Application of SQLE mutant site of microsporum canis, and SQLE mutant gene and mutant protein of microsporum canis

Abstract

This application relates to the field of fungal resistance detection technology and discloses Microsporum canis. SQLE Application of mutation sites and Microsporum canis SQLE Mutant gene and mutant protein. The mutation site includes an amino acid substitution occurring at position 391 and / or position 395 of the SQLE protein, and the gene encoding said amino acid substitution. SQLE Gene base mutation; this mutation site can serve as a detection target to assess reduced in vitro susceptibility of *Microsporum canis* to terbinafine, high minimum inhibitory concentration (MIC) phenotype, and / or potential resistance risk. The mutation can be detected by sequence analysis, allele-specific qPCR, or CRISPR-associated nuclease assays to assess reduced in vitro susceptibility of *Microsporum canis* to terbinafine, high MIC phenotype, and / or potential resistance risk. This application can shorten the terbinafine susceptibility evaluation cycle for *Microsporum canis* and provide technical support for related resistance risk monitoring and antifungal drug screening.

Description

Technical Field

[0001] This application relates to the field of fungal resistance detection technology, and in particular to a method, detection kit and application of assessing terbinafine sensitivity based on the mutation site of Microsporum canis squalene epoxidase (SQLE). Background Technology

[0002] Microsporum canis ( Microsporum canis Microsporum canis is an important zoophilic dermatophyte pathogen that primarily infects companion animals such as dogs and cats, causing dermatophytosis, characterized by clinical symptoms such as hair loss, scaling, itching, and inflammatory reactions. Simultaneously, Microsporum canis poses a certain zoonotic risk, as it can be transmitted from animals to humans, causing dermatophyte infections in humans. Therefore, its prevalence and control have received widespread attention. Existing studies have shown that Microsporum canis is one of the most common pathogens of canine and feline dermatophytosis, exhibiting a high detection rate in canine and feline dermatophyte cases in different regions. Some studies report a detection rate exceeding 80%, making it an important target for the prevention and control of dermatophytosis in companion animals.

[0003] Terbinafine is a commonly used allylamine antifungal drug in clinical practice, exhibiting strong bactericidal activity against various dermatophytes. It primarily exerts its antifungal effect by specifically inhibiting the activity of squalene epoxidase (SQLE), blocking the fungal ergosterol biosynthesis pathway, leading to squalene accumulation and disruption of cell membrane structure. Therefore, terbinafine is widely used in the treatment of dermatophyte infections in dogs and cats.

[0004] However, with the long-term and widespread use of terbinafine in clinical treatment, some dermatophytes have gradually shown decreased sensitivity to the drug or even resistance, leading to prolonged treatment cycles, increased risk of recurrence, and greater difficulty in infection control. Existing research indicates that... SQLE Mutations in the coding gene are one of the important molecular mechanisms by which dermatophytes develop terbinafine resistance. Previous reports have shown that substitutions at multiple key amino acid sites in the SQLE protein are associated with elevated terbinafine MICs and resistance phenotypes; for example, mutations such as F395L can be detected in some terbinafine-sensitive strains. However, due to differences in fungal species, geographical origin, and drug selection pressures, [further details are needed]. SQLE Mutations are diverse, and the reported mutation sites cannot fully cover novel variations that appear in clinical samples.

[0005] Currently, the evaluation of *Microsporum canis* susceptibility to terbinafine mainly relies on traditional in vitro drug susceptibility testing, including steps such as strain isolation, culture, drug exposure, and minimum inhibitory concentration (MIC) determination. This method typically requires a long testing cycle and depends on specialized laboratory conditions, making it difficult to meet the needs of rapid clinical screening and precise medication. Furthermore, detection methods based on known resistance mutation sites usually target single or a few reported mutations, limiting their detection range and making them unsuitable for detecting novel mutations. SQLE There is a risk of missed detection due to mutated strains.

[0006] Therefore, there is an urgent need to establish a method based on Microsporum canis. SQLE A rapid molecular detection method for key mutation sites, by detecting those associated with decreased terbinafine sensitivity. SQLE The mutation enables rapid evaluation of reduced drug sensitivity, high MIC phenotypes, and potential drug resistance risks in Microsporum canis, providing technical support for rational drug use and drug resistance monitoring in clinical practice. Summary of the Invention

[0007] The purpose of this application is to provide a method, detection system, and application for terbinafine sensitivity evaluation based on the squalene epoxidase (SQLE) mutation site in Microsporum canis. This addresses the shortcomings of existing technologies, which primarily rely on traditional in vitro drug susceptibility testing for terbinafine sensitivity evaluation in Microsporum canis. These methods suffer from long detection cycles, complex operations, limited coverage of known mutation sites, and difficulty in timely identification of novel carriers. SQLE This technology addresses issues such as variant strains, enabling rapid evaluation of reduced terbinafine susceptibility, high MIC phenotypes, and potential resistance risks in Microsporum canis.

[0008] In order to solve the above-mentioned technical problems, achieve the above-mentioned objectives, or at least partially solve the above-mentioned technical problems, as the first aspect of this application, Microsporum canis is provided. SQLE The application of mutation sites as detection targets in assessing reduced susceptibility to terbinafine, high MIC phenotype, and / or potential resistance risk in Microsporum canis. SQLE The mutation sites include the amino acid substitutions at positions 391 and / or 395 of the *Microsporum canis* squalene epoxidase (SQLE) protein, or their corresponding sites. SQLE The site of gene base mutation. Optionally, the... SQLEThe mutation site includes one or more of L391F, L391S, F395I and F395L, and is not F395L alone; for example, L391F, L391S or F395I, for example, L391F and F395I, for example, L391F and F395L, for example, L391S and F395I, for example, L391S and F395L.

[0009] As a second aspect of this application, a method based on Microsporum canis is provided. SQLE Methods for assessing sensitivity to terbinafine through mutation detection include: (1) Obtain nucleic acid samples of the Microsporum canis strain to be tested; (2) Detect the nucleotide sequence in the nucleic acid sample that contains the coding region of amino acid 391 and / or 395 of the SQLE protein; (3) Determine, based on the nucleotide sequence, whether there exists an amino acid substitution at position 391 and / or position 395 of the SQLE protein. SQLE Gene mutation; (4) Assess the reduced sensitivity of Microsporum canis to terbinafine, high MIC phenotype or potential drug resistance risk based on mutation detection results.

[0010] As a third aspect of this application, a method for detecting Microsporum canis is provided. SQLE A kit for detecting mutation sites. The kit includes components for detecting the above-mentioned mutation sites. SQLE Detection reagents for mutation sites.

[0011] Optionally, the detection reagent includes a PCR amplification detection system, a real-time quantitative PCR (qPCR) detection system, and / or a CRISPR nucleic acid detection system. This application also provides a corresponding detection method for *Microsporum canis*. SQLE The application of reagents targeting mutation sites in the preparation of kits for assessing the susceptibility of *Microsporum canis* to terbinafine, wherein *Microsporum canis* SQLE See the description of the mutation site in the first aspect of this application.

[0012] Optionally, the PCR amplification detection system includes a method for amplifying Microsporum canis. SQLE PCR amplification primers for the mutant gene region, of the *Microsporum canis* SQLE The mutation site gene region contains a nucleotide region encoding amino acids 391 and / or 395 of the SQLE protein, and can be determined by sequence analysis of the PCR amplification product. SQLE Does the gene contain a corresponding mutation?

