A carrot whole genome 5k liquid breeding chip, a special probe combination and application thereof

Abstract

The application discloses a carrot 5K liquid breeding chip, a special probe combination thereof and application. The 5K liquid breeding chip provided by the application comprises a probe combination for detecting the genotypes of 5237 single nucleotide polymorphism variation sites in a carrot genome, and the position information of each single nucleotide polymorphism variation site corresponding to the probe in the carrot reference genome can be seen from Table 2 in the specification. The single nucleotide polymorphism variation sites involved in the liquid breeding chip provided by the application have the advantages of high polymorphism, good repeatability, stable and reliable markers, convenience in statistics and the like. The application can also establish a DNA fingerprint database for identifying the authenticity of carrot varieties based on the liquid breeding chip, and can be used for authenticating carrot varieties, early selection and identification of carrot varieties, identification of carrot seed resources, and providing technical support for rich carrot germplasm resources, selection of new varieties and protection of new varieties, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of carrot variety identification technology, specifically to a carrot whole genome 5K liquid phase breeding chip and its dedicated probe combination and application for detecting genotypes at 5237 single nucleotide polymorphism variation sites. Background Technology

[0002] Carrots (Daucus carota L.) are an important root vegetable crop, renowned as the "crown of vegetables" due to their high content of β-carotene and its unique polyacetylenes, which significantly benefit vision and enhance the body's immune function. Carrots are a globally popular vegetable, with strong demand in Europe, America, Japan, South Korea, South Asia, and Southeast Asia, making them highly sought after in the international market. In recent years, with the increasing awareness of healthy eating among the population, carrots have become an important part of my country's vegetable industry. my country cultivates approximately 8 million mu (about 533,333 hectares) of carrots annually, producing nearly 20 million tons, accounting for over 45% of the world's total production. However, carrots originated abroad, and the genetic base of domestic carrot resources is limited. Breeding techniques are relatively lagging, and the main varieties widely cultivated in production still rely heavily on imports from developed countries and regions such as Japan, South Korea, and Europe and America. Therefore, there is an urgent need to conduct research on carrot molecular breeding technology to accelerate the selection of breakthrough varieties and provide technical support for the independent and sustainable development of the carrot industry.

[0003] With the completion of the fine mapping of the carrot genome, high-density genomic variation data from nearly a thousand representative carrot germplasms have been obtained. Key functional genes regulating several important agronomic traits, such as root shape, root color, carotenoid accumulation, disease resistance, and bolting, have been successfully located, laying the foundation for molecular breeding of carrots. Liquid-phase breeding chips are a novel molecular marker detection technology that integrates high-throughput sequencing and liquid-phase hybridization capture. They offer advantages such as high flexibility, high data quality, and low cost, meeting the needs of large-scale population genetic screening as well as the fine analysis of small batches of breeding materials. Currently, liquid-phase chip technology has been widely used in germplasm resource evaluation, marker-assisted backcrossing, genome-wide association analysis, varietal DNA fingerprinting construction, and purity identification in crops such as maize, rice, wheat, and tomato. However, specific liquid-phase chip products for scenarios such as carrot varietal DNA fingerprinting identification and genome-wide selection breeding are still lacking. Therefore, developing a high-efficiency breeding liquid chip that covers key functional genes and representative SNP markers of the whole genome in carrots is of great practical significance for accelerating the genetic improvement of carrots, shortening the breeding cycle, protecting the intellectual property rights of varieties, and promoting independent innovation in my country's carrot seed industry. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a 5K liquid-phase breeding chip for the entire carrot genome, along with its dedicated probe combination and applications. This liquid-phase breeding chip can accurately, efficiently, specifically, non-interferingly, and stably obtain the genotypes of 5237 single nucleotide polymorphism (SNP) variant sites in the entire carrot genome. These 5237 SNP variant sites are characterized by high polymorphism, uniform distribution on chromosomes, and stable and reliable markers.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention provides a probe array for detecting combinations of single nucleotide polymorphism (SNP) sites in the whole carrot genome. Each SNP site corresponds to one probe, and the SNP site array includes 5237 SNP sites. The locations and base types of the 5237 SNP sites in the carrot genome are shown in Table 1 of this specification. The locations of the 5237 SNP sites in the genome are determined based on the carrot DH1 V3 reference genome. In Table 1, the numbers on the left indicate the chromosome number where the SNP site is located, the values ​​in the middle indicate the physical location of the chromosome where the SNP site is located, and the letters on the right indicate the two base types of the SNP site.

