A SNP molecular marker c6-20265010 related to the content of sesame tocopherol and application thereof

Abstract

The application provides a SNP molecular marker C6-20265010 related to the content of sesame tocopherol and an application thereof. The SNP molecular marker is located at the 29th position from the 5' end of a sequence as shown in SEQ ID NO:1, and the polymorphism of the SNP molecular marker is T / C. The SNP molecular marker can be used for screening of the content of sesame tocopherol and selection of varieties, and helps to improve the breeding efficiency of high-tocopherol varieties.

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, specifically to an SNP molecular marker C6-20265010 related to the tocopherol content of sesame and its application. Background Technology

[0002] Tocopherol, also known as vitamin E, was first discovered in 1922. It plays an irreplaceable role in the physiological metabolism of humans and animals. However, the body cannot synthesize it and must obtain it through diet. It is widely known for its antioxidant properties. As a natural antioxidant, tocopherol can effectively reduce non-enzymatic oxidative damage to cells and lipids caused by free radicals or reactive oxygen species, inhibit lipid peroxidation, and protect biological membranes. Numerous studies have shown that tocopherol has various potential beneficial effects on human health, such as anti-cancer, anti-atherosclerosis, anti-cardiovascular, neuroprotective, and inhibitory effects on chronic diseases such as Alzheimer's disease. These health effects make tocopherol an important target molecule for nutritional fortification and functional food development.

[0003] Sesame( Sesamum indicum Sesame (L.) belongs to the genus *Sesamum* of the family Sesamaceae and is an annual herbaceous oilseed crop widely cultivated in Asia and Africa. Sesame seeds are rich in oil, protein, and various trace active ingredients, with tocopherol content being particularly high, thus making them a superior natural source of tocopherols. Sesame can be eaten directly or used to extract high-quality edible oil, and it can also be used as a spice, medicinal plant, and chemical raw material, possessing both economic and nutritional value. Studies have found significant differences in tocopherol content among different sesame varieties, exhibiting rich genetic variation. Therefore, in-depth exploration of key genetic regulatory sites for tocopherol content in sesame-specific germplasm and targeted improvement using modern molecular breeding techniques holds promise for significantly improving the nutritional quality of sesame and meeting the public's growing demand for health protection.

[0004] Traditional breeding methods, due to their long breeding cycles and low selection efficiency, are insufficient to meet current crop breeding needs. In recent years, with the rapid development of high-throughput sequencing technology and molecular genetics methods, genotype-based precision selection strategies have gradually become important tools in crop breeding. Screening for genetic markers significantly associated with target traits across the entire genome, combined with marker-assisted selection, can overcome the difficulties in identifying tocopherol content phenotypes, enabling rapid tracking and aggregation of superior alleles, and greatly improving breeding efficiency. Currently, there are no reports of the identification of relevant genetic regulatory sites in sesame. Summary of the Invention

[0005] To address the problems existing in the background art, the present invention provides an SNP molecular marker C6-20265010 related to the tocopherol content of sesame and its application. This SNP molecular marker can be used for screening the tocopherol content trait in sesame and for breeding varieties, which helps to improve the breeding efficiency of high-tocopherol varieties.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, the present invention provides an SNP molecular marker C6-20265010 related to the content of tocopherol in sesame seeds. The SNP molecular marker is located at position 29 from the 5' end of the sequence shown in SEQ ID NO:1, and the polymorphism of the SNP molecular marker is T / C.

[0007] Secondly, the present invention provides a reagent or kit for detecting the above-mentioned SNP molecular marker C6-20265010 in the application of sesame tocopherol content screening breeding.

[0008] According to the above scheme, the reagents include a primer set and / or a probe set for detecting the SNP molecular marker.

[0009] According to the above scheme, the reagent includes at least one of the following: Primer set for KASP genotyping detection; Primer set and probes for TaqMan fluorescent probe assay; Allele-specific primer set for ARMS-PCR detection; Amplification primer set for high-resolution melting curve (HRM) detection.

[0010] Thirdly, the present invention provides a KASP primer set for detecting the SNP molecular marker C6-20265010 related to the content of sesame tocopherol, comprising allelic forward primer F1, allelic forward primer F2, and a shared reverse primer R, the nucleotide sequences of which are as follows: Allelic forward primer F1: 5'-ACTGCTCTTATTTCAATAAATTCTCTTTT-3'; Allelic forward primer F2: 5'-ACTGCTCTTATTTCAATAAATTCTCTTTC-3'; Reverse primer R: 5'-TGTGTGCTTGCATAGATGTGT-3' According to the above scheme, the 5' ends of forward primers F1 and F2 are labeled with different tag sequences.