[0013] Optionally, the qPCR detection system includes primers for amplifying nucleic acid fragments containing the coding region of amino acids 391 and / or 395 of the SQLE protein, and primers for distinguishing *Microsporum canis*. SQLE Allele-specific detection probes for wild-type and mutant sequences of the mutation site. The allele-specific detection probes include wild-type probes targeting the L391 site of the SQLE protein, such as the L391F mutant probe and / or the L391S mutant probe, and wild-type probes targeting the F395 site of the SQLE protein, such as the F395I mutant probe and / or the F395L mutant probe, used to detect the presence of nucleotide mutations corresponding to SQLE amino acid substitutions in the sample. For the F395L mutation, this application is based on the Microsporum canis-specific background and other... SQLE The mutation combination detection system is protected, as detailed in the different descriptions in the first aspect of this application. SQLE Mutant combinations.

[0014] Optionally, the CRISPR nucleic acid detection system includes CRISPR-related nucleases and targeted Microsporum canis. SQLE crRNA targeting the mutation site region and nucleic acid reporter molecules. The crRNA targets include... SQLE The nucleic acid region at bases 1172, 1173, and / or 1183 of the mutation site is used to recognize gene mutations corresponding to amino acid substitutions at positions 391 and / or 395 of the SQLE protein. The CRISPR-associated nuclease is selected from Cas12a, Cas12b, and variants with trans-nucleotide cleavage activity.

[0015] As a fourth aspect of this application, a strain model for evaluating the activity of drugs against *Microsporum canis* is provided. The strain is a carrier... SQLE Microsporum canis strains with mutation sites. Optionally, the... SQLE The mutation sites include the L391F mutation site, which can also be understood as the ability to express SQLE proteins containing the L391F amino acid substitution. The strain is relative to... SQLE Wild-type Microsporum canis exhibits decreased terbinafine susceptibility and / or increased terbinafine minimum inhibitory concentration (MIC).

[0016] As a fifth aspect of this application, a method is provided for screening anti-Microsporum canis drugs using the above-described strains. The method includes mixing a candidate drug with the strain carrying... SQLE The mutant Microsporum canis strain was exposed to the drug, and the inhibitory effect of the candidate drug on the growth, reproduction, or survival of the strain was detected. Based on the inhibitory effect, candidate drugs with anti-Microsporum canis activity were screened.

[0017] This application uses Microsporum canisSQLE Key mutation sites were used as molecular detection targets for terbinafine sensitivity evaluation. A rapid detection strategy based on genetic markers was established, which can effectively identify carriers. SQLE The anomalous variant of *Microsporum canis* strain overcomes the limitations of existing technologies that rely on traditional antimicrobial susceptibility testing and detection of single known mutations, resulting in long detection cycles and limited coverage. Furthermore, the PCR, qPCR, and CRISPR nucleic acid detection systems provided in this application can target different forms of... SQLE Rapid detection of mutations improves the efficiency of terbinafine sensitivity evaluation for Microsporum canis, providing technical support for precision clinical drug use, drug resistance monitoring, and antifungal drug screening. Attached Figure Description

[0018] The accompanying drawings, which form part of this application, are used to provide a further understanding of this application. The illustrative embodiments of this application and their descriptions are used to explain this application and do not constitute an improper limitation of this application. Figure 1 The figure shows the statistical results of the quantity distribution of three dermatophyte species; Figure 2 The images shown are morphological images of three dermatophytes and microscopic images of their spores (40×); AC represent the morphological images of Microsporum canis, Nenestella gypseum, and Trichophyton mentagrophytes, respectively; DF represent the macroconidia of Microsporum canis and Nenestella gypseum, and the microconidia of Trichophyton mentagrophytes, respectively. Figure 3 The diagram shown is the experimental flowchart of this application; Figure 4 The image shows 14 strains with reduced sensitivity to terbinafine. SQLE Gene gel electrophoresis results (1786 bp, using primers Mc- in Table 1) SQLE -Pro-F and Mc- SQLE -Term-R); Negative control represents the negative control, Marker represents the DNA molecular weight standard, and the rest are the results corresponding to 14 strains with reduced sensitivity to terbinafine; Figure 5 The image shows 14 strains with reduced sensitivity to terbinafine. SQLE Gene gel electrophoresis results (365 bp, using primers Mc- in Table 1) SQLE -365-F and Mc- SQLE -365-R); Negative control represents the negative control, Marker represents the DNA molecular weight standard, and the rest are the results corresponding to 14 strains with reduced sensitivity to terbinafine; Figure 6 The image shows 14 strains with reduced sensitivity to terbinafine. SQLEGene sequence alignment results; Figure 7 The image shows 40 strains sensitive to terbinafine. SQLE Gene gel electrophoresis results (1786 bp, using primers Mc- in Table 1) SQLE -Pro-F and Mc- SQLE -Term-R); Negative control represents the negative control, Marker represents the DNA molecular weight standard, and the rest are the corresponding results for 40 strains sensitive to terbinafine; Figure 8 The image shows the terbinafine-sensitive Microsporum canis and the susceptible strain. SQLE Gene sequence alignment results; Figure 9 The figure shows the ROC curve and AUC value for predicting high MIC phenotypes based on L391F or F395L mutations (i.e., carrying at least one of the mutations). Figure 10 The image shown is a clinical hair and dandruff sample. SQLE Gene PCR results; MCH: PCR amplification template for clinical samples infected with Microsporum canis; SXR: PCR amplification template for clinical samples not infected with Microsporum canis; Positive control: Microsporum canis strains obtained through culture as positive controls; Negative control: negative control without template DNA; Marker: DNA molecular weight standard; Figure 11 The following are case information for clinical hair and dandruff samples: A: Hair surface observation of samples MCH (left) and SXR (right); B: Under Wood's lamp illumination, sample MCH (left) shows a positive Wood's lamp reaction, and sample SXR (right) shows a negative Wood's lamp reaction; C: Sample MCH is positive for fungal culture (after purification); D: Sample SXR is negative for fungal culture. Figure 12 The image shows primer Mc- SQLE -365-F / Mc- SQLE -365-R specificity verification; A: Primer Mc- SQLE -365-F / Mc- SQLE -365-R specificity verification; B: Amplification results of universal primers ITS1 / ITS4 for dermatophytes; Mc: Microsporum canis; Ng: Neisseria mentagrophytes; Tm: Trichophyton mentagrophytes; Negative control: template-free DNA negative control; Marker: DNA molecular weight standard; Figure 13 The image shows Microsporum canis ( M. canis ), Neisseria plasterii ( N. gypsea ), Trichophyton mentagrophytes (T.mentagrophytes ) SQLE Gene sequence comparison diagram (including non-coding regions); Figure 14 The image shows primer Mc- SQLE -Pro-F / Mc- SQLE - Term-R detection sensitivity analysis; GP (gelpurified): DNA purified from PCR amplification products using gel extraction; GDNA: Microsporum canis genomic DNA; Negative Control: negative control; Marker: DNA molecular weight standard; 3 technical replicates were performed for each concentration. Detailed Implementation

[0019] This application discloses a method, detection system, and application for evaluating the sensitivity of terbinafine based on the mutation site of squalene epoxidase (SQLE) in Microsporum canis. Those skilled in the art should understand that appropriate adjustments, modifications, or combinations can be made to the technical solutions described in this application without departing from the spirit and scope of this application, and such adjustments, modifications, or combinations should all be included within the protection scope of this application.

[0020] It should be noted that, in this document, relational terms such as "first" and "second," "step 1" and "step 2," and "(1)" and "(2)" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element. Moreover, the embodiments and features described in this application can be combined with each other without conflict.

