A rpa-lfd primer-probe combination, kit, application and detection method for detecting ascochyta maydis

Abstract

The present application relates to the technical field of plant disease detection, in particular to a kind of RPA-LFD primer pair probe combination for detecting corn small spot bacteria, kit, application and detection method.Extract sample genome total DNA, PRA amplification, LFD and 2.0% gel electrophoresis etc., if single band exists in gel electrophoresis, and LFD test strip appears 2 purple red bands, 1 in quality control area, 1 in detection area, then the result is positive, prove that there is corn small spot bacteria in the sample to be tested.The present application designs special primer and probe for the specific region of corn small spot bacteria reductase gene [reductase (Brn1) gene] sequence, which can quickly, simply, specifically and sensitively detect corn small spot bacteria, effectively solve the problem of existing detection being more complicated, time-consuming and labor-intensive.

Description

Technical Field

[0001] This invention relates to the field of plant disease detection technology, and in particular to an RPA-LFD primer-probe combination, kit, application, and detection method for detecting maize leaf spot fungus. Background Technology

[0002] Small leaf spot of corn is a typical and important fungal disease of corn leaves.

[0003] Accurate diagnosis of maize leaf spot disease is a fundamental prerequisite for effective disease control. Therefore, establishing a rapid, accurate, and easy-to-use detection method for maize leaf spot pathogens is of significant practical importance. Traditional methods for identifying maize pathogens mainly involve pathogen isolation and species identification based on morphological characteristics and molecular biology techniques. These methods are cumbersome, time-consuming, and require strong professional knowledge, thus limiting their effectiveness. In recent years, with the rapid development of biotechnology, nucleic acid-based detection technologies have been applied to the detection of plant pathogens, including conventional PCR, real-time quantitative PCR, nested PCR, nucleic acid hybridization, and loop-mediated isothermal amplification (LAM). However, these techniques are complex and require expensive materials and equipment, making them difficult to apply directly in the field. In contrast, recombinase polymerase amplification (RPA) technology does not have strict requirements regarding template integrity, reaction temperature, or time, thus showing significant application potential in the development of portable nucleic acid detection. Furthermore, RPA amplification products can be combined with lateral flow dipsticks (LFD), fluorescent dyes, etc., to achieve rapid visualization. Currently, RPA-LFD technology has been successfully applied to the detection of various pests, such as Akaspot virus, wheat smut, Alexandrium tamarense, and potato stem rot nematode. However, research on RPA-LFD detection technology for maize leaf spot pathogens and its application in the field have not yet been reported. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides an RPA-LFD primer-probe combination, kit, application, and detection method for detecting *B. maydis*. Based on the *Bipolaris maydis* reductase gene sequence (accession number: MT130208.1), this invention designs specific primers and probes for *B. maydis* RPA-LFD detection. Through optimization of reaction conditions (temperature and time), a rapid and visualized RPA-LFD detection system for *B. maydis* is established. The specificity and sensitivity of this detection method are further evaluated, and the detection effect is validated based on field samples suspected of being infected. The aim is to provide a highly specific, sensitive, simple, and visualized detection method for rapid field diagnosis of maize small leaf spot.

[0005] This invention, by comparing the specific region of the reductase (Brn1) gene sequence of *Bipolaris maydis* (accession number: MT130208.1), and based on the principles of RPA primer and probe design, designed specific primers BMF3 / BMR3 and probe BM-probe for the *B. maydis* PRA-LFD reaction. Based on the optimization of the RPA reaction system, a *B. maydis* PRA-LFD detection method was established. The specificity, sensitivity, and applicability of the established *B. maydis* PRA-LFD method were tested and evaluated, ultimately establishing an RPA-LFD detection method suitable for rapid detection of *B. maydis*.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides an RPA-LFD primer-probe combination for detecting maize leaf spot fungus, including primer BMF3, primer BMR3 and probe BM-probe;

[0008] The nucleotide sequence of the primer BMF3 is shown in SEQ ID No. 1;

[0009] The nucleotide sequence of the primer BMR3 is shown in SEQ ID No. 2;

[0010] The nucleotide sequence of the probe BM-probe is shown in SEQ ID No. 3.

