A kasp molecular marker related to soybean two-grain pod size, primer and application thereof

Abstract

The application belongs to the technical field of soybean molecular breeding, and more particularly relates to a KASP molecular marker related to soybean two-seeded pod size, a primer and an application thereof. The application identifies a target SNP site S02_5725405 extremely significantly related to two-seeded pod length and pod width at 5725405 bp of chromosome 2 of a soybean reference genome Wm82.a2.v1 version 2, and the site has C / T base variation. The application develops a KASP molecular marker and a primer set thereof aiming at the site, and genotype precise typing can be realized. Germplasm verification results show that the two-seeded pod length and pod width of soybean with a TT genotype are significantly greater than those of soybean with a CC genotype. The SNP site and the developed KASP molecular marker can realize early precise selection of two-seeded pod size, and are particularly suitable for breeding and germplasm improvement of fresh soybean large-pod excellent varieties, and improve the efficiency of soybean molecular marker assisted breeding.

Description

Technical Field

[0001] This invention belongs to the field of soybean molecular breeding technology, and more specifically, relates to a KASP molecular marker, primers and their applications related to the size of two soybean pods. Background Technology

[0002] Fresh soybeans, also known as vegetable soybeans, have become a popular specialty economic crop due to their sweet taste, rich nutrition, and convenient consumption. Two-pod soybeans are the main commercial pod type for fresh soybeans. Their pod length and width, among other appearance traits, significantly influence the commercial appearance, market grade, and economic value of fresh soybean pods. Therefore, developing large-pod, high-quality fresh soybean varieties is one of the core objectives of current fresh soybean breeding.

[0003] Traditional screening and identification of the two-pod size trait in soybeans mainly relies on manual phenotypic measurements at the field maturity stage, which has many technical drawbacks: First, the breeding cycle is long, and phenotypic identification can only be carried out when the soybeans are full and mature, making early screening impossible; second, the detection efficiency is low and the labor cost is high, making it difficult to adapt to the screening of large-scale germplasm resources; third, phenotypic traits are easily affected by environmental factors such as temperature, light, water and fertilizer, resulting in poor stability and low accuracy of identification results, which seriously restricts the breeding process of large-pod fresh-eating soybeans.

[0004] KASP (Competitive Allele-Specific PCR) molecular marker technology is a high-throughput genotyping technique based on SNP loci. It boasts advantages such as accurate genotyping, high stability, low cost, and immunity to environmental interference, making it a core technology in marker-assisted breeding of crops. Currently, for the two-pod size trait in fresh soybean, there are still relatively few reported stable associated SNP loci and KASP molecular markers that can be directly used for breeding selection, limiting the application of precise molecular-assisted breeding for this trait. Therefore, identifying key SNP loci for soybean two-pod size, developing dedicated KASP molecular markers, and establishing a standardized breeding application system are crucial to overcoming the current bottlenecks in large-pod soybean breeding technology. Summary of the Invention

[0005] The purpose of this invention is to provide a KASP molecular marker, primers, and their applications related to the size of two soybean pods, in order to solve the above-mentioned technical problems.

[0006] The objective of this invention is achieved through the following technical solution: This invention provides a KASP molecular marker S02_5725405 related to the size of soybean two-pod pods. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The base at position 200 of the nucleotide sequence is an SNP site with a polymorphism of C or T. Soybean two-pod pods with the TT genotype at the SNP site have a longer and wider pod than soybean two-pod pods with the CC and CT genotypes at the same SNP site.

[0007] This invention, for the first time, identified a SNP locus S02_5725405 at 5725405 bp on soybean chromosome 2, which is highly associated with the length and width of two-pod pods, through genome-wide association analysis. The T allele was identified as the superior genotype for large pods. Based on this, a KASP-specific primer set was developed based on the C / T base variation of this SNP. The 5′ ends of the downstream primers were linked to FAM and HEX fluorescent tags, respectively. Precise genotyping of CC and TT genotypes was achieved through fluorescence signal clustering, with a genotyping accuracy of 100%. Germplasm validation showed that the average pod length (8.701 cm) and pod width (2.066 cm) of two-pod soybeans with the TT genotype were significantly greater than those with the CC genotype. This invention opens a pathway for marker-assisted breeding of two-pod size traits, enabling early screening for large-pod varieties and providing an efficient, stable, and low-cost technical tool for the breeding and germplasm improvement of superior large-pod soybean varieties for fresh consumption.

