) Co., Ltd.; electrophoresis system (DYY-8C) was purchased from Beijing Liuyi Biotechnology Co., Ltd.; gel imaging analysis system (GelDoc XR+) was purchased from Bio-Rad, USA.

[0039] 2.3 Construction of Standard Recombinant Plasmids Target gene fragments from *Pectinobacterium niger*, *Pectinobacter brasiliensis*, and *Pectinobacter parmentifer* were amplified, respectively. The target gene fragments were purified and recovered using a gel extraction kit, ligated using the pEASY®-T5 Zero Cloning Kit, and the ligation products were transformed into Trans1-T1 competent cells. After amplification of PCR-identified single-clone colonies, recombinant plasmid DNA was extracted and sequenced for confirmation. Results ( Figure 1 This indicates that plasmid standards for the three pathogens were successfully constructed; the copy concentrations of pEASY-Pba, pEASY-Pbr, and pEASY-Ppa were determined to be 7.04 × 10⁻⁶. 10 copies / μL, 6.17×10 10 copies / μL, 7.63×10 10 copies / μL.

[0040] 2.4 Systematic optimization of multiplex PCR reaction conditions (1) Primer concentration optimization With 1×10 8 Using a mixture of copies / μL recombinant plasmid standards as a template, three primer pairs with final concentrations of 0.4 μmol / L, 0.2 μmol / L, and 0.1 μmol / L were used for multiplex PCR amplification. Results ( Figure 2The results indicate that the determination of the above concentration ratio (Ppa primer 0.4 μmol / L: Pba primer 0.2 μmol / L: Pbr primer 0.2 μmol / L) is non-obvious. Experiments show that when the three primer pairs use the same final concentration (0.4 μmol / L, 0.2 μmol / L, or 0.1 μmol / L), the amplification product band brightness is uneven, and some band signals are weak, failing to meet the interpretation requirements for simultaneous detection. Only when the Ppa primer concentration is more than twice that of the Pba and Pbr primer concentrations can the amplification efficiency of the three primer pairs reach an optimal balance. The above concentration ratio cannot be reasonably predicted based on conventional parameters such as primer Tm value and GC content, but is an optimal scheme obtained through actual gradient experiments.

[0041] (2) Optimization of annealing temperature Multiplex PCR amplification was performed at annealing temperature gradients of 52℃, 54℃, 56℃, 58℃, 60℃, and 62℃, respectively. Results ( Figure 3 The results showed that when the annealing temperature was 58℃, all three amplification product bands were bright, clear, and showed good specificity. Therefore, the optimal annealing temperature was determined to be 58℃.

[0042] (3) Optimization of the number of iterations Multiplex PCR amplification was performed with 20, 25, 30, 35, and 40 cycles respectively. Results ( Figure 4 The results show that 35 cycles are sufficient to obtain three bright, clear, and accurately sized target bands. Increasing the number of cycles does not significantly increase the band brightness and may increase the risk of nonspecific amplification. Therefore, the optimal number of cycles is determined to be 35.

[0043] Multiplex PCR amplification was performed using the primer set described above. The PCR amplification system consisted of: 1 μL of DNA to be detected, 12.5 μL of 2×TaqPCR MasterMix, 1 μL each of 10 μmol / L Pectinobacterium parvum upstream and downstream primers, 0.5 μL each of 10 μmol / L Pectinobacter niger upstream and downstream primers, 0.5 μL each of 10 μmol / L Pectinobacter brasiliensis upstream and downstream primers, and the remainder was made up to a final volume of 25 μL with sterile double-distilled water.

[0044] The PCR reaction conditions were optimized and determined as follows: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 15 s, 58℃ annealing for 20 s, 72℃ extension for 1 min, for 35 cycles; and 72℃ final extension for 10 min.

[0045] Example 3: Establishment and Methodological Validation of a Multiplex PCR Detection Method 3.1 Specificity test Using genomic DNA from strains such as *Pectobacterium carotenoides*, *Pectobacter multifunctionalis*, *Pectobacter punjab*, *D. d'adani*, *D. zearalenone*, *Ralstonia solanacearum*, and *Pseudomonas putida* as templates, the multiplex PCR method established in this invention was used for detection. Results ( Figure 5 The results showed that templates containing only *Pectinobacter niger*, *Pectinobacter brasiliensis*, and *Pectinobacter parmentii* amplified specific bands at 902 bp, 369 bp, and 632 bp, respectively, while other closely related and unrelated strains did not amplify any bands, indicating that the method has high specificity.

[0046] 3.2 Sensitivity Test The three recombinant plasmids pEASY-Pba, pEASY-Pbr, and pEASY-Ppa were mixed in equal proportions, serially diluted 10-fold, and then analyzed. Results ( Figure 6 The data shows that when the concentration of the mixed plasmid standard is 1×10⁻⁶, the results indicate that... 3 At a concentration of copies / μL, the three specific bands remained clearly distinguishable; below this concentration, no amplification signal was observed, thus establishing the limit of detection as 1×10⁻⁶. 3 copies / μL.