[0006] In the probe combination of the first aspect of the present invention, as a preferred embodiment, the corresponding positions of the nucleotide sequences of each probe in the genome are shown in Table 2 of the specification of the present invention. The information of each probe's corresponding position includes three data points. From left to right, the first data point represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data point represents the start position on the chromosome where the probe is located, and the third data point represents the end position on the chromosome where the probe is located. The corresponding position of each probe in the genome is determined based on the carrot DH1 V3 reference genome.

[0007] A second aspect of the present invention provides a carrot whole genome 5K liquid phase breeding chip, which includes the probe combination described in the first aspect of the present invention for detecting combinations of single nucleotide polymorphism variation sites in the carrot whole genome.

[0008] The carrot whole genome 5K liquid phase breeding chip targets the single nucleotide polymorphism variation sites in the carrot whole genome as described in the first aspect, in order to obtain base information or genotyping of polymorphic sites.

[0009] Liquid-phase breeding chips can also contain other commonly used reagents or equipment.

[0010] A third aspect of the present invention provides the use of the probe combination of the first aspect described above for detecting combinations of single nucleotide polymorphism variant sites in the whole genome of carrot, said use including any one of (1) to (7) below: (1) A kit for preparing a carrot variety identification kit; (2) A kit for preparing a method to identify the authenticity of carrot varieties; (3) A kit for preparing and analyzing the genetic relationships of carrot varieties; (4) Used for identifying carrot varieties; (5) Used to identify the authenticity of carrot varieties; (6) Used to analyze the genetic relationships of carrot varieties; (7) Used to construct a fingerprint database of the carrot varieties to be tested.

[0011] The fourth aspect of the present invention provides the use of the carrot whole genome 5K liquid phase breeding chip of the second aspect above, the use including any one of the following (A) to (D); (A) Used to identify carrot varieties; (B) Used to identify the authenticity of carrot varieties; (C) Used to analyze the genetic relationships of carrot varieties; (D) Used to construct a fingerprint database of the carrot varieties to be tested.

[0012] The fifth aspect of this invention provides a method for constructing a fingerprint database of tested carrot varieties, comprising the following steps: S1-1: Obtain genomic DNA from the tested carrot variety; S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library; S1-3: Combine the DNA library with the probes from the first aspect above to form a hybridization system and perform hybridization capture, then purify to obtain a sequencing library; S1-4: Sequencing and data analysis were performed on the sequencing library to obtain the genotyping information of the 5237 single nucleotide polymorphism (SNP) variant sites shown in Table 1 of this specification. Based on the genotyping information of the 5237 SNP variant sites, a fingerprint database of the tested carrot varieties was constructed.