[0008] The present invention also provides specific primers for amplifying the molecular marker, the primers comprising an upstream universal primer as shown in SEQ ID NO.2, and downstream allele-specific primers as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0009] The present invention also provides a kit for detecting the size of two soybean pods, the kit comprising the aforementioned specific primers.

[0010] Furthermore, the kit also includes 2×KASP Master Mix.

[0011] The present invention also provides the application of the molecular marker, the specific primer, or the kit in identifying the size of two soybean pods.

[0012] The present invention also provides the application of the molecular marker, the specific primer or the kit in soybean breeding or assisted soybean breeding, characterized in that the assisted soybean breeding is the cultivation of large-pod soybeans.

[0013] This invention also provides a method for identifying the size of two soybean pods, comprising the following steps: (1) Extract genomic DNA from the soybeans to be tested; (2) Using the extracted DNA as a template, amplification is performed using the specific primers described above to obtain the amplification product; (3) Identify the genotype of the SNP site corresponding to the amplification product, and determine the size of the two pods of the soybean to be tested based on the genotype.

[0014] The present invention also provides a method for identifying the size of two-pod soybeans. The method is as follows: when the SNP site corresponding to the amplification product is the TT genotype, the soybean to be tested is determined to have the trait of two large pods.

[0015] The present invention has the following beneficial effects: This invention, through genome-wide association analysis, detected a SNP locus S02_5725405 on soybean chromosome 2 that is highly significantly associated with the size of two-pod soybeans, clarifying the association between the T allele and the large two-pod phenotype. Based on this SNP locus, a specific KASP molecular marker and primer set were developed, suitable for high-throughput, large-volume germplasm sample detection, and unaffected by environmental conditions, plant type, or growth stage. The SNP locus discovered and the developed KASP molecular marker in this invention can improve the efficiency of improving large-pod fresh-eating soybean varieties, shorten the breeding cycle, and reduce breeding costs. Attached Figure Description

[0016] Figure 1 The frequency distribution histograms of two-pod length and pod width are presented for 390 soybean germplasm resources. In the histogram, A is the two-pod length histogram and B is the two-pod width histogram.

[0017] Figure 2 The graph shows the results of genome-wide association analysis (GWAS) of two-pod length and pod width in soybean germplasm resources. In the graph, A is the Manhattan plot of two-pod length, B is the quantile-quantile plot of two-pod length, C is the Manhattan plot of two-pod width, and D is the quantile-quantile plot of two-pod width.

[0018] Figure 3 The following graphs show the KASP genotyping results at the S02_5725405 locus and the differences in pod length and width between two pods in materials with different genotypes. In the graphs, A is the KASP genotype clustering diagram at the S02_5725405 locus, with blue, red, and black representing the CC genotype, TT genotype, and the NTC (no DNA template) control, respectively; B is a comparison of pod length between two pods in materials with CC and TT genotypes; and C is a comparison of pod width between two pods in materials with CC and TT genotypes. ** indicates extremely significant differences (P<0.01). Detailed Implementation

[0019] The present invention will now be described in detail with reference to specific embodiments, but these should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained commercially unless otherwise specified.

[0020] Example 1: Obtaining SNP sites that are significantly associated with the size of two soybean pods.

[0021] 1. Experimental Methods Thirty-ninety soybean germplasms were selected as experimental materials. A randomized block design was adopted with two replicates. The plants were planted in single-row plots with a row length of 2m, a row spacing of 0.5m, and a plant spacing of 0.15m. Uniform field water and fertilizer management was implemented.