[0011] Preferably, the 5' end of the primer BMR3 is labeled with biotin;

[0012] The probe BM-probe has a fluorescent group 6-FAM added to its 5' end and a modifying group C3-Spacer added to its 3' end to inhibit polymerase extension or amplification. Furthermore, the base at a distance of 30 bp from the 5' end of the probe is replaced by tetrahydrofuran.

[0013] The present invention also provides an RPA-LFD kit for detecting maize leaf spot pathogen, comprising the RPA-LFD primer-probe combination described in the above technical solution.

[0014] This invention also provides the application of the RPA-LFD primer-probe combination or the RPA-LFD kit described in the above technical solutions in the detection of maize leaf spot pathogen.

[0015] The present invention also provides a method for detecting corn leaf blight pathogens, comprising the following steps:

[0016] 1) Extract genomic DNA from the sample to be tested;

[0017] 2) Using the genomic DNA described in step 1) as a template, RPA amplification is performed using the RPA-LFD primer-probe combination described in the above technical solution to obtain the amplification product;

[0018] 3) Mix the amplification product obtained in step 2) with the detection buffer to obtain a mixture. Immerse the detection end of the LFD test strip vertically into the mixture. When two purple-red bands appear on the LFD test strip, corn leaf spot pathogen is detected.

[0019] Preferably, the sample to be tested in step 1) includes corn leaves.

[0020] Preferably, the RPA amplification system in step 2) is as follows: 29.5 μL of rehydration buffer, 2.1 μL of 10 μmol / L primer BM3F, 2.1 μL of 10 μmol / L primer BM3R, 0.6 μL of 10 μmol / L probe BM probe, 1.0 μL of genomic DNA, and 12.2 μL of sterile double-distilled water. After mixing the above components, add them to the RPA lyophilized enzyme powder, followed by 2.5 μL of 280 mmol / L magnesium acetate.

[0021] Preferably, the reaction conditions for RPA amplification in step 2) are: after incubation at 38°C for 4 min, mix well and centrifuge slightly, then continue incubation at 38°C for 26 min.

[0022] Preferably, the volume ratio of the amplification product to the detection buffer in step 3) is 1:19;

[0023] The detection end of the LFD test strip is vertically immersed in the mixed solution for 5 minutes.

[0024] Preferably, in step 3), to ensure the accuracy of the detection results, the amplification product is mixed with an equal volume of phenol / chloroform / isoamyl alcohol, centrifuged at 12000g for 5min, and the supernatant is subjected to 1.5% agarose gel electrophoresis. When a single band is amplified, corn leaf spot pathogen is detected; the volume ratio of phenol, chloroform and isoamyl alcohol is 25:24:1.

[0025] The beneficial effects of this invention are:

[0026] (1) High specificity and accuracy: This invention compares the specific region of the reductase (Brn1) gene sequence of Bipolaris maydis (accession number: MT130208.1) and designs specific primers BMF3 / BMR3 and probe BM-probe for the B. maydis PRA-LFD reaction based on the RPA primer and probe design principles. On the basis of RPA reaction system optimization, a B. maydis PRA-LFD detection method is established. This invention detects common corn pathogens, and only the B. maydis is positive, while the other pathogens are negative. The specificity and accuracy are extremely high.

[0027] (2) High sensitivity: The DNA detection limit of the present invention is 1 pg / μL, and the sensitivity is significantly higher than that of conventional PCR and LAMP.

[0028] (3) High efficiency and speed of detection: The RPA amplification system can amplify double-stranded DNA at 38℃ and obtain a visual result in as little as 30 minutes, overcoming the disadvantages of long time consumption of conventional PCR and LAMP.

