A gene for regulating peanut pod and kernel size, molecular marker and application thereof

Abstract

The present application belongs to the field of genetic engineering, and particularly relates to a gene for regulating peanut pod and kernel size, and a molecular marker and application thereof. The present application uses a recombinant self-cross family population constructed by a large-pod peanut variety Yuhua 15 (YH15) and a small-pod peanut resource W1202, combines genotype data obtained by whole genome resequencing and phenotype data in multiple environments to locate a major QTL site for controlling peanut pod and kernel size on chromosomes 8 and 18; through fine mapping, transcriptome differential expression analysis and structural variation detection, two homologous AhYABBY genes are screened and identified as key candidate genes for controlling peanut pod and kernel size; further, a mutant is created by using CRISPR / Cas9 gene editing technology, and the positive regulation effect of the AhYABBY gene on peanut pod and kernel size is verified.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a gene for regulating the size of peanut pods and seeds, its molecular markers, and applications. Background Technology

[0002] Peanuts (Arachis hypogaea L.) are a globally important oilseed and economic crop, possessing value for food, oil, and feed. Pod and kernel size are crucial agronomic traits that directly determine peanut yield and commercial quality. Developing peanut varieties with large pods and plump kernels is one of the core objectives of peanut breeding. Traditional peanut breeding primarily relies on phenotypic selection and hybridization, which suffers from long breeding cycles, low screening efficiency, and significant susceptibility to environmental influences, making it difficult to quickly and accurately improve pod and kernel size traits. With the development of molecular biology and genetic engineering technologies, identifying key functional genes regulating peanut pod and kernel size and using molecular breeding methods to directionally improve peanut traits has become an important approach to enhancing peanut breeding efficiency.

[0003] The YABBY gene family is a plant-specific transcription factor family. The proteins they encode contain conserved zinc finger and YABBY domains and play important regulatory roles in plant organ morphogenesis, polarity development, and tissue differentiation. Previous studies have shown that YABBY genes are involved in the developmental regulation of leaves, floral organs, and fruits in plants such as Arabidopsis thaliana, rice, and tomato. However, in peanuts, there are no reports on the cloning and functional studies of YABBY genes, and even fewer studies on the regulation of peanut pod and seed size by YABBY genes.

[0004] Therefore, identifying the YABBY gene in peanuts that regulates pod and seed size, and clarifying its function and application value, is of great significance for promoting molecular breeding of peanuts and cultivating new high-yield and high-quality peanut varieties. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a peanut pod and seed size regulating gene, AhYABBY. The AhYABBY gene comprises two homologous genes derived from two subgenomes of peanut, namely Ah08YABBY and Ah18YABBY. The Ah08YABBY gene is located on chromosome 8, and its full-length genome sequence is shown in SEQ ID NO.1. The Ah18YABBY gene is located on chromosome 18, and its full-length genome sequence is shown in SEQ ID NO.2.

[0006] Furthermore, the wild-type CDS sequence of the Ah08YABBY gene is shown in SEQ ID NO.3, and the mutant CDS sequence is shown in SEQ ID NO.4; the wild-type CDS sequence of the Ah18YABBY gene is shown in SEQ ID NO.5, and the mutant CDS sequence is shown in SEQ ID NO.6.

[0007] Furthermore, the wild-type protein sequence of the Ah08YABBY gene is shown in SEQ ID NO.7, and the mutant protein sequence is shown in SEQ ID NO.8; the wild-type protein sequence of the Ah18YABBY gene is shown in SEQ ID NO.9, and the mutant protein sequence is shown in SEQ ID NO.10.

[0008] Furthermore, the sequences of the primer pair are shown in SEQ ID NO.11 and SEQ ID NO.12.

[0009] Furthermore, the sequences of the primer pair are shown in SEQ ID NO.13 and SEQ ID NO.14.

[0010] The present invention also provides a KASP primer set for detecting the 999 bp deletion site of the Ah08YABBY gene as described in claim 1, the primer set comprising two forward primers as shown in SEQ ID NO.17 and SEQ ID NO.18, and two universal reverse primers as shown in SEQ ID NO.19 and SEQ ID NO.20.