[0022] Table 1: Information on 390 soybean materials GT001 USA GT070 China GT124 China GT169 China GT003 USA GT072 China GT125 China GT170 China GT005 Russia GT073 China GT126 China GT171 China GT007 Russia GT075 China GT127 China GT173 China GT010 China GT079 China GT128 China GT174 China GT013 China GT080 China GT129 China GT176 China GT018 China GT081 China GT130 China GT178 China GT019 China GT082 China GT131 China GT179 China GT020 China GT083 China GT132 China GT180 China GT021 China GT084 China GT133 China GT181 China GT022 China GT085 China GT134 China GT183 China GT027 China GT086 China GT135 China GT184 China GT028 China GT087 China GT136 China GT185 China GT029 China GT089 China GT137 China GT186 China GT032 China GT090 China GT138 China GT187 China GT033 China GT091 China GT139 China GT188 China GT034 China GT092 South Korea GT141 China GT189 China GT036 China GT096 China GT142 China GT190 China GT037 China GT098 China GT143 China GT191 China GT038 China GT099 China GT144 China GT192 China GT040 China GT100 China GT145 China GT193 China GT044 China GT101 China GT146 China GT194 China GT045 China GT103 China GT147 China GT195 China GT046 China GT104 China GT148 China GT196 China GT047 China GT105 China GT149 China GT198 China GT049 China GT106 Japan GT150 China GT199 China GT050 China GT107 China GT152 Japan GT200 China GT051 China GT108 China GT153 China GT202 China GT053 China GT109 South Korea GT154 China GT204 China GT054 China GT110 China GT155 China GT205 China GT055 China GT111 China GT156 China GT206 China GT057 China GT112 China GT157 China GT207 China GT058 China GT113 China GT158 China GT208 China GT059 China GT114 China GT159 China GT209 China GT060 China GT115 China GT160 China GT210 China GT061 China GT116 China GT162 China GT212 China GT062 China GT117 China GT163 China GT213 China GT063 China GT119 China GT164 China GT214 China GT066 China GT120 China GT165 China GT216 China GT067 China GT121 China GT166 China GT217 China GT068 China GT122 Japan GT167 China GT220 China GT069 China GT123 China GT168 China GT224 China GT226 China GT290 China GT346 China HY23-21 China GT227 China GT291 China GT347 China HY23-22 China GT228 China GT294 China GT348 China HY23-24 China GT229 China GT295 China GT349 China HY23-25 China GT230 China GT298 China GT350 China HY23-26 China GT231 China GT302 China GT351 China HY23-28 China GT232 China GT303 China GT352 China HY23-29 China GT233 China GT304 China GT353 China HY23-30 China GT235 China GT305 China GT354 China HY23-31 China GT236 China GT307 China GT355 China HY23-32 China GT238 China GT308 China GT356 China HY23-35 China GT239 China GT309 China GT357 China HY23-37 China GT240 China GT310 China GT358 China HY23-38 China GT242 China GT311 China GT359 China HY23-39 China GT244 China GT312 China GT361 China HY23-41 China GT244-2 China GT313 China GT362 China HY23-43 China GT245 China GT315 China GT363 China HY23-44 China GT247 China GT316 China GT366 China HY23-45 China GT248 China GT317 China GT367 China HY23-47 China GT249 China GT318 China GT369 China HY23-48 China GT250 China GT319 China GT373 China HY23-49 China GT251 China GT320 China GT375 China HY23-50 Japan GT252 China GT321 China GT377 China HY23-52 Japan GT254 China GT322 China GT378 China HY23-53 China GT255 China GT323 China GT381 China HY23-54 Japan GT259 China GT324 China GT382 China HY23-55 Japan GT260 China GT325 China GT383 China HY23-58 Japan GT262 China GT326 China GT384 China HY23-60 Japan GT269 China GT327 China HY23-01 China HY23-70 China GT271 China GT328 China HY23-02 China HY23-71 China GT273 China GT329 China HY23-03 China HY23-72 China GT274 China GT330 China HY23-04 China HY23-73 China GT276 China GT331 China HY23-05 China HY23-74 China GT277 China GT332 China HY23-06 China HY23-75 China GT278 China GT333 China HY23-09 China HY23-76 China GT279 China GT334 China HY23-10 China HY23-77 China GT280 China GT336 China HY23-11 China HY23-78 China GT281 China GT337 China HY23-12 China HY23-79 China GT282 China GT339 China HY23-13 China HY23-80 China GT283 China GT340 China HY23-14 China HY23-81 China GT284 China GT341 China HY23-15 China N01638 China GT285 China GT342 China HY23-16 China N01659 China GT286 China GT343 China HY23-17 China N01671 China GT288 China GT344 China HY23-19 China N01687 China GT289 China GT345 China HY23-20 China N01737 China N01743 China N02030 China N05590 China N06861 China N01755 China N02042 China N05614 China N06931 China N01781 China N02977 China N05672 China N07065 China N01823 China N03018 China N05675 China N07065 China N01830 China N03495 China N05762 China N07081 China N01858 China N03496 China N05845 China N22382 China N01869 China N05546 China N05876 China N22552 China N01928 China N05568 China N06082 China N22688 China N01950 China N05573 China N06103 China N22706 China N01996 China N05588 China N06817 China / / N02003 China N05589 China N06820 China / / Note: / indicates no data.