[0011] Fourthly, the present invention provides a kit for detecting the SNP molecular marker C6-20265010 related to the content of sesame tocopherol, comprising the above-mentioned KASP primer set.

[0012] Fifthly, the present invention provides a method for screening and breeding sesame seeds based on the tocopherol content trait, comprising the following steps: S1. The SNP molecular marker C6-20265010 of sesame was detected to obtain the genotype of the SNP site. The SNP molecular marker is located at position 29 from the 5' end of the sequence shown in SEQ ID NO:1. The polymorphism of the SNP molecular marker is T / C. S2. Screen individuals with the genotype TT at the SNP locus and measure the tocopherol content of the screened individuals; S3. Select individuals with tocopherol content higher than a preset threshold as breeding materials.

[0013] According to the above scheme, the sesame tocopherol content trait screening breeding method also includes the following steps: S4. Cross the sesame individuals selected in step S3 with the target parents to obtain a hybrid offspring population; S5. Detect the genotype of the SNP molecular marker in the hybrid offspring population, screen individuals with the genotype TT at the SNP locus, and determine their tocopherol content; S6. Select hybrid offspring individuals with tocopherol content higher than a preset threshold as target offspring obtained through selective breeding.

[0014] According to the above scheme, the method for detecting the genotype of SNP molecular markers is as follows: using sesame genomic DNA as a template, competitive allele-specific PCR amplification is performed using the above KASP primer set to obtain the genotype of the SNP locus.

[0015] According to the above scheme, the amplification program is as follows: 94℃ for 15 min; 94℃ for 20 s, 65℃ for 1 min, 10 cycles; 95℃ for 20 s, 57℃ for 1 min, 28 cycles; 25℃ for 1 min; after the amplification is completed, the fluorescence signal is collected and the genotype is determined.

[0016] The beneficial effects of this invention are: This invention has discovered an SNP molecular marker C6-20265010 that is significantly associated with tocopherol content in sesame, providing a reliable source of molecular markers for the pre-selection of tocopherol content traits in sesame. At the same time, this SNP molecular marker can also be used in the screening and breeding of sesame varieties or lines for tocopherol content traits, which can greatly reduce the workload of breeding screening, shorten the breeding cycle, and improve breeding efficiency. Attached Figure Description

[0017] Figure 1 This is a comparison of the tocopherol content of SiVE6_1-marked materials of different genotypes in 100 sesame germplasm resources in Example 3 of the present invention. TT(58) represents 58 materials with the TT genotype in 100 sesame germplasm resources, and CC(42) represents 42 materials with the CC genotype in 100 sesame germplasm resources. Detailed Implementation

[0018] The principles and features of the present invention are described below with reference to specific embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0019] Example 1: Acquisition of SNP sites related to sesame tocopherol content trait Based on geographical origin and genetic diversity testing results, a tiered sampling strategy was adopted to select 260 sesame accessions from domestic and international resources preserved in the National Sesame Mid-Term Bank to construct an association population. High-coverage whole-genome resequencing was performed on the 260 sesame accessions using paired-end sequencing on the Illumina Hiseq2500 sequencing platform, yielding over 1.3 million high-quality SNP markers for genome-wide association analysis.

[0020] The 260 sesame materials mentioned above were cultivated at the Wuchang base in Wuhan City, Hubei Province. Each material was planted with 30 plants per replicate in a randomized block design. After normal maturity in the plots, the sesame seeds were harvested manually, naturally dried, and then threshed. Under different conditions, equal amounts of three replicates from each material were mixed and the tocopherol content was determined and analyzed using ultra-high performance liquid chromatography (UPLC).

[0021] Genome-wide association analysis combining genotype data and sesame tocopherol content data revealed a significant association between the SNP marker C6-20265010 and sesame tocopherol content on chromosome 6, which explains 7.36% of the phenotypic variation. This SNP variant (the variation from T to C) is located at base 20265010 on chromosome 6 of the sesame “Zhongzhi 13” reference genome.

[0022] The SNP site is located at position 29 from the 5' end of the sequences shown in SEQ ID NO:1 and SEQ ID NO:2, and its polymorphism is T / C.