[0021] Currently, the evaluation of terbinafine susceptibility in *Microsporum canis* mainly relies on traditional in vitro drug susceptibility testing. This method typically requires strain isolation and culture, drug treatment, and minimum inhibitory concentration (MIC) determination. The testing process is complex and usually takes a long time to obtain results, making it difficult to meet the needs of rapid clinical screening and precise medication. Meanwhile, previous studies have shown that mutations in the squalene cyclooxygenase (SQLE) encoding gene are one of the important molecular mechanisms underlying the reduced terbinafine susceptibility of dermatophytes. However, currently reported... SQLE The mutation sites are mainly concentrated in a few known variant types, which is difficult to cover the different mutation forms that may appear in clinical isolates of Microsporum canis, thus limiting the application of rapid drug susceptibility evaluation methods based on molecular markers.

[0022] In the comparative experiments provided in this application, unless otherwise specified, all experimental conditions and materials remain consistent to ensure comparability. Furthermore, all materials used in this application are commercially available.

[0023] In this application, the *Microsporum canis* SQLE The location of the mutation site is based on the standard strain of Microsporum canis. M. canis CBS 113480 SQLE The gene sequence and its SQLE protein sequence have been determined and can be queried from NCBI, including the standard strain. SQLE The gene sequence is shown in SEQ ID No. 19, and the SQLE protein sequence is shown in SEQ ID No. 20.

[0024] The technical solutions provided in this application will be further described below with reference to specific embodiments.

[0025] Example 1: Identification and Species Composition Analysis of Clinical Isolates of Dermatophytes from Companion Animals To evaluate the prevalence of Microsporum canis in dermatophyte infections in companion animals, clinical samples of canine and feline dermatophytes were collected from the Department of Dermatology and Laboratory Center of the Animal Hospital of China Agricultural University between June 1, 2024 and March 29, 2026, and the isolated strains were identified.

[0026] A total of 76 clinical isolates of canine and feline dermatophytes were collected in this study. Due to the lack of complete host origin information for some strains (8 strains), they were not included in the canine and feline origin distribution statistics, but were still retained for species identification and subsequent experimental analysis. Of the remaining 68 clinical isolates with clearly defined origins, 17 were canine (25.0%) and 51 were feline (75.0%).

[0027] The strains were identified using colony morphology observation, microscopic morphological analysis, and molecular biological identification methods. The results showed that the 76 dermatophyte strains included three major dermatophyte species, among which *Microsporum canis* (… Microsporum canis 67 strains, accounting for 88.2%; Neisseria gypseum ( Nannizzia gypsea 3 strains, accounting for 3.9%; Trichophyton mentagrophytes ( Trichophyton mentagrophytes 6 strains, accounting for 7.9%. The statistical results of the quantity distribution of the three dermatophyte species are as follows: Figure 1 As shown.

[0028] Colony morphology and lactophenol blue staining results of three dermatophytes after 14 days of incubation in SDA medium at 28°C are shown below. Figure 2 As shown.

[0029] The above results indicate that *Microsporum canis* was the dominant species among the clinical isolates of canine and feline dermatophytes collected in this study. This provides a basis for further research on the terbinafine susceptibility evaluation of *Microsporum canis*. SQLE Mutation analysis provides the sample basis.

[0030] Example 2: Microsporum canis SQLE Screening of gene mutation sites and association analysis with terbinafine sensitivity phenotype This embodiment is used to screen Microsporum canis for bacteria associated with decreased in vitro terbinafine susceptibility. SQLE Gene mutation sites, and analysis of different SQLE The relationship between mutation type and drug sensitivity phenotype.

[0031] Fourteen clinical isolates of Microsporum canis exhibiting a reduced susceptibility phenotype to terbinafine were obtained through in vitro drug susceptibility testing.

[0032] The strain was revived in SDA medium, and after 5-7 days of fungal growth, whole-genome DNA was extracted using the Bio-spin fungal whole-genome DNA kit according to the manufacturer's instructions. The experimental procedure is as follows: Figure 3 As shown. According to Microsporum canis SQLE Gene sequence was used to design two pairs of specific primers. The first pair of primers is Mc- SQLE -Pro-F and Mc- SQLE -Term-R, the second primer pair is Mc- SQLE -365-F and Mc- SQLE -365-R, see Table 1. The first primer pair was used to amplify the promoter fragment containing approximately 100 bp upstream of the transcription start site and approximately 200 bp downstream of the terminator. The second primer pair amplified... SQLE Gene hotspot mutation regions. PCR amplification. SQLEGene sequence. The PCR system included: 1 μL DNA template, 15 μL 2×Taq DNA enzyme, 1.5 μL each of 10 pmol / μL forward and reverse primers, and ddH2O to a final volume of 30 μL. Amplification conditions: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 15 s, 30 cycles; 72℃ extension for 5 min. PCR products were electrophoresed on a 1.0% agarose gel at 120 V for 30 min. Detection was performed using a UV gel imaging system. A single clear band at 1786 bp was considered successful amplification of the first primer pair, and a single clear band at 365 bp was considered successful amplification of the second primer pair. The qualified PCR products were sent to Beijing Kangwei Century Biotechnology Co., Ltd. for sequencing. After the sequencing results were returned, the sequence fragments of each strain were compared with the Microsporum canis standard strain. M. canis The SQLE fragment (MCYG_02365) of CBS 113480 was compared.

[0033] Table 1 Primer sequence information

[0034] Mc- SQLE -365-F and Mc- SQLE The 365bp fragment amplified by -365-R: CCTGGGAGATTCCCTGAATATGCGCCACCCATTAACGGGAGGGGGTATGACCGTGGCGTTCAATGATGTCGTTCTCCTTCGGGACCTTCTCAGTGTGGAAGCGGTCCCGATTTCAGCAACACAAAACTCGTCTTAAAACAATTATCCAAGTTCCATTGGCAAAGGAAGTCATTAACTTCAGTT ATTAATATTCTTGCTCAAGCTTTATACTCTATATTTGCTGCCGGTGGTCAGTATAACTCCCAGTGTCCTTCCTCCGTCTGTGCGGTTGATCGTTTTTACTGATATCATACCTCTTAGATCCTAACTTGAAAGTCCTACAACGGGGCTGTTTCCGGTATTTCCAGCTCGGACTTATTGACGG (SEQ IDNo.7) Gel electrophoresis results of 14 Microsporum canis isolates with reduced terbinafine sensitivity are shown below. Figure 4 , Figure 5Specific mutation sites are shown in Table 2. Mutations were detected in all 10 strains: MC1-FY, MC2-GDQ, MC3-GST, MC4-ZY, MC5-BB, MC8-LF, MC9-EGZ, MC11-ZR, MC13-LM, and MC14-YL. SQLE A mutation A→C occurs at position 1173 of the gene, resulting in the change of amino acid leucine to phenylalanine at position 391 (L391F). The MC6-LXT strain... SQLE A T→C mutation exists at position 1172 of the gene, resulting in the change of amino acid leucine to serine at position 391 (L391S). In strain MC10-JYH, a T→C mutation occurs at position 1183, changing phenylalanine at position 395 to leucine (F395L); in strain MC12-LJH, a T→A mutation occurs at the same site, changing phenylalanine at position 395 to isoleucine (F395I). No mutation was detected in strain MC7-LMA. SQLE Gene mutation. 14 strains with reduced sensitivity to terbinafine. SQLE See gene sequence alignment Figure 6 .