[0011] The present invention also provides a KASP primer set for detecting the 220 bp deletion site of the Ah18YABBY gene, the primer set comprising two forward primers as shown in SEQ ID NO.21 and SEQ ID NO.22, and two universal reverse primers as shown in SEQ ID NO.23 and SEQ ID NO.24.

[0012] The present invention also provides a specific primer pair for identifying the above-mentioned AhYABBY gene-positive transgenic or gene-edited peanut lines, wherein the primer pair is an Ah08YABBY identification primer pair or an Ah18YABBY identification primer pair; the sequence of the Ah08YABBY identification primer pair is shown in SEQ ID NO.25 and SEQ ID NO.26; the sequence of the Ah18YABBY identification primer pair is shown in SEQ ID NO.27 and SEQ ID NO.28.

[0013] This invention also provides the application of the above primer pairs or primer sets in marker-assisted breeding of peanuts. By using the primer pairs or primer sets for PCR amplification or KASP detection, the genotypes of Ah08YABBY and / or Ah18YABBY genes in peanuts can be identified, and peanut plants or lines with excellent pod and / or seed traits can be screened.

[0014] This invention also provides a method for cultivating transgenic peanut varieties with enlarged pods and / or kernels, comprising the following steps:

[0015] 1) Construct a recombinant plant expression vector containing the AhYABBY gene as described in claim 1;

[0016] 2) Introduce the recombinant expression vector into peanut recipient cells or callus tissue;

[0017] 3) Culture the transformed cells or callus tissue to obtain regenerated peanut plants;

[0018] 4) Molecular testing and phenotypic identification were performed on the regenerated plants to screen for transgenic peanut lines with enlarged pods and / or kernels.

[0019] The present invention has the following beneficial effects:

[0020] This invention utilizes recombinant self-pollinated families constructed from the large-fruited peanut variety Yuhua 15 (YH15) and the small-fruited peanut resource W1202. Combined with genotypic data obtained from whole-genome resequencing and phenotypic data from multiple environments, major QTL loci controlling peanut pod and seed size were located on chromosomes 8 and 18. Through fine mapping, transcriptome differential expression analysis, and structural variation detection, two homologous AhYABBY genes were screened and identified as key candidate genes controlling peanut pod and seed size. Furthermore, mutants were created using CRISPR / Cas9 gene editing technology to verify the positive regulatory effect of the AhYABBY gene on peanut pod and seed size.

[0021] Analysis of the raw sequencing data of YH15 and W1202, and the BAM files generated after alignment with the reference genome, revealed a 999 bp deletion in the YABBY gene (YH15.Ah08g165700) on chromosome 8 in W1202 compared to YH15. This deletion covers part of the terminal intron and exon regions. Compared to W1202, YH15 also exhibits a 220 bp deletion in the YABBY gene (YH15.Ah18g072600) on chromosome 18, located 4 bp downstream of the third intron start site, leading to altered gene structure and premature translation termination. Two KASP molecular markers were developed based on the mutation sites of the AhYABBY gene on chromosomes 8 and 18, respectively. These markers were validated in the recombinant inbred lines “Yuhua 15” and “W1202” and showed a high linkage to peanut pod and seed size, demonstrating their accuracy. These two KASP markers can be applied to molecular marker-assisted selection for large-fruited peanut varieties. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 Example 1: Seed size of YH15 and W1202;

[0024] Figure 2 Example 1: QTL location results of 100-fruit weight (HPW);

[0025] Figure 3 Example 2: Fine mapping of the AhYABBY gene and prediction of candidate genes;

[0026] Figure 4 Example 3: Expression levels of the AhYABBY gene in pods and seeds at different growth stages;

[0027] Figure 5 Example 4: Comparison of CRISPR / Cas9 gene-editing mutant lines, negative controls, and wild-type pods and seeds;

[0028] Figure 6 Functional marker genotyping diagrams of the Ah08YABBY (left) and Ah18YABBY (right) genes;

[0029] Figure 7 Functional markers of the two AhYABBY genes are linked to 100-fruit weight (left) and 100-seed weight (right). Detailed Implementation

[0030] Various exemplary embodiments of the present invention are now described in detail. Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared using conventional methods. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and embodiments of the present invention.