[0023] SEQ ID NO:1 actgctcttatttcaataaattctcttt t atatcaggtaaacaaaaatgagaatacacatctatgcaagcacaca SEQ ID NO:2 actgctcttatttcaataaattctctttc atatcaggtaaacaaaaatgagaatacacatctatgcaagcacaca Example 2: Development of KASP primer set for SNP molecular marker C6-20265010 associated with tocopherol content trait A 200 bp sequence was extracted from the front and rear of chromosome 6 (20265010) of sesame. Following the principles of KASP (Kompetitive Allele-Specific PCR) molecular marker primer design, a KASP molecular marker, SiVE6_1, was developed targeting the positive strand. This marker includes two competitive forward primers, SiVE6_1-F1 and SiVE6_1-F2, corresponding to the T and C bases at the aforementioned SNP mutation site, respectively, and a reverse universal primer, SiVE6_1-R. The primer sequences are as follows: SiVE6_1-F1:actgctcttatttcaataaattctctttt (SEQ ID NO:3) SiVE6_1-F2:actgctcttatttcaataaattctctttc (SEQ ID NO:4) SiVE6_1-R:tgtgtgcttgcatagatgtgt (SEQ ID NO:5) The primers mentioned above must be developed according to the principles of KASP markers, and a universal adapter with the KASP marker must be added before use.

[0024] The connector sequence added before SiVE6_1-F1 is gaaggtgaccaagttcatgct (SEQ ID NO:6), and the connector sequence added before SiVE6_1-F2 is gaaggtcggagtcaacggatt (SEQ ID NO:7).

[0025] The sequence amplified in sesame G621 is of the TT genotype, and the sequence is shown below: actgctcttatttcaataaattctcttttatatcaggtaaacaaaaatgagaatacacatctatgcaagcacaca (shown in SEQ ID NO. 1).

[0026] The sequence amplified in sesame G520 is of the CC genotype, and the sequence is shown below: actgctcttatttcaataaattctctttcatatcaggtaaacaaaaatgagaatacacatctatgcaagcacaca (shown in SEQ ID NO. 2).

[0027] (2) Genotyping of the markers was performed in the sesame-related population using competitive allele-specific PCR. Amplification was performed using the OretBiotech Universal Direct Amplification Real-Time Competitive Allele-Specific Amplification Detection Kit (Catalog No.: CPR02190). Following the kit instructions, a 10 μL reaction system was designed: 5 μL of 2×Allele-Specific Detection Master Mix, 0.15 μL of FAM primer (10 μM), 0.15 μL of HEX primer (10 μM), 0.4 μL of CommonR primer (10 μM), and 10-100 ng of sesame genomic DNA. The amplification program was: 94℃ for 15 min; 94℃ for 20 s, 65℃ for 1 min, 10 cycles; 95℃ for 20 s, 57℃ for 1 min, 28 cycles; 25℃ for 1 min. Fluorescence signals were collected after amplification, and genotyping was performed. Association analysis using rMVP software revealed a significant association between the SiVE6_1 marker and the tocopherol content in sesame seeds.

[0028] Example 3: Application of the SNP locus C6-0265010 related to sesame tocopherol content trait in sesame tocopherol content trait screening breeding. One hundred materials were randomly selected from the germplasm resource bank and planted at the Wuchang base in Wuhan, Hubei Province. Each material had 30 plants per replicate, with three replicates. After normal maturity, the materials were harvested manually, naturally dried, and then threshed. Five plants from each replicate of each material were mixed and analyzed for tocopherol content using ultra-high performance liquid chromatography (UPLC).

[0029] The genotypes of the SiVE6_1 marker were classified using the detection method described in Example 2. The results showed that 58 of the 100 samples had the TT genotype (average tocopherol content of 307.76 mg / kg), and 42 samples had the CC genotype (average tocopherol content of 272.68 mg / kg). The T-test results indicated a highly significant difference in tocopherol content between the TT and CC genotypes detected by the SiVE6_1 molecular marker. P <0.0001)( Figure 1 ).

[0030] The distribution of the two genotypes of the molecular marker SiVE6_1 in the above materials with high and low tocopherol content was examined, and the results are shown in Table 1 below.