[0047] 3.3 Repeatability Test With 1×10 8 Using a mixed plasmid of copies / μL as a template, intra-batch (3 replicates within the same batch) and inter-batch (3 independent batches) repeatability validation was performed. Results ( Figure 7 The results showed that the size and brightness of the amplified bands within and between batches were consistent, with no significant differences, confirming that the method has good reproducibility. Example 4: Application of PCR detection of pathogen DNA extracted from field samples

[0048] Twenty-two samples of suspected potato blackleg disease collected from Ningde, Zhangzhou, Quanzhou, and Longyan in Fujian Province were tested. Pathogens were isolated, cultured, and purified from the base of potato stems or tubers at the boundary between diseased and healthy tissue. Genomic DNA was extracted from the samples using the FastPureBacteria DNA Isolation Mini Kit-BOX2 bacterial DNA extraction kit and used as templates for multiplex PCR amplification.

[0049] Genomic DNA extracted from 22 field samples was used as templates for amplification using the multiplex PCR primer set described in Example 1 and the optimized reaction system and program determined in Example 2. The PCR reaction system consisted of: 1 μL of the sample DNA, 12.5 μL of 2×Rapid Taq MasterMix, 1 μL each of 10 μmol / L Ppa forward and reverse primers, 0.5 μL each of 10 μmol / L Pba forward and reverse primers, 0.5 μL each of 10 μmol / L Pbr forward and reverse primers, and sterile ddH2O to a final volume of 25 μL. The PCR reaction program was: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 15 s, 58℃ annealing for 20 s, and 72℃ extension for 1 min, for a total of 35 cycles; and a final extension at 72℃ for 10 min. The amplified products were detected by 1% agarose gel electrophoresis (180V, 20min). The pathogen species were identified based on the band size: 902bp was *Pectinobacterium niger*, 632bp was *Pectinobacter parmenti*, and 369bp was *Pectinobacter brasiliensis*.

[0050] result( Figure 8 The results showed that among 22 field samples, 4 samples were infected with *Pectinobacter niger* alone, 4 samples were infected with *Pectinobacter parmentii* alone, and 6 samples were infected with *Pectinobacter brasiliensis* alone; 1 sample was infected with a combination of *Pectinobacter niger* and *Pectinobacter brasiliensis*, 2 samples were infected with a combination of *Pectinobacter niger* and *Pectinobacter parmentii*, and 3 samples were infected with a combination of *Pectinobacter brasiliensis* and *Pectinobacter parmentii*; and 2 samples were infected with a combination of all three pathogens. The above results were completely consistent with the results of singleton PCR retesting (100% concordance rate), and the electrophoretic bands were clear and highly specific, indicating that the method of this invention has a reliable detection effect on actual field samples.

[0051] Example 5: Application of direct PCR detection of field sample juice To further simplify the operation process, reduce the detection cost, and improve the applicability of the method of this invention in rapid screening in the field, this embodiment establishes a direct PCR detection scheme for the juice of three pathogenic bacteria of potato black shank.

[0052] Twenty-one samples of suspected blackleg diseased potato plants were collected from Ningde, Zhangzhou, Quanzhou, and Longyan in Fujian Province. Approximately 0.1–0.2 g of tissue from the base of the potato stem or tuber at the boundary between diseased and healthy tissue was taken, thoroughly crushed, and mixed with 200 μL of sterile water by vortexing to prepare a tissue homogenate. After standing for 1–2 minutes, the supernatant was collected. The homogenate was diluted 100-fold with sterile water, and 1 μL of the diluted solution was directly added to the PCR reaction system.

[0053] The same 25 μL multiplex PCR reaction system as in Example 2 (primer concentration ratios were the same as before) was used, and the template source was 1 μL of the tissue homogenate dilution obtained in the above steps. In the PCR reaction program, the pre-denaturation step was extended from 4 min in the purified DNA system to 10 min at 95°C to fully lyse the pathogen cell wall, release the target nucleic acid, and inactivate any PCR inhibitors that may be present in the sample; the other reaction conditions remained unchanged: denaturation at 95°C for 15 s, annealing at 58°C for 20 s, extension at 72°C for 1 min, for a total of 35 cycles; and a final extension at 72°C for 10 min.

[0054] result( Figure 9 The results showed that among 21 field samples, 5 samples were infected with *Pectinobacter niger* alone, 7 samples with *Pectinobacter parmentii* alone, and 2 samples with *Pectinobacter brasiliensis* alone; 1 sample was infected with a combination of *Pectinobacter niger* and *Pectinobacter brasiliensis*, 2 samples were infected with a combination of *Pectinobacter niger* and *Pectinobacter parmentii*, and 4 samples were infected with a combination of *Pectinobacter brasiliensis* and *Pectinobacter parmentii*. These results were completely consistent with the singleton PCR retest results (100% concordance rate), with clear electrophoretic bands and no non-specific amplification, indicating that the direct PCR protocol for juice established in this invention is equivalent and reliable to the purified DNA protocol.