[0013] The sixth aspect of this invention provides a method for identifying a carrot variety to be tested, comprising the following steps: S2-1: Obtain the genomic DNA of the carrot variety to be tested and the standard carrot variety, respectively; S2-2: The genomic DNA of each variety obtained in step S2-1 is broken, end-repaired, adapter-ligated, and purified to obtain the DNA library of the corresponding variety; S2-3: Combine the DNA libraries of each variety with the probes in the first aspect above to form a hybridization system and perform hybridization capture. After purification, obtain the sequencing libraries of each variety. S2-4: Sequencing and data analysis were performed on the sequencing libraries of each variety to obtain the genotyping information of the 5237 single nucleotide polymorphism variant sites shown in Table 1 of this specification in each variety; S2-5: The genotyping results of 5237 single nucleotide polymorphism (SNP) variants in the tested carrot variety were compared with those of 5237 SNP variants in the standard carrot variety. The SNP similarity (LS) between the two carrot varieties was calculated using the formula: LS = (1-D / T)×100%, where D is the number of differentially expressed SNP variants between the two varieties, and T is the total number of SNP variants compared. Then, the following judgments were made: If the similarity of the tested carrot variety with a certain standard carrot variety is ≥98.0%, then the tested carrot variety and the standard carrot variety are the same variety or are suspected to be the same variety; the fewer the number of different sites, the higher the variety similarity. If the site similarity between the tested carrot variety and a certain standard carrot variety is between 95.0% and 98.0% but does not include 98%, then the tested carrot variety and the standard carrot variety are similar varieties. If the site similarity between the carrot variety to be tested and a certain standard carrot variety is <95.0%, then the carrot variety to be tested and the standard carrot variety are different varieties.

[0014] The standard carrot varieties mentioned in this invention refer to known carrot varieties, such as the 190 carrot varieties recorded in Table 3 of this invention.

[0015] In the method for constructing the fingerprint database of tested carrot varieties in the fifth aspect above or the method for identifying the carrot varieties to be tested in the sixth aspect above, as one possible implementation, in step S1-2 or S2-2, the fragmentation and end repair are carried out by a system containing fragmentation and end repair enzymes. The system is: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water to make up to 20 μL.

[0016] In the method for constructing the fingerprint database of tested carrot varieties in the fifth aspect above or the method for identifying the carrot varieties to be tested in the sixth aspect above, as one possible implementation, in step S1-2 or S2-2, the reaction system for the adapter ligation consists of 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina TrueSeq universal adapter sequence, and ultrapure water to a final volume of 20 μL.

[0017] In the method for constructing the fingerprint database of tested carrot varieties in the fifth aspect above or the method for identifying the carrot varieties to be tested in the sixth aspect above, as one possible implementation, in step S1-3 or S2-3, the hybridization system is 2.5 μg of concentrated DNA library obtained in step S1-2 or step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and ultrapure water to make up the system to 16 μL.

[0018] The beneficial effects of this invention are: (1) The single nucleotide polymorphism variation site combination provided by the present invention has the advantages of high polymorphism, good repeatability, uniform distribution on chromosomes, stable and reliable markers and easy statistics, which can reflect the genetic kinship of the tested carrot varieties to the greatest extent.

[0019] (2) The material background of the single nucleotide polymorphism variation site combination involved in the liquid phase breeding chip of the present invention covers a wider range of carrot varieties, with high representativeness and rich diversity information.

[0020] (3) The probe combination provided by the present invention can accurately, efficiently, specifically, without interference, and stably obtain the genotypes of 5237 single nucleotide polymorphism variation sites in the whole carrot genome.

[0021] (4) The 5K liquid phase breeding chip provided by the present invention can be applied to the identification of the authenticity of carrot varieties, identification of kinship, hybridization and selection and fingerprint pattern construction, which is conducive to accelerating the process of carrot research and breeding.

[0022] (5) This invention provides for the first time a method for constructing a DNA fingerprint database for identifying the authenticity of carrot varieties based on high-throughput sequencing. It can be used to identify carrot varieties at an early stage of seed or seedling stage, ensuring the authenticity of varieties, effectively protecting the rights and interests of producers and breeders, and providing technical support for the protection of carrot germplasm resources and new varieties.

[0023] (6) The method for identifying carrot varieties provided by the present invention can identify unknown carrot varieties as well as verify the authenticity of known varieties.

[0024] (7) The carrot variety identification method provided by the present invention has the advantages of high throughput, accuracy, low cost, simple operation, and saving manpower and material resources, and has a very broad application prospect. Attached Figure Description

[0025] Figure 1 This is a distribution map of single nucleotide polymorphism variation sites of the 5K liquid-phase breeding chip of the present invention on the carrot genome.