[0029] (4) Simple operation, no special equipment required, and strong applicability: This invention can detect whether corn leaves carry the corn leaf blight pathogen (Bipolaris maydis), which is of great significance for early diagnosis, inspection and quarantine, prediction and forecasting and precise control of corn leaf blight. It overcomes the disadvantages of PCR detection, which requires complex instruments and equipment and takes a long time. It is suitable for rapid detection at the grassroots level or on site and has important practical application value.

[0030] (5) Stable and easy-to-understand results: The detection results in this invention are presented by the quality control line and the detection line. The results are stable and easy to understand, which overcomes the shortcomings of LAMP detection in the field, such as unclear color differentiation and unstable results due to light and other reasons.

[0031] In summary, this invention can accurately monitor whether maize plants contain *Bipolarismaydis*, the pathogen causing maize leaf spot, and overcomes the drawbacks of conventional PCR and LAMP detection methods, such as long detection time, high cost (and inconvenience to carry), complex operation, and unstable results. It boasts advantages such as high specificity, high sensitivity, simple operation, and high timeliness. This invention can be used for efficient and precise specific detection of *Bipolarismaydis* in the field, providing a theoretical basis for precision control. Attached Figure Description

[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0033] Figure 1 Screening of RPA primers for the specific detection of maize leaf spot pathogen; M: DL2000 marker; 1: primer BM3F / BM3R; 3: primer BM2F / BM2R; 5: primer BM1F / BM1R; 2, 4, 6: negative controls;

[0034] Figure 2 Optimization of the reaction temperature for Bipolaris maydis RPA-LFD; A: Gel electrophoresis detection of RPA products; B: Lateral chromatography strip detection of RPA products; M: DL2000 marker; 1-7 represent negative control, 36, 37, 38, 39, 40 and 42℃ respectively; C: Control line; T: Detection line;

[0035] Figure 3 Optimization of RPA-LFD reaction time for Bipolaris maydis; A: Gel electrophoresis detection of RPA products; B: Lateral chromatography strip detection of RPA products; M: DL2000 marker; 1-6: Negative control, 15, 25, 30, 35 and 40 min; C: Control line; T: Detection line;

[0036] Figure 4 Establishment of RPA-LFD detection method for Bipolaris maydis; A: Gel electrophoresis detection of RPA products; B: Lateral chromatography strip detection of RPA products; M: DL2000 marker; 1: Bipolaris maydis genomic DNA; 2: Negative control; C: Control line; T: Detection line;

[0037] Figure 5For Bipolaris maydis RPA-LFD specificity; A: Gel electrophoresis detection of RPA products; B: Lateral chromatography strip detection of RPA products; M: DL2000 marker; 1-8 are negative control, *Helicobacter pylori*, *Helicobacter rotundus*, *Helicobacter pylori*, *Helicobacter pylori*, *Helicobacter pylori*, *Helicobacter pylori*, and *Helicobacter pylori*, respectively; C: Control line; T: Detection line;

[0038] Figure 6 Sensitivity of Bipolaris maydis RPA-LFD based on genomic DNA concentration; A: Gel electrophoresis for RPA product detection; B: Lateral chromatography strip for RPA product detection; M: DL2000 marker; 1-6 represent negative control, 100 fg / μL, 1 pg / μL, 10 pg / μL, 100 pg / μL, and 1 ng / μL, respectively; C: Control line; T: Detection line;

[0039] Figure 7 For the detection of actual samples using the Bipolaris maydis RPA-LFD system; A: Gel electrophoresis detection of RPA products; B: Lateral chromatography strip detection of RPA products; M: DL2000 marker; 1: Negative control; 2-6: Maize leaves from different regions of Fujian Province; C: Control line; T: Detection line. Detailed Implementation

[0040] This invention provides an RPA-LFD primer-probe combination for detecting maize leaf spot fungus, comprising primer BMF3, primer BMR3, and probe BM-probe; the nucleotide sequence of primer BMF3 is shown in SEQ ID No. 1; the nucleotide sequence of primer BMR3 is shown in SEQ ID No. 2; and the nucleotide sequence of probe BM-probe is shown in SEQ ID No. 3. In this invention, the 5' end of primer BMR3 is labeled with biotin; the 5' end of probe BM-probe is supplemented with the fluorescent group 6-FAM, and the 3' end is supplemented with the modifying group C3-Spacer to inhibit polymerase extension or amplification; and the base at 30 bp from the 5' end of the probe is replaced with tetrahydrofuran.