[0031] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0032] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0033] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0034] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0035] Example 1: Localization of the AhYABBY gene

[0036] Utilizing common peanut resources YH15 and W1202, which exhibit significant differences in pod and seed size ( Figure 1The parental groups were crossbred to obtain recombinant inbred families (RILs) through generation progression. Whole-genome resequencing was performed on 318 RILs and two parents using next-generation sequencing (NGS), with a sequencing depth of 30× for the parents and 1× for the progeny. Variation detection was performed using GATK and samtools software, and SNP data from the RIL population were converted into bin markers using SNPbinner software. Redundant markers were filtered using QTL Icimapping software, a high-density genetic linkage map was constructed, and QTL mapping for peanut pod and seed size was performed using phenotypic data from five environments. Major QTLs controlling pod and seed size were located on chromosomes 8 and 18. Figure 2 ).

[0037] Example 2: Fine mapping of the AhYABBY gene

[0038] To finely locate the major QTL on chromosome 8, an F2 population of 640 individuals was constructed using two recombinant inbred lines (RILs) S181365 (P1) and S181446 (P2). The genetic makeup of these two families was then analyzed.

[0039] The genetic makeup was similar, differing only in the target region, with significant differences in pod and seed size. Twenty-eight competitive allele-specific PCR (KASP) markers were designed using polymorphic SNPs of YH15 and W1202 within the candidate region. These markers were used to genotype the entire F2 population, and heterozygous individuals in the target region were selected for further generations. The developed markers were then used to genotype 281 F3 individuals, ultimately identifying five individuals that recombinated within the target region. Genotypic and phenotypic identification was performed using F4 seeds harvested from these five individuals. Figure 3 ).

[0040] The pods and seeds of L1 were significantly smaller than those of the other four recombinant lines (L2-L5). Figure 3 a) There were no significant differences in pod width (p = 0.54) and seed width (p = 0.91) among the other four recombinant lines. There were also no significant differences in pod length (p = 0.42) and seed length (p = 0.12) among L2, L3, and L5, while the pod and seed length of L4 were slightly longer. Figure 3 a). By integrating the recombination breakpoints and the phenotypes of the five recombination systems, the target interval was finally precisely located within a 91.98 kb interval between the markers chr08.39230691 and chr08.39322668.

[0041] Example 3: Identification of the AhYABBY gene

[0042] Within the 91.98 kb target region, five genes were annotated, encoding ubiquitin C-terminal hydrolase 8, transcription factor YABBY2, fibronectin-like arabinogalactan protein 16, E3 ubiquitin ligase RHF2A, and protein FAR1-related sequence 5. Notably, homologs of the first four genes also exist within the candidate region on chromosome 18.

[0043] To identify structural variations potentially associated with major-effect QTLs on chromosomes 8 and 18, we analyzed the raw sequencing data of YH15 and W1202 and the BAM files generated after alignment with the reference genome. Compared to YH15, W1202 has a 999 bp deletion in the YABBY gene (YH15.Ah08g165700) on chromosome 8, which covers a portion of the terminal intron and exon regions. Figure 3 c). In addition, compared with W1202, YH15 has a 220 bp deletion in the YABBY gene (YH15.Ah18g072600) on chromosome 18. This deletion is located 4 bp downstream of the third intron start site, resulting in changes in gene structure and premature termination of translation.

[0044] RNA-seq analysis further validated the correlation between these two genes and peanut pod and seed size. At 15 days (pod), 25 days (pod), 35 days (pericarp), and 45 days (pericarp) after flowering and pegging, the expression level of YH15.Ah08g165700 in the large-pod genotypes YH15 and S181523 was significantly higher than that in the small-pod genotypes W1202 and S181517. Figure 4 a). Conversely, at the same developmental stage, the expression levels of the homolog YH15.Ah18g072600 in W1202 and S181523 were significantly higher than those in YH15 and S181517 (a). Figure 4 b).