[0035] Forty terbinafine-sensitive wild-type clinical isolates of Microsporum canis were subjected to... SQLE Genetic testing showed no mutations. See gel electrophoresis image below. Figure 7 Terbinafine reduces susceptibility to Microsporum canis and susceptible strains. SQLE See gene sequence alignment results Figure 8 .

[0036] Table 2. MIC (µg / mL) of five antifungal drugs to terbinafine-sensitive strains. SQLE Gene mutation sites

[0037] As shown in Table 2, the MICs of terbinafine for all 10 strains carrying the L391F mutation were >64 μg / mL. The MIC of the MC6-LXT strain carrying the L391S mutation was 2 μg / mL, and the MIC of the MC12-LJH strain carrying the F395I mutation was 8 μg / mL. One strain did not show any abnormalities. SQLE The mutated strain also had a MIC value >64 μg / mL. Another strain carrying the F395L mutation also had a MIC value >64 μg / mL.

[0038] The results of this study show that *Microsporum canis* was discovered. SQLE The three new mutation sites, L391F, L391S, and F395I, enrich the understanding of Microsporum canis. SQLEMutation profile. Regarding the correspondence between phenotype and genotype, the results showed that all strains carrying the L391F mutation exhibited high levels of drug resistance (MIC > 64 μg / mL), indicating a high degree of consistency between this mutation and the terbinafine resistance phenotype. It is speculated that L391F may mediate drug resistance by altering the spatial conformation of the SQLE protein, thereby reducing the binding ability of the drug to the target enzyme. In contrast, the MIC values ​​of the L391S and F395I mutant strains were 2 μg / mL and 8 μg / mL, respectively, significantly lower than those of the L391F mutant strain, suggesting that different amino acid substitutions have different effects on enzyme structure and function, leading to varying degrees of drug resistance phenotype.

[0039] In addition, this application found one strain that was not detected. SQLE Strains with gene mutations but still exhibiting high MIC (>64 μg / mL) suggest that, in addition to SQLE Besides gene mutations, other drug resistance mechanisms may be involved in *Microsporum canis*, such as overexpression of drug efflux pumps or alterations in other metabolic regulatory pathways. Furthermore, the F395L mutant strain detected in this application exhibited high MIC, consistent with previous literature reports, further validating the important role of this site in terbinafine resistance.

[0040] Based on the above results, it is suggested that S QLE Different gene mutation sites and their amino acid substitution types have varying degrees of influence on drug resistance phenotypes, with L391F possibly being one of the important mutation forms mediating high levels of drug resistance.

[0041] Example 3: PCR detection SQLE Correlation analysis between mutations and the high MIC phenotype of Microsporum canis Since there is currently a lack of clinical breakpoints or epidemiological cutoff values ​​(ECOFF) for terbinafine against Microsporum canis, this application, based on existing literature reports and the distribution of data in this application, defines strains with MICs significantly higher than the reported wild-type range and exceeding the upper limit of detection as having a "potential resistance phenotype," avoiding direct equation with clinical resistance. An empirical grading analysis of MIC values ​​is performed, as shown in Table 3. Therefore, the "resistance assessment" in this application aims to reflect changes in the strain's in vitro drug sensitivity or potential resistance risk.

[0042] The results showed that in strains with MIC > 64 μg / mL SQLE The detection rate of gene mutations was significantly increased (approximately 91.7%, 11 / 12), suggesting... SQLE There is a strong association between gene mutations and the high MIC phenotype.

[0043] Using MIC > 64 μg / mL as the criterion for high MIC phenotype, the sensitivity of predicting high MIC phenotype based solely on L391F mutation was 83.3% (95% CI: 51.6%-97.9%), the specificity was 100% (95% CI: 91.6%-100%), the positive predictive value was 100% (95% CI: 69.2%-100%), the negative predictive value was 95.5% (95% CI: 84.9%-99.4%), and the AUC was 0.917 (95% CI: 0.89-0.99), as shown in Table 4. Using MIC > 64 μg / mL as the criterion for the high MIC phenotype, carrying the L391F or F395L mutation (i.e., carrying at least one of these mutations) had a predictive sensitivity of 91.7% (95% CI: 61.2%-99.8%), a specificity of 100% (95% CI: 91.6%-100%), a positive predictive value of 100% (95% CI: 71.5%-100%), and a negative predictive value of 97.7% (95% CI: 84.9%-99.5%), with an AUC of 0.958 (95% CI: 0.88-1.00). (See Table 5). Figure 9 .

[0044] Table 3 SQLE Relationship between gene mutation type and terbinafine MIC value and drug resistance phenotype (µg / mL)

[0045] Table 4. 2×2 contingency analysis table for predicting high MIC phenotypes based on L391F mutation detection.

[0046] Note: High MIC means MIC > 64 μg / mL; others mean MIC ≤ 64 μg / mL.

[0047] Table 5. 2×2 contingency analysis of the prediction of high MIC phenotypes based on L391F or F395L mutation detection (i.e., carrying at least one of the mutations).

[0048] Note: High MIC means MIC > 64 μg / mL; others mean MIC ≤ 64 μg / mL.

[0049] Combining Tables 3-5 and Figure 9 As a result, in strains with MIC > 64 μg / mL, SQLEThe mutation detection rate was approximately 91.7% (11 / 12), indicating that the proposed method has high sensitivity and specificity in predicting high-level drug resistance. Compared with traditional in vitro drug susceptibility testing, using the mutation sites provided in this application as detection targets, combined with molecular detection methods, eliminates the need for lengthy fungal cultures and allows detection to be completed within hours, significantly shortening the detection cycle and contributing to more timely clinical medication decisions.

[0050] Example 4: Microsporum canis based on clinical hair and dander samples SQLE Gene PCR detection This assay was used for fungal identification and rapid drug resistance testing of clinical hair samples. In the experimental group, clinical hair samples (numbered MCH and SXR, uncultured) were ground and the complete fungal genome was extracted using a kit. The positive control consisted of the complete genome extracted from ground fungal culture colonies using the kit. The negative control did not include template DNA. All other components were the same as the experimental and positive control groups. The amplification primers used were those listed in Table 1 (Mc-). SQLE -365-F and Mc- SQLE -365-R. The total PCR reaction volume was 30 μL, including: 15 μL 2×Taq Mix; 1.5 μL upstream primer (10 μmol / L); 1.5 μL downstream primer (10 μmol / L); 1.0 μL DNA template; and nuclease-free water to a final volume of 30 μL. PCR amplification conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 15 s; 30 cycles in total; final extension at 72℃ for 5 min. Results are shown below. Figure 10 Sequencing revealed it to be *Microsporum canis*. SQLE The fragments were sequenced and BLAST-aligned with the GenBank database, and compared with *Microsporum canis*. SQLE The gene sequences are 100% similar.

[0051] Of these, sample MCH was a Wood's lamp positive sample and had a positive fungal culture, indicating a case of Microsporum canis infection; sample SXR was a Wood's lamp negative sample and had a negative fungal culture, indicating a case of non-Microsporum canis infection. The positive control was the result of PCR analysis of cultured Microsporum canis strains. Figure 10 The results indicate that hair and dander from Microsporum canis infection cases can transmit the virus through contact with skin cells. SQLE Gene PCR yielded the target band, while no band was observed in hair and dander from cases other than Microsporum canis infection. See detailed case information. Figure 11 .