[0055] The results of this embodiment demonstrate that the method of the present invention can be further simplified into a direct PCR detection scheme for juice without DNA extraction. The entire process requires no nucleic acid purification kits or centrifugation, and can be completed within one hour from sample processing to electrophoresis result interpretation. By extending the pre-denaturation time from 4 min to 10 min, the interference of inhibitors such as polysaccharides and polyphenols in crude plant tissue extracts on the multiplex PCR system is effectively solved, while ensuring balanced amplification of the three primer pairs in the same system. This significantly reduces detection costs and operational barriers, making it particularly suitable for grassroots testing institutions and large-scale seed potato quality screening in the field, providing a more convenient technical means for rapid on-site diagnosis and early warning of potato black shank disease. In summary, the two sets of field test results demonstrate that the multiplex PCR method established in this invention can effectively and simultaneously detect single-infection and multi-infection samples in the field, and the test results comprehensively reflect the actual infection status of the three pathogens in the field. Existing singlex PCR methods require three independent tests to obtain the same information, and the limited throughput makes screening for multi-infection in large batches of field samples operationally difficult. The simultaneous detection capability of multi-infection in this invention overcomes the bottleneck of existing technologies, providing more complete data support for the accurate diagnosis and control decisions of potato blackleg.

[0056] While specific embodiments of the present invention have been described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and not intended to limit the scope of the present invention. Equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A set of multiplex PCR primers for the simultaneous detection of three major pathogens of potato black shank, characterized in that: Includes the following three primer pairs: Primer pair for *Pectinobacter niger*: Forward primer 5'-GGGAGCATCATCGGTAGTGG-3', as shown in SEQ ID No:1; The reverse primer 5'-GAGCTCCAAGGCACTCATA-3' is shown in SEQ ID No:2; Brazilian pectinobacterium primer pair: Forward primer 5'-GGAAGTGGTGTTCCGTCAGA-3', as shown in SEQ ID No:3; The reverse primer 5'-GCAAGTTCAGCACAGGCAAT-3' is shown in SEQ ID No:4; Parmentier pectinobacter primer pair: Forward primer 5'-ATGGAGGCCATGTCATACCTTT-3', as shown in SEQ ID No:5; The reverse primer 5'-AGGAACGCAACTATCGCTGG-3' is shown in SEQ ID No:

6.

2. The multiplex PCR primer set according to claim 1, characterized in that: The amplification product of the *Pectinobacter niger*-specific primer pair was 902 bp; the amplification product of the *Pectinobacter brasiliensis*-specific primer pair was 369 bp; and the amplification product of the *Pectinobacter parmentier*-specific primer pair was 632 bp. The three amplification products showed distinguishable migration rates in agarose gel electrophoresis.

3. A multiplex PCR method for simultaneously detecting three pathogens of potato black shank, characterized in that, Includes the following steps: a. Preparation of nucleic acid templates for the samples to be tested; the nucleic acid templates may be extracted and purified genomic DNA, or crude extracts obtained by grinding / pressing potato diseased plant tissues; b. Using the nucleic acid prepared in step a as a template, amplification is performed using the multiplex PCR primer set described in claim 1 or 2; the PCR amplification reaction conditions are: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 15 s, 58℃ annealing for 20 s, 72℃ extension for 1 min, for a total of 35 cycles; 72℃ final extension for 10 min. c. Perform gel electrophoresis on the PCR amplification products and determine the types of pathogens contained in the sample based on the size of the electrophoretic bands.

4. The multiplex PCR detection method according to claim 3, characterized in that: When the nucleic acid template is crude extract of potato tissue without DNA extraction, the pre-denaturation time at 95°C in step b is 8–12 min.

5. The multiplex PCR detection method according to claim 3 or 4, characterized in that: The total volume of the PCR amplification system described in step b is 25 μL. The system components include: 12.5 μL of 2×Rapid Taq MasterMix, 1 μL each of 10 μmol / L Pectinobacterium parvum upstream and downstream primers, 0.5 μL each of 10 μmol / L Pectinobacterium niger upstream and downstream primers, 0.5 μL each of 10 μmol / L Pectinobacter brasiliensis upstream and downstream primers, 1 μL of DNA to be detected, and the remainder is made up with sterile double-distilled water.

6. The multiplex PCR method according to claim 3 or 4, characterized in that: The gel electrophoresis described in step c is 1% agarose gel electrophoresis, with an electrophoresis voltage of 180V and an electrophoresis time of 20min.

7. The multiplex PCR detection method according to claim 3 or 4, characterized in that: The interpretation criteria in step c are as follows: the presence of a 902 bp specific band indicates a positive result for *Pectinobacter nigra*, the presence of a 632 bp specific band indicates a positive result for *Pectinobacter parmentifer*, and the presence of a 369 bp specific band indicates a positive result for *Pectinobacter brasiliensis*.

8. The application of the multiplex PCR primer set according to claim 1 or 2 in the preparation of a detection kit for the simultaneous detection of *Pectinobacterium tumefaciens*, *Pectinobacter brasiliensis*, and *Pectinobacter parmentii*.

Images