[0041] SEQ ID No. 1:

[0042] 5'-TTCGGCCACTTCAAGGATGTCACCCCCGAGGAG-3';

[0043] SEQ ID No. 2:

[0044] Biotin-ACCTTCTTCTCACCAGCGTCTGAAACAATG -3';

[0045] SEQ ID No. 3:

[0046] 5'- 6-FAM-TATCCTCATGGGTTCCATCACCGGTCAGGC / THF / AAGGGTGT CCCCAAGCACG- / C3spacer / -3'.

[0047] The present invention also provides an RPA-LFD kit for detecting maize leaf spot pathogen, comprising the RPA-LFD primer-probe combination described in the above technical solution.

[0048] This invention also provides the application of the RPA-LFD primer-probe combination or the RPA-LFD kit described in the above technical solutions in the detection of maize leaf spot pathogen.

[0049] The present invention also provides a method for detecting corn leaf blight pathogens, comprising the following steps:

[0050] 1) Extract genomic DNA from the sample to be tested;

[0051] 2) Using the genomic DNA described in step 1) as a template, RPA amplification is performed using the RPA-LFD primer-probe combination described in claim 1 or 2 to obtain the amplification product;

[0052] 3) Mix the amplification product obtained in step 2) with the detection buffer to obtain a mixture. Immerse the detection end of the LFD test strip vertically into the mixture. When two purple-red bands appear on the LFD test strip, corn leaf spot pathogen is detected.

[0053] This invention extracts genomic DNA from samples to be tested. In this invention, the sample to be tested preferably includes maize leaves. This invention does not specifically limit the method for extracting genomic DNA from the sample; conventional methods can be used by those skilled in the art.

[0054] This invention uses the genomic DNA as a template and performs RPA amplification using the RPA-LFD primer-probe combination described in the above technical solution to obtain the amplification product. In this invention, the preferred RPA amplification system is as follows: 29.5 μL of rehydration buffer, 2.1 μL of 10 μmol / L primer BM3F, 2.1 μL of 10 μmol / L primer BM3R, 0.6 μL of 10 μmol / L probe BM probe, 1.0 μL of genomic DNA, and 12.2 μL of sterile double-distilled water. After mixing the above components, they are added to the RPA lyophilized enzyme powder, followed by 2.5 μL of 280 mmol / L magnesium acetate. In this invention, the preferred RPA amplification reaction conditions are: incubation at 38°C for 4 min, followed by mixing, slight centrifugation, and further incubation at 38°C for 26 min.

[0055] This invention involves mixing the amplification product with a detection buffer (HybriDetect Assay Buffer) to obtain a mixture. The detection end of the LFD test strip is vertically immersed in the mixture. When two purple-red bands appear on the LFD test strip, *Sclerotinia serratifolia*, the corn leaf blight pathogen, is detected. In this invention, the preferred volume ratio of the amplification product to the detection buffer is 1:19. The preferred immersion time of the detection end of the LFD test strip in the mixture is 5 minutes. To ensure the accuracy of the detection results, the amplification product is mixed with an equal volume of phenol / chloroform / isoamyl alcohol, centrifuged at 12000g for 5 minutes, and the supernatant is subjected to 1.5% agarose gel electrophoresis. When a single band is amplified, *Sclerotinia serratifolia*, the corn leaf blight pathogen, is detected. The volume ratio of phenol, chloroform, and isoamyl alcohol is 25:24:1.

[0056] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0057] Example 1

[0058] Design of specific primers and probes for RPA detection of Bipolaris maydis, the causal agent of maize leaf spot.