[0052] The results of this embodiment demonstrate that, using the method provided in this application... SQLEUsing mutation sites as detection targets is not only applicable to cultured Microsporum canis strains, but also has the potential for direct detection in clinical samples such as hair and dander. Targets can be rapidly obtained through molecular detection methods without the need for traditional fungal isolation and culture. SQLE This method provides information on mutation sites, significantly shortening the terbinafine susceptibility assessment cycle for *Microsporum canis*, with the detection process completed in approximately 24 hours. In contrast, traditional drug susceptibility assessment methods typically require initial *Microsporum canis* isolation and culture (culture period approximately 1–3 weeks), followed by in vitro drug susceptibility testing and MIC determination, with the overall assessment cycle potentially taking several weeks. Therefore, the detection method provided in this application offers a rapid and convenient molecular detection means for assessing changes in *Microsporum canis* terbinafine susceptibility and monitoring drug resistance risks. This application not only expands the scope of research on *Microsporum canis* terbinafine susceptibility reduction... SQLE The mutation site spectrum also provides experimental evidence for establishing a rapid detection method for antifungal drug sensitivity of Microsporum canis, which has potential clinical application value and promotion prospects.

[0053] Example 5: Microsporum canis SQLE Evaluation of the specificity of primers for PCR amplification of the target region Primer specificity verification experiment. To verify the specificity of the Mc- primers in the detection kit of this invention... SQLE -365-F / Mc- SQLE The specificity of the -365-R primer for detecting *Microsporum canis* was demonstrated. *Microsporum canis*, *Neisseria gypseum*, and *Trichophyton mentagrophytes* obtained through fungal culture were selected as experimental materials. After culturing, each strain was ground, and whole-genome DNA was extracted using a genomic DNA extraction kit as a PCR template. A system without template DNA, maintaining all other reaction components, served as a negative control. This experiment used two pairs of primers for PCR amplification; the first pair of primers was for *Microsporum canis* designed in this invention. SQLE Gene-specific primers Mc- SQLE- 365-F and Mc- SQLE- The second primer pair, 365-R, consisted of the universal fungal identification primers ITS1 and ITS4, used to verify the template DNA quality and the effectiveness of the PCR reaction system (see Table 1). The total PCR reaction volume was 30 μL, including: 15 μL of 2×Taq Mix; 1.5 μL of upstream primer (10 μmol / L); 1.5 μL of downstream primer (10 μmol / L); 1.0 μL of DNA template; and nuclease-free water to a final volume of 30 μL. PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 15 s; 30 cycles in total; and a final extension at 72℃ for 5 min. The experimental results are as follows: Figure 12 As shown.

[0054] Using Mc- SQLE -365-F / Mc- SQLE When amplified with primers -365-R, only the *Microsporum canis* template showed a specific amplification band of the expected size, while no corresponding amplification products were detected for *Neisseria gypseum* and *Trichophyton mentagrophytes* templates, indicating that the primers are effective against *Microsporum canis*. SQLE The target sequence has good specificity.

[0055] Meanwhile, when amplified using the universal fungal primers ITS1 / ITS4, *Microsporum canis*, *Neisseria gypseum*, and *Trichophyton mentagrophytes* all yielded corresponding amplification products, indicating that the DNA template quality of each group met the requirements for PCR detection and that the PCR reaction system was functioning normally. Therefore, *Neisseria gypseum* and *Trichophyton mentagrophytes* did not show Mc- SQLE -365-F / Mc- SQLE The -365-R amplification band was not due to abnormal template DNA quality or PCR reaction conditions, but rather because the primers were not properly matched to the target bacterial species. SQLE The sequence is species specific.

[0056] Also see Figure 13 This application relates to Microsporum canis ( M. canis ), Neisseria plasterii ( N. gypsea ), Trichophyton mentagrophytes ( T.mentagrophytes ) SQLE Gene sequence alignment was performed; the red arrow points to the mutant region of *Microsporum canis* in this application. Downstream primer Mc- SQLE The -365-R binding site is located in the non-coding region. Because the primer binding sites exhibit sequence differences or deletions in *Microsporum gypseum* and *Trichophyton mentagrophytes*, they cannot effectively bind to and amplify the target fragment. This indicates that the site selection of the amplification primers in this application possesses high specificity.

[0057] Therefore, this application provides SQLE The regional amplification system can be used simultaneously for the identification and subsequent treatment of Microsporum canis. SQLE Mutation detection.

[0058] Example 6: Microsporum canis SQLE Sensitivity evaluation of PCR detection in target regions The determination of the lowest detection limit (sensitivity verification test) of the PCR detection method of the present invention. To evaluate the detection sensitivity of the Microsporum canis-specific primers of the present invention, the PCR products after gel recovery were serially diluted, and the lowest detection limit of the PCR detection method of the present invention was determined.

[0059] The primer detected in this embodiment is Mc- SQLE -Pro-F and Mc- SQLE-Term-R, the target fragment length is 1786bp. The specific primer sequences are shown in Table 1, SEQ ID No. 1-No. 2. Genomic DNA of *Microsporum canis* was extracted using a fungal genomic DNA extraction kit and amplified by PCR. The total PCR reaction volume was 30 μL, including: 15 μL of 2×Taq Mix; 1.5 μL of upstream primer (10 μmol / L); 1.5 μL of downstream primer (10 μmol / L); 1.0 μL of DNA template; and nuclease-free water to a final volume of 30 μL. PCR amplification conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 15 s; 30 cycles in total; final extension at 72℃ for 5 min.

[0060] The target amplification product was separated by 1% agarose gel electrophoresis and then purified by gel extraction to obtain high-purity target DNA fragments and remove non-specific products and impurities from the PCR amplification system. The DNA concentration of the gel-extracted product was measured to be 52.1 ng / μL using a NanoDrop nucleic acid concentration analyzer. This is the concentration of the 1786 bp PCR product after gel extraction.

[0061] A 1786 bp PCR amplification product, purified by gel extraction, was used as a standard template. Its concentration was determined and converted to the target sequence copy number. Serial dilutions were then performed for limit of detection analysis. The template DNA copy number was calculated using the following formula: Copies / μL = [6.02 × 10⁻⁶]. 23 [×DNA concentration (g / μL)] / [DNA length (bp) × 660]. Where: 6.02 × 10⁻⁶ 23 1 is Avogadro's constant; 660 is the average molecular weight (g / mol) of 1 bp double-stranded DNA.

[0062] Based on the 1786 bp amplified fragment, the copy number concentration of the template DNA was calculated to be 2.66 × 10⁻⁶. 10 The template was prepared in 10 copies / μL and serially diluted to different concentrations for PCR amplification. 0 10 -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 10 -9 10 -10The specific dilution factors and copy numbers after dilution are shown in Table 6. The PCR reaction system and PCR amplification conditions are the same as above. The amplification products were analyzed by 1% agarose gel electrophoresis, as shown... Figure 14 As shown.

[0063] The results showed that when the template concentration was not less than 26.6 copies / μL, specific amplification bands of the correct size and clearly visible could be obtained; when the template concentration was less than 26.6 copies / μL, no obvious specific amplification bands were detected.

[0064] Therefore, the limit of detection for the PCR detection method of this invention is 26.6 copies / μL of template. When the target sequence template amount is ≥26.6 copies / μL, a stable and reproducible specific amplification signal can be obtained. This result demonstrates that the primers and detection system designed in this invention can effectively identify the target sequence under low copy number template conditions, significantly improving the sensitivity of Microsporum canis molecular detection. This facilitates rapid and accurate detection in early infection stages or low-load clinical samples, providing reliable technical support for the early diagnosis and timely intervention of Microsporum canis infection.