[0045] Example 4 Functional verification of the AhYABBY gene

[0046] To verify the function of AhYABBY, a CRISPR / Cas9 gene knockout vector containing two single guide RNAs (sgRNAs) was used to transform peanut variety YH9326 via gene gun method. Figure 5 a). Similar to YH15, YH9326 carries the complete sequence of Ah08g165700, while its homolog Ah18g072600 is missing a large fragment, resulting in loss of gene function.

[0047] Using CRISPR / Cas9-mediated mutagenesis, a total of 30 homozygous T2 mutant plants were obtained, containing three different mutation types. Figure 5a) The first mutation type (Mu1) has a CTTG deletion at target site 1 of Ah08g165700 and an A-base insertion at target site 2, while also having a T-base insertion at target site 1 of Ah18g072600. Mu1 yielded 17 single plants from 6 T1 lines. The second mutation type (Mu2) has a TCTTG deletion at target site 1 of Ah08g165700 and a GTCTTG deletion at target site 1 of Ah18g072600, comprising 10 single plants from two T1 lines. The third mutation type (Mu3) has a TCTTGAGG deletion and a T-base insertion at target sites 1 of Ah08g165700 and Ah18g072600, respectively, comprising 3 single plants from two T1 lines. In addition, for phenotypic comparison, this study also included a negative control line and the wild-type (WT) YH9326. The pod and seed size of the negative control line was not significantly different from that of the wild-type YH9326, while the pods and seeds of the three mutants were significantly smaller than those of the negative control and wild-type. Figure 5 These results provide direct genetic evidence that AhYABBY plays a key role in the positive regulation of peanut pod and seed size.

[0048] Example 5: Development and Validation of Functional Molecular Markers

[0049] (1) Development of functional markers for Ah08YABBY gene deletion fragments

[0050]

[0051] (2) Development of functional markers for Ah18YABBY gene deletion fragments

[0052] The Ah18YABBY gene contains a 220 bp deletion in the third intron region, located after arahy.YH15.chr18:7359776. Based on the sequence difference of this 220 bp between the two parents, KASP primers (as described in claim 10) were designed. The sequence of the 100 bp before and after this region is as follows:

[0053] AGGAACTGGGATCATCCTCATCAAGATGCAACAAGTTATCAGCAGCATTTGATCCTGTAGACCATGATCCCCAACCTAGGATCCCTCCCATTCGTCGTGA[- / GTCTCACACTCCACAAATAAATACATGTTTCTTGTAGGAAAAAGAGGCTAATTTCTTTTGAACATACATATACACACAAATACATTTGTTTTTTGTCTCATTGAA AATAGTAGTTAGCATTTGGCATGATGATGATGATGAATCATGAAGCTAAAGTTAATTAATGAATGAATGAATGAAACAAGAGAGTACTTAACTAGGCCAGGCTGAAGGTGA]ACCTTTTGAGCCAGAAGTTGAGGACAAAAAAGACTCAGACTGAAAACTCTACAAGTGGCAGATGACAATTAATGGAAGAAGCAAAATAAACACACACATC

[0054] (3) KASP marker genotyping PCR system and amplification procedure

[0055] The PCR reaction system consisted of 1 μL: 1 μL template DNA (50-100 ng / μL). After drying, 1 μL of a mixture of 1×MasterMix and KASP primers was added. The primer volume was approximately 1.4% of the total reaction system.

[0056] KASP primer mixing solution: Prepare stock solutions of each of the four primers at a concentration of 100 μmol / L. The KASP primer mixing solution ratio is X:C1:Y:C2:water = 15:15:15:15:40.

[0057] The PCR amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, extension at 61℃-55℃ for 1 min, 10 cycles; 94℃ denaturation for 20 s, extension at 55℃ for 1 min, 26 cycles; storage at 10℃.

[0058] (4) Validate the functional marker in the “YH15×W1202” RIL population

[0059] DNA was extracted from each family in the “YH15×W1202” RIL population, and genotyping was performed on the functional markers of the Ah08YABBY and Ah18YABBY genes using the SNPLine genotyping platform. Figure 6 Of the 301 families successfully genotyped in this population, 54 families had mutations in both Ah08YABBY and Ah18YABBY; 96 families had a mutation in Ah08YABBY and Ah18YABBY was wild-type; 92 families had wild-type Ah08YABBY and a mutation in Ah18YABBY; and 59 families had both wild-type Ah08YABBY and Ah18YABBY. When both the Ah08YABBY and Ah18YABBY genes were mutated simultaneously, the 100-fruit weight (HPW) and 100-seed weight (HKW) were significantly lower than those with only one gene mutation or no mutation in either gene. Figure 7 The results showed that the two functional markers, Ah08YABBY and Ah18YABBY, were closely linked to peanut pod and kernel size, and could be used for marker-assisted selection of large-pod or small-pod peanut varieties.