[0023] During the R6 stage (grain-filling stage) of soybean, 6-8 healthy, disease-free, and morphologically intact two-pod plants were randomly selected from each experimental plot. Samples were collected and pod images were taken. Phenotypic indices were determined using the minimum bounding rectangle method: the pod length was defined as the longer side of the minimum bounding rectangle, and the pod width was defined as the diameter of the smallest inscribed circle in the width direction. The average of two replicates was taken as the final phenotypic data. Genomic DNA was extracted from 390 soybean germplasms, and whole-genome resequencing was performed to obtain whole-genome SNP variation data. Combined with the phenotypic data of two-pod plant length and width, a genome-wide association analysis was conducted using a mixed linear model (MLM) (reference genome Wm82.a2.v1).

[0024] 2. Experimental Results like Figure 1 and 2 As shown in the association analysis, the 5684011–5729550 bp region on soybean chromosome 2 was significantly associated with the length and width of two-pod pods, and a total of 10 linked common significant SNP sites were identified (Table 2). Among them, SNP site S02_5725405 showed the strongest association signal. This site was significantly associated with both the length and width of two-pod pods, and its corresponding −log 10 The (P) values ​​were 7.06 and 9.04, respectively. A C / T single nucleotide polymorphism exists at this site.

[0025] Phenotypic difference analysis showed that among the 390 tested soybean germplasms, 341 CC genotype germplasms had an average pod length of 7.069 cm and an average pod width of 1.701 cm for two-pod varieties; while 49 TT genotype germplasms had an average pod length of 8.557 cm and an average pod width of 2.039 cm for two-pod varieties. The pod length and width of the TT genotype germplasms were significantly greater than those of the CC genotype germplasms, with a significance level of -log10(P) = 11.80 for pod length and 12.68 for pod width. Based on locus significance, phenotypic differences, and sequence characteristics, S02_5725405 was identified as the target associated locus for subsequent KASP marker development. This locus is located at 5725405 bp on chromosome 2 of the soybean reference genome Wm82.a2.v1.

[0026] Table 2: Significant SNP loci associated with soybean chromosome 2 and pod size. Note: The -log10(P) value in the table represents the significance level obtained from the MLM-GWAS analysis; S02_5725405 is the optimal KASP marker development site; / indicates no data.

[0027] The nucleotide sequence of S02_5725405 is shown in SEQ ID NO.1. The 200th position is the mutation site.