[0031] Table 1: Genotypes of the molecular marker SiVE6_1 in sesame tocopherol content extreme materials

[0032] The results showed that among the 20 materials with high tocopherol content, 13 of the SiVE6_1 samples had the TT genotype and 7 had the CC genotype, while among the 20 materials with low tocopherol content, 3 had the TT genotype and 17 had the CC genotype. This indicates that the prepared molecular marker SiVE6_1 is highly correlated with sesame tocopherol content and can therefore be used for marker-assisted selection of the tocopherol content trait in sesame.

[0033] Furthermore, the method for using the SNP loci developed in this invention to screen for tocopherol content in sesame seeds includes the following steps: (1) The SNP molecular marker C6-20265010 of sesame was detected to obtain the genotype of the SNP site. The SNP molecular marker is located at position 29 from the 5' end of the sequence shown in SEQ ID NO:1. The polymorphism of the SNP molecular marker is T / C. (2) Screen individuals with the genotype TT at the SNP locus and measure the tocopherol content of the screened individuals; (3) Select individuals with tocopherol content higher than the preset threshold as breeding materials.

[0034] Furthermore, it also includes the following steps: (4) The sesame individuals obtained in step (3) are crossbred with the target parent to obtain a hybrid offspring population; (5) Detect the genotype of the SNP molecular marker in the hybrid offspring population, screen individuals with the genotype TT at the SNP locus, and determine their tocopherol content; (6) Select hybrid offspring individuals with tocopherol content higher than the preset threshold as the target offspring obtained through breeding.

[0035] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A SNP molecular marker C6-20265010 related to the tocopherol content of sesame seeds, characterized in that, The SNP molecular marker is located at position 29 from the 5' end of the sequence shown in SEQ ID NO:1, and the polymorphism of the SNP molecular marker is T / C.

2. Application of the reagent or kit for detecting the SNP molecular marker C6-20265010 as described in claim 1 in the screening breeding of sesame tocopherol content.

3. The application according to claim 2, characterized in that, The reagents include a primer set and / or probe set for detecting the SNP molecular marker.

4. The application according to claim 3, characterized in that, The reagent includes at least one of the following: Primer set for KASP genotyping detection; Primer set and probes for TaqMan fluorescent probe assay; Allele-specific primer set for ARMS-PCR detection; Amplification primer set for high-resolution melting curve (HRM) detection.

5. A KASP primer set for detecting the SNP molecular marker C6-20265010 associated with sesame tocopherol content as described in claim 1, characterized in that, The nucleotide sequences of allelic forward primer F1, allelic forward primer F2, and shared reverse primer R are as follows: Allelic forward primer F1: 5'-ACTGCTCTTATTTCAATAAATTCTCTTTT-3'; Allelic forward primer F2: 5'-ACTGCTCTTATTTCAATAAATTCTCTTTC-3'; Reverse primer R: 5'-TGTGTGCTTGCATAGATGTGT-3'.

6. The KASP primer set according to claim 5, characterized in that, The 5' ends of forward primers F1 and F2 are labeled with different tag sequences.

7. A kit for detecting the SNP molecular marker C6-20265010 associated with sesame tocopherol content as described in claim 1, characterized in that, Includes the KASP primer set as described in claim 5 or 6.

8. A method for screening and breeding sesame seeds based on tocopherol content, characterized in that, Includes the following steps: S1. The SNP molecular marker C6-20265010 of sesame was detected to obtain the genotype of the SNP site. The SNP molecular marker is located at position 29 from the 5' end of the sequence shown in SEQ ID NO:

1. The polymorphism of the SNP molecular marker is T / C. S2. Screen individuals with the genotype TT at the SNP locus and measure the tocopherol content of the screened individuals; S3. Select individuals with tocopherol content higher than a preset threshold as breeding materials.

9. The breeding method according to claim 8, characterized in that, It also includes the following steps: S4. Cross the sesame individuals selected in step S3 with the target parents to obtain a hybrid offspring population; S5. Detect the genotype of the SNP molecular marker in the hybrid offspring population, screen individuals with the genotype TT at the SNP locus, and determine their tocopherol content; S6. Select hybrid offspring individuals with tocopherol content higher than a preset threshold as target offspring obtained through selective breeding.

10. The breeding method according to claim 9, characterized in that, The method for detecting the genotype of SNP molecular markers is as follows: using sesame genomic DNA as a template, competitive allele-specific PCR amplification is performed using the primer set described in claim 5 or 6 to obtain the genotype of the SNP site.

Images