[0065] Table 6. Dilution factor and copy number after dilution

[0066] Note: TE solution is Tris-EDTA buffer.

[0067] Example 7: TaqMan-MGB probe detection of Microsporum canis SQLE Application examples of mutation sites Based on Microsporum canis ( Microsporum canis ) SQLE This application establishes a method based on allele-specific TaqMan-MGB probes to detect specific mutations in the coding regions of amino acids 391 and 395 of the gene. SQLE Mutation detection system.

[0068] The detection system uses co-amplification primers to amplify the target nucleic acid fragment containing the coding regions of amino acids 391 and 395 of the SQLE protein, and utilizes specific probes designed for different allele sequences to detect the target nucleic acid fragment. SQLE Wild-type sequences and mutant sequences L391F, L391S, F395I, and F395L were distinguished and detected.

[0069] Meanwhile, this application design SQLE Gene conserved region detection probes are used to identify Microsporum canis in the sample to be tested. SQLE The gene template is present and serves as a quality control for the effectiveness of the detection system. Common amplification primers include: (one) SQLE Design of primers for target region amplification Used to amplify SQLE The common amplification primers for the coding regions of amino acids 391 and 395 are as follows: Forward primer Mc- SQLE -qF: 5′-CCATTGGCAAAGGAAGTCATTAAC-3′ (SEQ ID No. 8); Reverse primer Mc- SQLE -qR: 5′-CGATCAACCGCACAGACGGA-3′ (SEQ ID No. 9).

[0070] The primers amplify regions covering the coding regions of amino acids 391 and 395 of the SQLE protein, which can be used for subsequent mutation site detection.

[0071] (II) Design of allele-specific probes for the L391 locus TaqMan-MGB probes were designed to recognize wild-type, L391F mutant, and L391S mutant sequences targeting the coding region of the SQLE protein at amino acid position 391.

[0072] L391 wild-type probe: 5′-VIC-TATTCTTGCTCAAGCTTTATACTCTATA-MGB-NFQ-3′ (SEQ ID No. 10); used to detect the absence of L391 site mutation. SQLE wild-type sequence.

[0073] L391F mutant probe: 5′-FAM-TATTCTTGCTCAAGCTTTCTACTCTATA-MGB-NFQ-3′ (SEQ ID No. 11) is used for detection. SQLE The L391F amino acid substitution is caused by the change from A to C at the 1173rd base position of the gene.

[0074] L391S mutant probe: 5′-CY5-TATTCTTGCTCAAGCTTCATACTCTATA-MGB-NFQ-3′ (SEQ ID No. 12) is used for detection. SQLE The L391S amino acid substitution is caused by the T→C change at the 1172nd base of the gene.

[0075] (III) Design of allele-specific probes at the F395 locus TaqMan-MGB probes were designed to recognize wild-type, F395I mutant, and F395L mutant sequences targeting the coding region of the SQLE protein at amino acid position 395.

[0076] F395 wild-type probe: 5′-VIC-TACTCTATATTTGCTGCCGGTG-MGB-NFQ-3′ (SEQ ID No. 13) F395L mutant probe: 5′-FAM-TACTCTATACTTGCTGCCGGTG-MGB-NFQ-3′ (SEQ ID No. 14) F395I mutant probe: 5′-CY5-TACTCTATAATTGCTGCCGGTG-MGB-NFQ-3′ (SEQ ID No. 15) (Four) SQLE Conservative region detection probe SQLE Conservative region detection probe: The conserved region described in 5′- Texas Red-CCGGTGGTCAGTATAACTCCCAG-MGB-NFQ-3′ (SEQ ID No. 16) is located in Microsporum canis. SQLE Non-mutation-related regions in the gene are highly conserved across different clinical isolates of Microsporum canis, and are used for correct amplification in quality control qPCR.

[0077] (v) Detection system and reaction conditions During detection, L391 site detection system and F395 site detection system can be established separately.

[0078] Each reaction system includes: SQLE Primers for amplifying the target region; wild-type probes for the corresponding sites; corresponding mutant probes; SQLE Conservative region detection probe; real-time fluorescent PCR reaction solution; nucleic acid template for the sample to be tested. (1) An exemplary 20 μL reaction system includes: 2× Real-time Fluorescent PCR Reaction Solution: 10 μL; Forward and reverse primers: 0.2–0.8 μmol / L each; Allele-specific probes: 0.05–0.3 μmol / L; SQLE Conservative region detection probe: 0.05–0.3 μmol / L; Template nucleic acid: 1–5 μL; Add nuclease-free water to a final volume of 20 μL. (2) Amplification procedure: Pre-denaturation at 95℃ for 2 min; Denaturation at 95℃ for 15 seconds, annealing and extension at 55-60℃ for 30 seconds, cycled 40-45 times.

[0079] (vi) Result determination The results were determined based on the signals from different fluorescence channels: (1) SQLE The detection probe in the conserved region generates a specific fluorescent signal, indicating the presence of Microsporum canis in the sample. SQLE Gene templates and effective detection systems.

[0080] (2) When the wild-type L391 probe produces a specific fluorescent signal, while the mutant L391F and L391S probes do not have an obvious signal, the L391 site of the sample is determined to be wild-type.

[0081] (3) When the L391F or L391S mutant probe produces a specific fluorescent signal, the presence of the corresponding mutant probe in the sample is determined. SQLE mutation.

[0082] (4) When the F395I or F395L mutant probe produces a specific fluorescent signal, the presence of the corresponding mutant probe in the sample is determined. SQLE mutation.

[0083] (5) When SQLE If the conserved region detection probe is positive, while none of the aforementioned mutant probes produce a specific signal, it indicates that the sample does not contain the substance described in this application. SQLE Mutations, or other uncovered mutations, may exist. SQLE Mutation type.

[0084] (6) When SQLE If the probe for detecting the conserved region also fails to detect a signal, it suggests that Microsporum canis may not be present in the sample, or that the detection may fail due to insufficient nucleic acid content.

[0085] This embodiment can also use other probe forms capable of distinguishing single nucleotide differences instead of the TaqMan-MGB probe, as long as the corresponding probe can be used to distinguish between Microsporum canis and other microsporum species. SQLE The wild-type sequence of the gene and the target mutant sequence bind differentially.

[0086] Example 8: Detection of Microsporum canis using the CRISPR / Cas12b method SQLE Application examples of drug resistance-related mutations This application provides a CRISPR-related nuclease-based detection method for Microsporum canis (… Microsporum canis ) SQLEA method for detecting drug resistance-related mutations. This embodiment utilizes the Cas12b protein to specifically recognize target nucleic acids under the guidance of crRNA, and achieves fluorescence signal output through its trans-single-stranded nucleic acid cleavage activity, thereby enabling the detection of Microsporum canis. SQLE Mutation sites in the gene associated with decreased terbinafine sensitivity.

[0087] Specifically, nucleic acid was first obtained from the Microsporum canis sample to be tested, and nucleic acid amplification methods such as PCR, recombinase polymerase amplification (RPA), and loop-mediated isothermal amplification (LAMP) were used to amplify the target nucleic acid fragment containing the coding regions of amino acids 391 and 395 of the SQLE protein.

[0088] The target amplification region includes SQLE The mutations occur at bases 1172, 1173, and 1183 of the gene. Specifically, the T→C mutation at base 1172 corresponds to the L391S amino acid substitution in the SQLE protein; the A→C mutation at base 1173 corresponds to the L391F amino acid substitution in the SQLE protein; the T→A mutation at base 1183 corresponds to the F395I amino acid substitution in the SQLE protein; and the T→C mutation at base 1183 corresponds to the F395L amino acid substitution in the SQLE protein.