[0059] 1. Tested Strains: The tested strains included *Bipolaris maydis* (maize small leaf spot), *B. zeicola* (maize round leaf spot), *B. oryzae* (rice leaf spot spores), *B. zeae* (maize leaf spot spores), *B. sorokinina* (wheat root rot spores), *Exserohilum turcicum* (maize large leaf spot), *Curvulariaeragrostidis* (maize leaf spot spores), *Alternaria tenuissima* (maize leaf spot spores), *Fusarium verticillioides* (maize verticillium), *F. graminearum* (maize grain spores), *F. proliferatum* (maize sheath rot), *Rhizoctonia solani* (maize sheath blight), *Cercospora zeae-maydis* (maize gray leaf spot), *Pythium arrhenomanes* (maize stalk rot), *P. ultimum* (maize stalk rot), and *Colletotrichum* (maize anthracnose). truncatum. All the above strains are preserved at the Institute of Plant Protection, Fujian Academy of Agricultural Sciences.

[0060] 2. Mycelial collection and genomic DNA extraction

[0061] Genomic DNA was extracted from the sample using the CTAB method. 10 mg of sample was ground in liquid nitrogen, and 600 μL of CTAB extraction buffer (preheated to 65 °C) was added and mixed. The mixture was then incubated at 65 °C for 1 h (mixing every 15 min). After the reaction was complete and slightly cooled, an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) extraction solution was added and mixed. The mixture was then centrifuged at 12000 r / min for 8 min. The supernatant was collected and mixed with an equal volume of chloroform:isoamyl alcohol (24:1) extraction solution. After centrifugation at 12000 r / min for 8 min, the supernatant was collected and an equal volume of pre-cooled isopropanol was added. The mixture was incubated at –20 °C for at least 2 h, centrifuged at 12000 r / min for 10 min, and the supernatant was discarded. The sample was washed twice with 70% ethanol, thoroughly dried, and dissolved in 50 μL of sterile ddH2O. The DNA concentration and purity were determined using Nanodrop, and the mixture was stored at –20 °C for later use.

[0062] 3. Design of RPA detection-specific primers and probes

[0063] Using PrimerPremier 5.0 software, detection primers and probes were designed based on a specific region of the *Bipolaris maydis* reductase gene [reductase(Brn1) gene] sequence (accession number: MT130208.1) and according to RPA primer and probe design principles. RPA primers are typically 30 to 35 nucleotides long, amplifying fragments ranging from 100 to 400 bp in size. RPA probes are usually 46 to 52 bp in length. A 45 bp probe was designed based on the amplified fragment from the designed RPA primers. The probe had a 6-carboxyfluorescein (6-FAM) fluorescent group added to its 5' end and a C3-spacer added to its 3' end. A tetrahydrofuran (THF) base was substituted 30 bp from the 5' end of the probe. The reverse primer used for LFD-RPA was modified with biotin at its 5' end. The designed primers and probes are shown in Table 1 (Table 1). The detection primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0064] Table 1 shows the RPA-LFD primers and probes used in the study.

[0065] BM1F SEQ ID No.4: GGAGATGGGTGGCCGCATTATCCTCATGGG BM1R SEQ ID No.5: Biotin-AACCCGAGAATCCAAACGCTGAAGCGGATAAC BM2F SEQ ID No.6: TGGTCAGTTCTTCGTAGCCAAGGCCGCGTACA BM2R SEQ ID No.7: Biotin-GGCAACGCAGTTGACAGTGACCTTCTTCTCAC BM3F SEQ ID No.1: TTCGGCCACTTCAAGGATGTCACCCCCGAGGAG BM3R SEQ ID No.2: Biotin-ACCTTCTTCTCACCAGCGTCTGAAACAATG BM-probe SEQ ID No.3: 6-FAM-TATCCTCATGGGTTCCATCACCGGTCAGGC / THF / AAGGGTGTCCCCAAGCACG- / C3 spacer /