[0026] Figure 2 The genotype detection rate of the 5K liquid phase breeding chip of this invention in 190 representative carrot varieties is shown.

[0027] Figure 3 The MAF values ​​of the genotypes in 190 representative carrot varieties are represented by the 5K liquid phase breeding chip of this invention.

[0028] Figure 4 This paper presents the genetic similarity distribution of 190 carrot varieties using the 5K liquid-phase breeding chip of this invention.

[0029] Figure 5 The results of clustering fingerprint profiles of 190 carrot varieties using the 5K liquid phase breeding chip of this invention are shown.

[0030] Figure 6 This is a background recovery rate distribution diagram of 96 individual plants in the BC2F1 population using the 5K liquid phase breeding chip of the present invention. In the diagram, blue represents the proportion of each individual plant with the same genotype as the recurrent parent, and orange represents the proportion of each individual plant with the same genotype as the donor parent. Detailed Implementation

[0031] The following embodiments and accompanying drawings are provided to facilitate a better understanding of the present invention. They are intended to explain in detail one aspect or certain features of the present invention, but do not constitute a limitation on the present invention.

[0032] Unless otherwise stated, the technical and scientific terms used in this invention have their common meaning in the art.

[0033] Any improvements or extensions to the embodiments of the present invention without departing from the spirit or scope of the present invention shall fall within the protection scope of the present invention.

[0034] Unless otherwise specified, the experimental methods described in the following examples are conventional methods. For liquid-phase chip application methods not described in detail in the specification, please refer to (Targeted Sequencing Genotyping (GBTS) Technology and Its Application, 2020).

[0035] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0036] Example 1: Acquisition of single nucleotide polymorphism (SNP) variation sites from a 5K liquid-phase breeding chip in the whole carrot genome. This invention is based on 653 carrot resequencing datasets published on the NCBI website (https: / / www.ncbi.nlm.nih.gov / biosample?Db=biosample&DbFrom=bioproject&Cmd=Link&LinkName=bioproject_biosample&LinkReadableName=BioSample&ordinalpos=1&IdsFromResult=865653) to screen for SNP variants that can represent the whole genome genetic information of cultivated carrots and are suitable for liquid-phase microarray analysis. Specifically, the polymorphism screening criteria for SNP loci are as follows: first, a deletion rate (Miss < 0.2), a heterozygosity (He < 0.1), and a minimum allele frequency (MAF) > 0.15. In addition, the screened single nucleotide polymorphisms (SNPs) had no other SNPs, SSRs, or Indels within a 200 bp radius on either side, and each SNP locus could be successfully converted into a KASP molecular marker. Ultimately, the inventors of this invention obtained 116,843 high-quality SNP loci and further screened 5,237 single nucleotide polymorphism (SNP) variants based on their uniform distribution across chromosomes for use in carrot 5K liquid-phase breeding chips. The locations and variant bases of these 5,237 SNP variants on carrot chromosomes are shown in Table 1, and their distribution across the nine carrot chromosomes is shown in [Table 1]. Figure 1 The base types and physical locations on chromosomes of the aforementioned single nucleotide polymorphism (SNP) variant sites were determined based on the carrot DH1V3 reference genome (https: / / ftp.ncbi.nlm.nih.gov / genomes / all / GCF / 001 / 625 / 215 / GCF_001625215.2_DH1_v3.0 / ). The SNP variant sites involved in the carrot 5K breeding liquid-phase microarray were evenly distributed on the chromosome, with an average physical distance of 81.99 kb between each site, and 37.1% of the variant sites were located in gene exons.

[0037] Table 1. Location and base information of 5237 single nucleotide polymorphism variants on chromosomes. Note: In the single nucleotide polymorphism (SNP) variant site information, the leftmost data is the chromosome number where the SNP variant site is located, the middle value is the physical location of the chromosome where the SNP variant site is located, and the rightmost value is the two genotypes of the SNP variant site.