[0089] Based on the PAM recognition characteristics of the Cas12b protein, in SQLE Target sequences that meet the Cas12b recognition requirements are screened near the coding regions of amino acids 391 and 395 of the gene. In this embodiment, the following target DNA sequences (the reverse complementary regions of the mutated coding regions) are selected: 5′-GCAAATATAGAGTATAAAGCTTG-3′ (SEQ ID No. 17).

[0090] The terminal "TTG" sequence serves as the PAM region required for Cas12b recognition, while the terminal "GCAAATATAGAGTATAAAGC" sequence serves as the crRNA target region. Based on these target sequences, a corresponding crRNA is designed, and the target spacer sequence of the crRNA is as follows: 5′-GCAAAUAUAGAGUAUAAAGC-3′ (SEQ ID No. 18, in accordance with the WIPO ST.26 sequence listing requirements, the RNA sequence is represented by the base T to indicate the uracil U at the corresponding position during the listing process).

[0091] The crRNA targeting region covers Microsporum canis.SQLE The coding region of amino acids at positions 391 and 395 of the gene. When the sample to be tested contains... SQLE When the gene retains the wild-type sequence, the crRNA can perfectly match the target sequence and activate the trans-nucleotide cleavage activity of the Cas12b protein.

[0092] In the detection system, Cas12b protein, the above-mentioned crRNA, and the amplified... SQLE The target fragment and the nucleic acid reporter molecule. The nucleic acid reporter molecule is a single-stranded nucleic acid reporter molecule, with a fluorescent reporter group and a quencher group attached to its two ends, respectively. When the Cas12b protein is activated by the target sequence, it can non-specifically cleave the reporter molecule, thereby releasing a fluorescent signal.

[0093] Exemplary detection systems include: Cas12b protein, targeted... SQLE The target region's crRNA, amplification products, fluorescent reporter molecules, and a buffer system suitable for the Cas12b reaction are included. After the reaction, the sample is identified by detecting changes in fluorescence intensity. SQLE Does the target region of the gene contain mutations?

[0094] When the sample to be tested carries SQLE When the wild-type sequence is present, the Cas12b protein is effectively activated and produces a significant fluorescent signal because the crRNA perfectly matches the target sequence. When the sample to be tested carries... SQLE Drug resistance-related mutations, including L391F, L391S, F395I, and F395L mutations, cause single-base differences in the crRNA recognition region, leading to mismatches between the crRNA and the target sequence. This reduces the activation efficiency of the Cas12b protein, resulting in decreased or absent fluorescence signal. Specifically: (1) L391F mutation corresponds to SQLE The base change at position 1173 of the gene is from A to C. (2) L391S mutation corresponds to SQLE The T→C change occurs at position 1172 of the gene. (3) F395I mutation corresponds to SQLE The base change at position 1183 of the gene is from T to A. (4) F395L mutation corresponds to SQLE The change occurs at the 1183rd base of the gene, from T to C.

[0095] Therefore, when the detection system produces a significant fluorescence signal, it indicates that the sample to be tested... SQLE The target region is consistent with the wild-type sequence; when the fluorescence signal in the detection system is significantly reduced or absent, it indicates that the sample is not being tested. SQLE Mutations may exist in the amino acid coding regions at positions 391 and / or 395.

[0096] In other embodiments, to further determine the specific mutation type, different... SQLE Mutant crRNAs were designed for each mutation site. For example, crRNAs targeting the L391F mutation, containing the A→C mutation region at position 1173, were designed; crRNAs targeting the L391S mutation, containing the T→C mutation region at position 1172, were designed; crRNAs targeting the F395I mutation, containing the T→A mutation region at position 1183, were designed; and crRNAs targeting the F395L mutation, containing the T→C mutation region at position 1183, were designed. By comparing the fluorescence signals generated by different crRNA detection systems, further determination can be made. SQLE Specific mutation type.

[0097] In other embodiments, the CRISPR-associated nuclease may also be selected from Cas12a, Cas12b, and functional variants with trans-nucleotide cleavage activity. The crRNA targeting region can be adjusted according to the PAM recognition requirements of different CRISPR-associated nucleases, as long as it can cover... SQLE The gene contains bases at positions 1172, 1173, and / or 1183, and enables control of *Microsporum canis*. SQLE Specific detection of mutation sites is sufficient.

[0098] Example 9: A strain model carrying the SQLE L391F mutation of Microsporum canis This application provides a strain model for evaluating the activity of drugs against *Microsporum canis*. The strain model is a strain carrying the *Microsporum canis* SQLE L391F mutation, where the SQLE L391F mutation corresponds to *Microsporum canis*. SQLE A mutation was made at base 1173 of the gene, A→C, resulting in the substitution of leucine (L) for phenylalanine (F) at amino acid position 391 of the SQLE protein. The strain model expressed the SQLE protein containing the L391F amino acid substitution and exhibited decreased terbinafine sensitivity and / or increased minimum inhibitory concentration (MIC) compared to the control strain expressing wild-type SQLE protein.

[0099] In this embodiment, the clinical isolate of *Microsporum canis* obtained in the aforementioned embodiments is used as the strain source. Specifically, the clinical isolate of *Microsporum canis* is subjected to... SQLE Gene sequence analysis was used to screen for strains carrying the SQLE L391F mutation.

[0100] Genomic DNA was extracted from the test strain and used... SQLE Specific primers were used to amplify a gene fragment containing the coding regions of amino acids 391 and 395, and the PCR amplification products were sequenced for analysis. The obtained...SQLE Gene sequence and standard strain of Microsporum canis M. canis CBS 113480 SQLE Gene sequences were compared.

[0101] The results showed that some clinical isolates of Microsporum canis SQLE A mutation A→C occurs at the 1173rd base of the gene, resulting in the replacement of leucine (L) with phenylalanine (F) at the 391st amino acid of the SQLE protein, forming the SQLE L391F mutation.

[0102] Further in vitro drug susceptibility testing was used to evaluate the susceptibility of the above strains to terbinafine. The results showed that the *Microsporum canis* strains carrying the SQLE L391F mutation exhibited significantly elevated MIC values ​​to terbinafine, with some strains having MIC values ​​> 64 μg / mL, while the SQLE wild-type *Microsporum canis* strains did not show the same degree of MIC elevation.

[0103] Therefore, strains carrying the SQLE L391F mutation of Microsporum canis and exhibiting reduced terbinafine sensitivity and / or high MIC phenotype can serve as strain models for evaluating the activity of anti-Microsporum canis drugs.

[0104] In other embodiments, the strain model can also be constructed using genetic engineering methods. For example, gene editing technologies (including but not limited to CRISPR / Cas systems, homologous recombination technology, etc.) can be used to introduce the SQLE L391F mutation into the Microsporum canis genome, causing the strain to express the mutant SQLE protein, and then... SQLE Strains with the expected phenotype were obtained through gene sequencing and in vitro drug susceptibility testing.

[0105] In addition, in other implementations, a heterologous expression system can be used to establish... SQLE Mutant functional validation models. For example, one could choose *Saccharomyces cerevisiae* (Saccharomyces cerevisiae). Saccharomyces cerevisiae Using other suitable fungal model strains as hosts, the SQLE L391F mutant protein derived from Microsporum canis is expressed through genetic engineering methods, or the host itself... SQLE Homologous genes were mutated at corresponding sites. The sensitivity of wild-type and mutant SQLE protein strains to antifungal drugs such as terbinafine can be evaluated by comparing these differences. SQLE The impact of mutations on drug sensitivity, and their application in antifungal drug screening.