[0066] Example 2

[0067] Specific primer screening

[0068] Methods: Using genomic DNA of *Sclerotium cristatum* as a nucleic acid template, the nucleic acid was analyzed according to TwistAMP. Ⓡ Following the instructions of the Basic Kit (TABAS03KIT, TWISTDX), the following 50 μL reaction mixture was prepared: 29.5 μL rehydration buffer, 2.1 μL each of 10 μmol / L primers (Table 1), 0.6 μL of 10 μmol / L probe BM, 1.0 μL template DNA, and 12.2 μL sterile double-distilled water. After mixing these components, add them to the RPA lyophilized enzyme powder, followed by 2.5 μL of 280 mmol / L magnesium acetate, and invert to mix. Incubate the reaction mixture at 39°C for 4 min, then invert the tube 8-10 times to mix, briefly centrifuge, and continue incubating at 39°C for 26 min.

[0069] Following the Milenia Genline HybriDetect (Milenia biotec MGHD1, Milenia Genline, Germany) instructions, LFD was used for detection. 5 μL of the reaction product was mixed thoroughly with 95 μL of HybriDetectAssay Buffer. The sample detection end of the test strip was then vertically immersed in the mixture. After standing at room temperature for 5 minutes, the results were observed. If the test strip shows two purple-red bands, one in the control area and one in the detection area, the result is positive, indicating the presence of *Sclerotinia corniculatum* in the sample. If only one purple-red band appears in the control area and no band appears in the detection area, the result is negative, indicating the absence of the target pathogen in the sample. Meanwhile, to ensure the accuracy of the detection results, gel electrophoresis was used to detect the reaction products. After the reaction, an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) extraction solution was added to the reaction products and mixed well. The mixture was centrifuged at 12,000 r / min for 10 min, and the supernatant was added to 10× loading buffer for 2.0% agarose gel electrophoresis. Specific RPA primers were screened based on the amplification products.

[0070] Results: Based on the sequence of the *Bipolaris maydis* reductase gene [Brn1], three pairs of RPA primers and one probe were designed. Primer screening results showed that all three pairs of primers amplified genomic DNA of *Bipolaris maydis*, with amplified fragments of 172, 253, and 336 bp, respectively. Figure 1 Among them, the BM3F / BM3R amplification band was the brightest and clearest, therefore primers BM3F / BM3R were selected for subsequent experiments.

[0071] Example 3

[0072] Optimization of RPA reaction system

[0073] Methods: Based on the screening of RPA primers specific to *Sclerotinia serratifolia*, the RPA reaction temperature was first optimized. The reaction time was 30 min, and six temperature gradients (36, 37, 38, 39, 40, and 42 °C) were used for detection. After identifying the optimal reaction temperature, five time gradients (15, 25, 30, 35, and 40 min) were used to optimize the reaction time. After the reaction, the products of the different reactions were detected using LFD test strips and 2.0% gel electrophoresis. The clarity, color depth, and brightness of the electrophoretic bands were observed. The optimal reaction conditions for LFD-RPA detection were defined as clear and dark bands or the brightest electrophoretic bands. Each experiment was repeated three times.

[0074] Results: Using Bipolaris maydis genomic DNA as a template, with a reaction time of 30 min, detection at different temperature gradients showed that the RPA-LFD system could amplify clear electrophoretic bands and LFD positive bands at reaction temperatures of 37, 38, and 39 ℃. Figure 2 At 38 ℃, the electrophoretic bands and LFD positive bands are clearest, and less dimer formation occurs. Therefore, 38 ℃ was selected as the optimal reaction temperature for the Bipolaris maydis RPA-LFD detection system.

[0075] The reaction temperature was kept constant at 38 ℃, and the results of different reaction time gradients showed that ( Figure 3 At reaction times of 15, 25, 30, 35 and 40 min, clear electrophoretic bands and LFD positive bands were amplified. The bands amplified at reaction times of 30, 35 and 40 min were the brightest and clearest. There was no significant difference between the results of the three reaction times. Based on the principle that the shorter the time, the better, 30 min was selected as the optimal reaction time.