[0038] Example 2: Probe preparation for carrot 5K liquid phase breeding chip The carrot 5K liquid-phase breeding chip includes 5237 probe combinations, each probe hybridizing with a single nucleotide polymorphism (SNP) variant region to form a double strand. Based on the base pairing principle, oligonucleotide probes complementary to the target sequence are designed, with the probe combination design principles as follows: (1) The probe length is 190 bp on average, with single nucleotide polymorphisms in the middle of the probe and 90-110 bp on the flanking sequences; (2) The probe is located in a relatively conservative region (with no other variations in the 50bp on both sides), avoiding regions with repetitive sequences, structural variations, etc. (3) The GC content of the probe is 40%-60%, with a stronger capture ability in the 50% region, avoiding high GC and high AT regions.

[0039] The sequence information of 5237 probes in the carrot 5K liquid phase breeding chip is shown in Table 2.

[0040] The probe sequences in Table 2 are synthesized from single-stranded nucleotides with an average length of 190 bp, and are polystyrene microspheres with a biotin group modified at the 5' end and covalently coupled to biotin.

[0041] Table 2. Probe location information of the 5K liquid phase breeding chip for carrots. Note: In the probe information, the leftmost data is the chromosome number where the single nucleotide polymorphism variant site or probe sequence is located, the middle data is the start position of the probe on the chromosome, and the rightmost value is the end position of the probe on the chromosome.

[0042] Example 3: Evaluation of the genotype detection efficiency of carrot 5K liquid phase breeding chip A 5K liquid-phase breeding chip for carrot whole genome involves single nucleotide polymorphism (SNP) variant sites listed in Table 1 of Example 1 above. This liquid-phase breeding chip includes the probe combination from Example 2. Specifically, 5237 SNP variant sites correspond to 5237 probes, and each probe hybridizes with one SNP variant site to form a double strand.

[0043] To evaluate the genotyping efficiency of 5237 single nucleotide polymorphism (SNP) variant sites, the carrot 5K liquid phase breeding chip of this invention was used to perform SNP variant genotyping on 190 carrot hybrids collected from China.

[0044] The basic information of the 190 tested carrot varieties in this embodiment is shown in Table 3. All 190 tested carrot varieties are common and excellent varieties in production or some are introduced varieties from abroad.

[0045] Table 3. Information on 190 carrot varieties The detection method of carrot 5K liquid phase breeding chip includes specific steps such as obtaining genomic DNA, library construction, hybridization capture, sequencing and data analysis.

[0046] 1. Obtaining genomic DNA from the tested carrot varieties Genomic DNA was extracted from the leaves of 190 tested carrot varieties using SDS and magnetic bead methods, respectively, to obtain the genomic DNA of the tested carrot varieties.

[0047] The quality and concentration of genomic DNA from the tested carrot varieties must meet the requirements for PCR. The standards are as follows: 1% agarose gel electrophoresis shows a single DNA band without obvious diffusion; the A260 / A230 ratio is greater than 2.0 and the A260 / A280 ratio is around 1.8, as detected by a Nanodrop2000 (Thermo) UV spectrophotometer; and the concentration of genomic DNA from the tested carrot varieties is >50 ng / μL.

[0048] 2. Library Construction Take 300 ng of quality-tested DNA, add 2.6 μL of fragmentation and end-repair enzyme, 4 μL of end-repair reaction buffer, and ultrapure water to a final volume of 20 μL. Then, incubate at 37°C for 30 min and 72°C for 30 min. After fragmentation and repair by the end-repair enzyme, an A will be added to the 3' end of the DNA. Using 10 ng of the repaired DNA obtained in the previous step, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of the Illumina TrueSeq universal adapter sequence (AATGATACGGCGACCACCGAGATCTACAC, sequence 1), and ultrapure water to a final volume of 20 μL, the mixture was incubated at 22°C for 60 min. The DNA fragment with added DNA (A) was ligated to the adapter. PCR amplification was used to ligate the index and sequence from the sequencer to both ends of the adapter-containing DNA fragment, forming a complete library structure. The library was purified and fragments were selected by adding purification beads and mixing by pipetting or vortexing. The purified and selected fragments were then mixed in equal volumes to form a mixed library.