[0060] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A gene AhYABBY that regulates peanut pod and seed size, characterized in that: The AhYABBY gene contains two homologous genes derived from two subgenomes of peanut, namely Ah08YABBY and Ah18YABBY; the Ah08YABBY gene is located on chromosome 8, and its full-length genome sequence is shown in SEQ ID NO.1; the Ah18YABBY gene is located on chromosome 18, and its full-length genome sequence is shown in SEQ ID NO.

2.

2. The AhYABBY gene according to claim 1, characterized in that: The wild-type CDS sequence of the Ah08YABBY gene is shown in SEQ ID NO.3, and the mutant CDS sequence is shown in SEQ ID NO.4; the wild-type CDS sequence of the Ah18YABBY gene is shown in SEQ ID NO.5, and the mutant CDS sequence is shown in SEQ ID NO.

6.

3. The AhYABBY gene according to claim 2, characterized in that: The wild-type protein sequence of the Ah08YABBY gene is shown in SEQ ID NO.7, and the mutant protein sequence is shown in SEQ ID NO.8; the wild-type protein sequence of the Ah18YABBY gene is shown in SEQ ID NO.9, and the mutant protein sequence is shown in SEQ ID NO.

10.

4. A PCR primer pair for amplifying the 999 bp deletion fragment in the Ah08YABBY gene of claim 1, characterized in that, The sequences of the primer pairs are shown in SEQ ID NO.11 and SEQ ID NO.

12.

5. A PCR primer pair for amplifying the 220 bp deletion fragment in the Ah18YABBY gene of claim 1, characterized in that, The sequences of the primer pairs are shown in SEQ ID NO.13 and SEQ ID NO.

14.

6. A KASP primer set for detecting the 999 bp deletion site of the Ah08YABBY gene as described in claim 1, characterized in that, The primer set includes two forward primers as shown in SEQ ID NO.17 and SEQ ID NO.18, and two universal reverse primers as shown in SEQ ID NO.19 and SEQ ID NO.

20.

7. A KASP primer set for detecting the 220 bp deletion site of the Ah18YABBY gene as described in claim 1, characterized in that, The primer set includes two forward primers as shown in SEQ ID NO.21 and SEQ ID NO.22, and two universal reverse primers as shown in SEQ ID NO.23 and SEQ ID NO.

24.

8. A specific primer pair for identifying AhYABBY gene-positive transgenic or gene-edited peanut lines as described in claim 1, characterized in that, The primer pairs are either the Ah08YABBY identification primer pair or the Ah18YABBY identification primer pair; the sequences of the Ah08YABBY identification primer pair are shown in SEQ ID NO.25 and SEQ ID NO.26; the sequences of the Ah18YABBY identification primer pair are shown in SEQ ID NO.27 and SEQ ID NO.

28.

9. The application of the primer pair or primer set according to any one of claims 4 to 8 in marker-assisted breeding of peanuts, characterized in that: Using the primer pairs or primer sets, PCR amplification or KASP detection is performed to identify the genotypes of the Ah08YABBY and / or Ah18YABBY genes in peanuts, and peanut plants or lines with superior pod and / or seed traits are screened.

10. A method for cultivating transgenic peanut varieties with enlarged pods and / or kernels, characterized in that, Includes the following steps: 1) Construct a recombinant plant expression vector containing the AhYABBY gene as described in claim 1; 2) Introduce the recombinant expression vector into peanut recipient cells or callus tissue; 3) Culture the transformed cells or callus tissue to obtain regenerated peanut plants; 4) Molecular testing and phenotypic identification were performed on the regenerated plants to screen for transgenic peanut lines with enlarged pods and / or kernels.

Images