[0076] Example 4

[0077] Construction and Specificity Detection of RPA-LFD Detection System

[0078] Methods: Based on the optimization results of reaction conditions (temperature, time), the final Bipolaris maydis RPA-LFD amplification detection system (reaction system and procedure) was constructed as follows: A 50 μL reaction system consisted of: 29.5 μL rehydration buffer, 2.1 μL each of 10 μmol / L BM3F / BM3R, 0.6 μL of 10 μmol / L BM probe, 1.0 μL of B. maydis genomic DNA, and 12.2 μL of sterile double-distilled water. After mixing the above components, they were added to the RPA lyophilized enzyme powder, followed by 2.5 μL of 280 mmol / L magnesium acetate, and the mixture was inverted and mixed thoroughly. The reaction system was incubated at 38℃ for 4 min, then the reaction tube was inverted 8-10 times to mix, briefly centrifuged, and incubated at 38℃ for another 26 min. The amplification products were detected using LFD and 2.0% agarose gel electrophoresis, following the same procedure as in step 3 (5 μL of reaction product was mixed thoroughly with 95 μL of HybriDetect Assay Buffer, and the sample detection end of the test strip was vertically immersed in the mixture. After standing at room temperature for 5 min, the results were observed. If two purple-red bands appeared on the test strip, one in the control area and one in the detection area, the result was positive. If only one purple-red band appeared in the control area and no band appeared in the detection area, the result was negative. To ensure the accuracy of the amplification results, after the reaction, an equal volume of phenol / chloroform solution was added to the reaction product, mixed thoroughly, centrifuged at 12,000 g for 5 min, and 5 μL of the supernatant was taken for 1.5% agarose gel electrophoresis and the results were observed).

[0079] Results: The constructed Bipolaris maydis RPA-LFD detection system was validated using B. maydis genomic DNA as a template. Agarose gel electrophoresis was used to detect the amplification products. The results showed that the designed primer pairs amplified clear and single bands, and the target fragment size was 336 bp. Figure 4 According to LFD test results, in the reaction system containing B. maydis DNA, the test strip showed two purple-red bands, one in the control area and one in the test area. In contrast, the negative control test strip only showed one purple-red band in the control area, with no band in the test area. Figure 4 (B) indicates that the constructed Bipolaris maydis RPA-LFD detection system can be used for subsequent experiments.

[0080] The specificity of Bipolaris maydis RPA-LFD was verified using the genomic DNA of the tested strains. The results showed that only B. maydis genomic DNA was positive, while the genomic DNA of the other tested strains was negative. Figure 5 This indicates that the Bipolaris maydis RPA-LFD detection system can specifically detect Bipolaris maydis.

[0081] Example 5

[0082] Sensitivity detection of the RPA-LFD system

[0083] Methods: To validate the sensitivity of the RPA-LFD method, extracted maize leaf spot pathogen genomic DNA was serially diluted 10-fold to concentrations of 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, and 10 fg / μL. Using these different concentrations of maize leaf spot pathogen DNA as templates and ddH2O as a control, RPA-LFD detection was performed according to the established reaction system and procedure. After the reaction, the reaction products were detected using LFD test strips and 2.0% gel electrophoresis. A positive result was indicated by two purple-red bands on the test strip, one in the control zone and one in the detection zone. A positive result was also indicated by the appearance of a specific band on the electrophoresis result. The detection sensitivity of RPA-LFD was evaluated based on the results. All experiments were performed in triplicate under the same conditions. Sensitivity testing of the method was then conducted.

[0084] Results: Genomic DNA sensitivity testing showed that all test strips had visible control lines, and at template DNA concentrations of 1 pg / μL to 1 ng / μL, the test strips had clearly visible detection lines, and electrophoresis results were all positive. Figure 6 This indicates that the minimum detection limit of the RPA-LFD detection method is 1 pg / μL.