[0049] 3. Hybrid capture The mixed library was concentrated to a dry powder state and then added to the hybridization system for hybridization capture. 2.5 μg of the concentrated library was added to 4 μL of 50 ng / μL probe working solution, and ultrapure water was added to bring the total volume to 16 μL. The mixture was then incubated at 95°C for 10 min and then at 65°C for 2–4 h. After hybridization, 16 μL of the hybridization capture solution was transferred to prepared magnetic beads. The enriched product was purified to complete the preparation of the sequencing library.

[0050] 4. Sequencing and data analysis The purified products were mixed in equal volumes to obtain a sequencing library, which was then subjected to high-throughput sequencing using a BGI T7 sequencer. The raw sequencing bases were split according to the barcodes of different samples, low-quality sequencing data were filtered out, and the data were compared with the carrot DH1V3 reference genome to mine single nucleotide polymorphism (SNP) variation information. Based on the obtained SNP information, the corresponding SNP genotypes were derived, thereby constructing the fingerprint profile of the tested varieties.

[0051] 5. Efficiency Evaluation After testing 190 carrot samples, the average genotype detection rate of the carrot 5K liquid phase breeding chip was 97.11%. Figure 2 The detection rate of 77 sample materials was 97%-98%, with the highest detection rate reaching 99% and the lowest reaching 94%. The genotype data detection rate of the carrot 5K liquid phase breeding chip provided by this invention is high. By statistically analyzing the polymorphism information content (MAF) of 5237 single nucleotide polymorphism variations, 96.4% of the single nucleotide polymorphism variation sites had an MAF value greater than 0.1, with an average MAF of 0.325. Figure 3 This indicates that the carrot 5K liquid phase breeding chip developed in this invention has high polymorphism in 190 carrot test varieties.

[0052] Example 4: Method for detecting whether a carrot variety belongs to one of 190 tested carrot varieties 1. Obtaining genomic DNA from the carrot variety to be tested The leaves of the carrot variety “Huayu 268” to be tested were taken from the experimental base of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences.

[0053] Following the method in step 1 of Example 3, replace "the leaf of the tested carrot variety" with "the leaf of the carrot variety to be tested", and keep all other steps unchanged to obtain the genomic DNA of the carrot variety to be tested.

[0054] 2. Preparation of sequencing libraries Following the method in step 2 of Example 3, replace "genomic DNA of the tested carrot variety" with "genomic DNA of the carrot variety to be tested", and keep all other steps unchanged to obtain the sequencing library of the carrot variety to be tested.

[0055] 3. Hybrid capture Perform the procedure according to step 3 in Example 3.

[0056] 4. Sequencing Sequencing was performed on the sequencing library of the carrot variety to be tested.

[0057] The sequencing results of 5237 single nucleotide polymorphism (SNP) amplification products of the tested carrot varieties in the carrot 5K liquid phase breeding chip were compared with 5237 SNP variant sites of 190 tested carrot varieties (as shown in Table 3). The site similarity (LS) between the two carrot varieties was statistically analyzed. The formula for calculating LS is: LS = (1-D / T)×100%, where D is the number of differentially expressed sites between the two samples being compared, and T is the total number of sites being compared.

[0058] Then, the following judgment is made: If the locus similarity between the tested carrot variety and a standard carrot variety (the tested carrot variety) is ≥98.0%, then the tested carrot variety and the standard carrot variety are suspected to be the same variety; the fewer the number of different loci, the higher the locus similarity. If the site similarity between the tested carrot variety and a standard carrot variety (the tested carrot variety) is between 95.0% and 98.0% but does not include 98%, then the tested carrot variety and the standard carrot variety are similar varieties.