[0106] Example 10: A method for screening anti-Microsporum canis drugs based on the SQLE L391F mutant strain model This application provides a method for screening anti-Microsporum canis drugs based on an SQLE mutant strain model.

[0107] Specifically, the candidate drug is brought into contact with the strain model carrying the Microsporum canis SQLE L391F mutation described in Example 9; the inhibitory effect of the candidate drug on the growth, reproduction and / or survival of the strain model is detected; and candidate drugs with anti-Microsporum canis activity are screened based on the inhibitory effect.

[0108] In a specific implementation, contacting the candidate drug with the strain means placing the candidate substance with potential antifungal activity and a strain carrying the SQLE L391F mutation and exhibiting a high MIC phenotype of terbinafine under suitable culture conditions, so that the candidate drug and the strain can interact.

[0109] The candidate drugs may be derived from natural product extracts, chemically synthesized compounds, proteins or peptides prepared by biotechnology, marketed antifungal drugs and their derivatives, etc.

[0110] The candidate drug may exist in solution, suspension or other suitable form and may come into contact with the strain in a variety of ways, including but not limited to: (1) Add candidate drugs of different concentration gradients to a liquid culture system containing the strain for culture; (2) The candidate drug is added to a solid culture medium and then inoculated with the strain for culture; (3) Using microplate detection or high-throughput screening, the candidate drug and the strain culture system are incubated, and the growth status, bacterial quantity change or survival status of the strain are detected.

[0111] The inhibitory effect of the candidate drug on the growth of the bacterial strain can be detected by one or more detection methods, including but not limited to: (1) Determine the minimum inhibitory concentration (MIC) by observing the growth of the bacterial strain in the culture system. (2) The changes in bacterial biomass were evaluated by detecting the changes in turbidity of the culture system using the turbidimetric method; (3) Changes in colony forming units (CFU) were detected by plate counting method; (4) The survival status of the strain was evaluated by detecting ATP content, MTT or XTT metabolic activity; (5) Observe the growth status, morphological changes and quantity changes of mycelia through a microscope.

[0112] The growth inhibition effect refers to the changes that occur after the candidate drug is applied, such as slowed growth, inhibited proliferation, reduced metabolic activity, or cell death in strains carrying the SQLE L391F mutation and exhibiting a high MIC phenotype.

[0113] Typically, the candidate drug treatment group is compared with the control group of strains without the candidate drug, and evaluation can be performed using indicators such as growth inhibition rate, MIC, and minimum fungicidal concentration (MFC). Candidate drugs that can significantly inhibit the growth of SQLE L391F mutant strains or reduce their MIC levels can be considered as candidate drugs with anti-Microsporum canis activity.

[0114] The above description is merely a specific embodiment of this application, enabling those skilled in the art to understand or implement this application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of this application. Therefore, this application is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features claimed herein.

Claims

1. Microsporum canis SQLE The application of mutation sites as detection targets in assessing reduced in vitro susceptibility, high MIC phenotype, and / or potential resistance risk of Microsporum canis is characterized by, The SQLE The mutation sites include the amino acid substitutions at positions 391 and / or 395 of the *Microsporum canis* squalene epoxidase (SQLE) protein, or their corresponding sites. SQLE The site of gene base mutation.

2. The application according to claim 1, characterized in that, The SQLE The mutation site is selected from one or more of L391F, L391S, F395I and F395L, and is not F395L alone.

3. The application according to claim 1 or 2, characterized in that, The SQLE Gene base mutations include coding sequence changes corresponding to amino acid substitutions at L391F, L391S, F395I, and F395L, among which: (1) L391F corresponds to the A→C mutation at the 1173rd base; (2) L391S corresponds to the T→C mutation at the 1172nd base; (3) F395I corresponds to the T→A mutation at the 1183rd base; (4) F395L corresponds to the T→C mutation at the 1183rd base.

4. A method based on Microsporum canis SQLE A method for assessing the in vitro sensitivity of terbinafine by detecting mutation sites, characterized in that, include: (1) Obtain nucleic acid samples of the Microsporum canis strain to be tested; (2) Detect the nucleotide sequence in the nucleic acid sample that contains the coding region of amino acid 391 and / or 395 of the SQLE protein; (3) Determine, based on the nucleotide sequence, whether there exists an amino acid substitution at position 391 and / or position 395 of the SQLE protein. SQLE Gene mutation; (4) Assess the reduced in vitro sensitivity of Microsporum canis to terbinafine, high MIC phenotype and / or potential drug resistance risk based on mutation detection results.

5. A detection kit for assessing reduced in vitro susceptibility, high MIC phenotype, and / or potential resistance risk of Microsporum canis, characterized in that: Includes the detection of any one of claims 1 to 3 SQLE Detection reagents for mutation sites.

6. The detection kit according to claim 5, characterized in that: The detection reagent includes reagents for amplifying Microsporum canis. SQLE PCR amplification primers for the mutant gene region; the *Microsporum canis* SQLE The mutation site gene region contains the nucleotide sequence region encoding the 391st and / or 395th amino acid region of the SQLE protein.

7. The detection kit according to claim 5, characterized in that, The detection reagent includes a method for detecting Microsporum canis. SQLE The qPCR detection system reagent for the mutation site includes primers for amplifying nucleic acid fragments containing the coding region of amino acid position 391 and / or 395 of the SQLE protein, and reagents for distinguishing *Microsporum canis*. SQLE Allele-specific detection probes for wild-type and mutant sequences at mutation sites; the allele-specific detection probes include one or more of the following: (1) Wild-type probes targeting the L391 site of the SQLE protein: L391F mutant probe and / or L391S mutant probe; (2) Wild-type probes targeting the F395 site of the SQLE protein: F395I mutant probe and / or F395L mutant probe; The detection probe is used to detect whether there is a nucleotide mutation in the sample that causes the SQLE amino acid substitution described in claim 2.

8. The detection kit according to claim 5, characterized in that, The detection reagents include CRISPR-related nuclease and targeted Microsporum canis. SQLE crRNA at the mutation site region and nucleic acid reporter molecules; the crRNA targets include SQLE The nucleic acid region containing the mutated bases at positions 1172, 1173, and / or 1183 is used to detect the mutation as described in claim 3. SQLE Gene base mutation; the CRISPR-related nuclease is selected from Cas12a, Cas12b and variants with trans nucleic acid cleavage activity.

9. A strain for evaluating the activity of drugs against Microsporum canis, characterized in that, The strain model is a strain carrying the SQLE L391F mutation, obtained through natural isolation or genetic engineering, and the SQLE L391F mutation corresponds to *Microsporum canis*. SQLE The strain has an A→C mutation at base position 1173 of the gene; the strain is able to express the SQLE protein containing the L391F amino acid substitution and exhibits decreased terbinafine sensitivity and / or increased minimum inhibitory concentration of terbinafine compared to the control strain expressing the wild-type SQLE protein.

10. A method for screening drugs against Microsporum canis, characterized in that, include: (1) Provide the Microsporum canis strain carrying the SQLE L391F mutation as described in claim 9; (2) Contact the candidate drug with the Microsporum canis strain; (3) Detect the inhibitory effect of the candidate drug on the growth, reproduction or survival of the strain; (4) Based on the inhibitory effect, candidate drugs for inhibiting the growth of Microsporum canis were screened.

Images