[0085] Example 6

[0086] Leaf tissue bacterial contamination detection

[0087] Methods: To evaluate the feasibility of the RPA-LFD detection method in actual production, leaves with suspected maize leaf spot symptoms were collected from Fuzhou, Sanming, Fu'an, and Jian'ou cities in Fujian Province. Genomic DNA was extracted from the diseased tissue using the CTAB method. Maize leaf spot pathogen genomic DNA was used as a positive control, and sterilized ddH2O was used as a blank control. The optimized RPA-LFD detection system was used for detection, and the applicability of RPA-LFD was preliminarily evaluated based on the detection results. The experiment was repeated three times.

[0088] Results: Bipolaris maydis RPA-LFD detection of maize leaves collected from different regions showed that all 23 samples produced a positive reaction, with bands appearing in the detection area, while the negative control only showed one control line, indicating a positive electrophoresis result. Figure 7 The results showed that all 23 samples were infected with maize leaf spot fungus, indicating that the Bipolarismaydis RPA-LFD detection technology established in this study can be used for the rapid diagnosis of maize leaf spot.

[0089] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An RPA-LFD primer-probe combination for detecting maize leaf spot pathogen, characterized in that, This includes primers BMF3 and BMR3, and the probe BM-probe; The nucleotide sequence of the primer BMF3 is shown in SEQ ID No. 1; The nucleotide sequence of the primer BMR3 is shown in SEQ ID No. 2; The nucleotide sequence of the probe BM-probe is shown in SEQ ID No.

3.

2. The RPA-LFD primer-probe combination according to claim 1, characterized in that, The primer BMR3 is labeled with Biotin at its 5' end; The probe BM-probe has a fluorescent group 6-FAM added to its 5' end and a modifying group C3-Spacer added to its 3' end to inhibit polymerase extension or amplification. Furthermore, the base at a distance of 30 bp from the 5' end of the probe is replaced by tetrahydrofuran.

3. An RPA-LFD kit for detecting maize leaf spot pathogen, characterized in that, Includes the RPA-LFD primer-probe combination as described in claim 1 or 2.

4. The use of the RPA-LFD primer-probe combination according to any one of claims 1 to 2 or the RPA-LFD kit according to claim 3 in the detection of maize leaf spot pathogen.

5. A method for detecting corn leaf blight pathogen, characterized in that, Includes the following steps: 1) Extract genomic DNA from the sample to be tested; 2) Using the genomic DNA described in step 1) as a template, RPA amplification is performed using the RPA-LFD primer-probe combination described in claim 1 or 2 to obtain the amplification product; 3) Mix the amplification product obtained in step 2) with the detection buffer to obtain a mixture. Immerse the detection end of the LFD test strip vertically into the mixture. When two purple-red bands appear on the LFD test strip, corn leaf spot pathogen is detected.

6. The method according to claim 5, characterized in that, Step 1) The sample to be tested includes corn leaves.

7. The method according to claim 5, characterized in that, Step 2) The RPA amplification system is as follows: 29.5 μL of rehydration buffer, 2.1 μL of 10 μmol / L primer BM3F, 2.1 μL of 10 μmol / L primer BM3R, 0.6 μL of 10 μmol / L probe BM probe, 1.0 μL of genomic DNA, and 12.2 μL of sterile double-distilled water. After mixing the above components, add them to the RPA lyophilized enzyme powder, and then add 2.5 μL of 280 mmol / L magnesium acetate.

8. The method according to claim 5, characterized in that, Step 2) The reaction conditions for RPA amplification are as follows: after incubation at 38°C for 4 min, mix well and centrifuge slightly, then continue incubation at 38°C for 26 min.

9. The method according to claim 5, characterized in that, Step 3) The volume ratio of the amplification product to the detection buffer is 1:19; The detection end of the LFD test strip is vertically immersed in the mixed solution for 5 minutes.

10. The method according to claim 5, characterized in that, Step 3) To ensure the accuracy of the detection results, the amplification product is mixed with an equal volume of phenol / chloroform / isoamyl alcohol, centrifuged at 12000g for 5min, and the supernatant is subjected to 1.5% agarose gel electrophoresis. When a single band is amplified, corn leaf blight is detected; the volume ratio of phenol, chloroform and isoamyl alcohol is 25:24:1.

Images