[0059] If the site similarity between the carrot variety to be tested and a certain standard carrot variety is <95.0%, then the carrot variety to be tested and the standard carrot variety are different varieties.

[0060] The results showed that the genetic similarity of the tested carrot variety to 190 tested carrot varieties was 91.3% at 5237 single nucleotide polymorphism variation sites. Therefore, the tested carrot variety does not belong to any of the 190 tested carrot varieties, that is, the tested carrot variety "Huayu 268" is different from any of the 190 tested carrot varieties.

[0061] Example 6: Constructing a DNA fingerprint database of 190 carrot varieties The carrot 5K liquid-phase breeding chip developed in this invention can be used to construct a DNA fingerprint database of 190 carrot varieties, establishing a unique DNA fingerprint molecular identity card for each variety resource. Figure 5 ).

[0062] Based on the 5237 nucleotide variation information in Example 1 and the 190 tested carrot varieties in Implementation Case 3, the method in Example 3 can be used to quickly construct a DNA fingerprint database of 190 carrot varieties, providing data support for whether newly collected variety resources should be introduced into the DNA fingerprint database in the future.

[0063] Example 7: Screening for single plants that rapidly restore background in backcross breeding. The carrot 5K liquid phase breeding chip developed in this invention can be used to identify and quickly determine the donor and recipient genome percentages of each individual plant in backcross selection progeny, providing data support for screening backcross progeny with high background recovery rates.

[0064] Based on the 5237 nucleotide variation information in Example 1, seedling genotyping was performed on 96 individual plants from the BC2F1 population constructed from the donor parent XIN9524 and the recurrent parent ZD2601. 2514 SNP variations showing differences between the donor and recurrent parents were screened. The proportion of individual plants with the same genotype as the recurrent parent was calculated. A genotype proportion of 98% from the recurrent parent was used as the selection criterion for restoring the recurrent parent background. Finally, one individual plant was selected. Figure 6 Furthermore, its field phenotype is not significantly different from that of the recurrent parent, which significantly improves identification efficiency and saves field planting costs.

Claims

1. A probe array for detecting combinations of single nucleotide polymorphism (SNP) variant sites in the whole carrot genome, wherein each SNP corresponds to one probe, and the SNP combination comprises 5237 SNP sites. The locations and base types of the 5237 SNP sites in the carrot genome are shown in Table 1 of the specification. In the information for each single nucleotide polymorphism (SNP) variant site, the number on the left indicates the chromosome number where the SNP variant site is located, the value in the middle indicates the physical location of the chromosome where the SNP variant site is located, and the letter on the right indicates the two base types of the SNP variant site. The locations of the 5237 single nucleotide polymorphism variants in the genome were determined based on the carrot DH1 V3 reference genome.

2. The probe assembly for detecting combinations of single nucleotide polymorphism variant sites in the carrot genome according to claim 1, characterized in that, The corresponding positions of the nucleotide sequences of each probe in the probe combo in the genome are shown in Table 2 of the specification. The information of each probe position contains three data points. From left to right, the first data point represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data point represents the start position of the probe on the chromosome, and the third data point represents the end position of the probe on the chromosome. The corresponding position of each probe in the genome was determined based on the carrot DH1 V3 reference genome.

3. A 5K liquid-phase breeding chip for the whole genome of carrots, characterized in that, Includes the probe combination for detecting combinations of single nucleotide polymorphism variation sites in the whole genome of carrot as described in claim 1 or 2.

4. The application of the probe assembly, characterized in that, The probe combination is the probe combination for detecting single nucleotide polymorphism variation sites in the whole genome of carrot as described in claim 1 or 2, and the use includes any one of the following (1) to (7): (1) A kit for preparing a carrot variety identification kit; (2) A kit for preparing a method to identify the authenticity of carrot varieties; (3) A kit for preparing and analyzing the genetic relationships of carrot varieties; (4) Used for identifying carrot varieties; (5) Used to identify the authenticity of carrot varieties; (6) Used to analyze the genetic relationships of carrot varieties; (7) Used to construct a fingerprint database of the carrot varieties to be tested.

5. The application of the carrot whole genome 5K liquid phase breeding chip, characterized in that, The carrot whole genome 5K liquid phase breeding chip is the carrot whole genome 5K liquid phase breeding chip according to claim 3, and the use includes any one of the following (A) to (D); (A) Used to identify carrot varieties; (B) Used to identify the authenticity of carrot varieties; (C) Used to analyze the genetic relationships of carrot varieties; (D) Used to construct a fingerprint database of the carrot varieties to be tested.

6. A method for constructing a fingerprint database of tested carrot varieties, characterized in that, Includes the following steps: S1-1: Obtain genomic DNA from the tested carrot variety; S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library; S1-3: The DNA library is combined with the probe combination for detecting single nucleotide polymorphism variation sites in the whole genome of carrot as described in claim 1 or 2 to form a hybridization system and perform hybridization capture, and then purified to obtain a sequencing library; S1-4: Sequencing and data analysis of the sequencing library to obtain the genotyping information of the 5237 single nucleotide polymorphism (SNP) variant sites as described in claim 1, and constructing a fingerprint database of the tested carrot varieties based on the genotyping information of the 5237 SNP variant sites.

7. A method for identifying a carrot variety to be tested, characterized in that, Includes the following steps: S2-1: Obtain the genomic DNA of the carrot variety to be tested and the standard carrot variety, respectively; S2-2: The genomic DNA of each variety obtained in step S2-1 is broken, end-repaired, adapter-ligated, and purified to obtain the DNA library of the corresponding variety; S2-3: The DNA libraries of each variety are respectively combined with the probes described in claim 1 or 2 for detecting single nucleotide polymorphism variation sites in the whole genome of carrot to form a hybridization system and perform hybridization capture, and the sequencing libraries of each variety are obtained after purification. S2-4: Sequencing and data analysis were performed on the sequencing libraries of each variety to obtain the genotyping information of the 5237 single nucleotide polymorphism variant sites as described in Table 1 of each variety; S2-5: The genotyping results of 5237 single nucleotide polymorphism (SNP) variants in the tested carrot variety were compared with those of 5237 SNP variants in the standard carrot variety. The SNP similarity (LS) between the two carrot varieties was calculated using the formula: LS = (1-D / T)×100%, where D is the number of differentially expressed SNP variants between the two varieties, and T is the total number of SNP variants compared. Then, the following judgments were made: If the site similarity between the carrot variety to be tested and a certain standard carrot variety is greater than or equal to 98.0%, then the carrot variety to be tested and the standard carrot variety are the same variety. If the site similarity between the tested carrot variety and a certain standard carrot variety is between 95.0% and 98.0% but does not include 98%, then the tested carrot variety and the standard carrot variety are similar varieties. If the site similarity between the carrot variety to be tested and a certain standard carrot variety is less than 95.0%, then the carrot variety to be tested and the standard carrot variety are different varieties.

8. The method for identifying the carrot variety to be tested according to claim 7, characterized in that, In step S2-2, the fragmentation and end repair are performed using a system containing fragmentation and end repair enzymes. The system consists of: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water to bring the total volume to 20 μL.

9. The method for identifying the carrot variety to be tested according to claim 7, characterized in that, In step S2-2, the reaction system for adapter ligation consists of 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina TrueSeq universal adapter sequence, and ultrapure water to a final volume of 20 μL.

10. The method for identifying the carrot variety to be tested according to claim 7, characterized in that, In step S2-3, the hybridization system consists of 2.5 μg of concentrated DNA library obtained in step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and ultrapure water to make up the system to 16 μL.

Images