[0028] SEQ ID NO.1: AGCAAATTTGGCGGTAACAGATTTTCGTTATCCATGACCTCAATCAATCATTTGTTACTATTTGTTAGCAATCCCTATGAACGCCTAAAATAATTCCAATTAACGAAAAACTAATATACATTTGAGCCTTTGTTTATCTACTATTTTAATATCTCAAAACGTTCAGCACAAAATAATTTAAAAACTATTTTGAATTTG GCATTGACAGACTTTTCATATTACACTTTTATTTATTTATTCAAATGAAGTGCTGCATACGGCTTTTGATGGTCCAAAGAAAGAAATAGACTTTTATGGTAATTGAATATATTATAGTTTGCATAATTTTCTGTGTAACATATGTCACGGTAATGAGTTCTTTTATTTTTAAGAAATAGTGTGTATTAACAGTATAAAACAA.

[0029] Example 2: Primer design.

[0030] Based on the C / T variation characteristics of SNP site S02_5725405 described in Example 1, a KASP-specific primer set was designed and developed. The primers consist of an upstream universal primer and two allele-specific downstream primers. The 5′ ends of the downstream primers are respectively connected to KASP-specific FAM and HEX fluorescent adapter sequences to ensure the specificity and accuracy of genotyping.

[0031] The upstream universal primer F is shown in SEQ ID NO.2.

[0032] SEQ ID NO. 2: GCAATCCCTATGAACGCCTA.

[0033] The downstream allele-specific primer R1 is shown in SEQ ID NO.3.

[0034] SEQ ID NO. 3: GAAGGTGACCAAGTTCATGCTGTGTAATATGAAAAGTCTGTCAATG.

[0035] The downstream allele-specific primer R2 is shown in SEQ ID NO.4.

[0036] SEQ ID NO. 4: GAAGGTCGGAGTCAACGGATTGTGTAATATGAAAAGTCTGTCAATA.

[0037] Among them, in the downstream allele-specific primer R1 sequence, GAAGGTGACCAAGTTCATGCT is a FAM fluorescent adapter sequence; in the downstream allele-specific primer R2 sequence, GAAGGTCGGAGTCAACGGATT is a HEX fluorescent adapter sequence.

[0038] A 10 μL KASP-PCR reaction system was used, comprising: 5 μL 2×KASP Master Mix, 1 μL mixed primers, 1 μL genomic DNA (200 ng), and 3 μL ddH2O. The mixed primer solution was prepared by mixing 100 μM downstream primers R1 and R2, and upstream universal primer F with ddH2O; specifically, 2 μL of downstream primer R1, 2 μL of downstream primer R2, 5 μL of upstream universal primer F, and 151 μL of ddH2O were mixed thoroughly to obtain the mixed primer solution.

[0039] The KASP-PCR amplification program used was as follows: 95℃ pre-denaturation for 15 min, 95℃ denaturation for 20 s, gradient annealing from 61 to 55℃ for 1 min (10 cycles, decreasing by 0.6℃ per cycle); 95℃ denaturation for 20 s, 55℃ annealing for 1 min, for a total of 30 cycles, followed by extension at 37℃ for 1 min. After the reaction, the FAM and HEX fluorescence channel signals were read using a quantitative real-time PCR instrument for genotype cluster analysis.

[0040] Genotyping criteria: Detection of only FAM fluorescence signal indicates CC genotype; detection of only HEX fluorescence signal indicates TT genotype; detection of both fluorescence signals indicates CT heterozygous genotype.

[0041] Example 3: Application of KASP molecular markers in the identification of two-pod size in soybeans.

[0042] Seventy soybean germplasm samples from different sources were randomly selected (Table 3). Using the primer set and detection system described in Example 2, genotyping of the S02_5725405 locus was carried out. At the same time, the phenotypic phenotypes of two-pod length and pod width of each sample were measured to verify the effectiveness of the marker.

[0043] The typing results showed that among the 70 accessions, 37 were of the CC genotype and 33 were of the TT genotype. The marker typing was clear, with no blurred or mixed bands, and no false positives, achieving a typing accuracy of 100%. This demonstrates the high specificity and good stability of the primer set of this invention. (See [link to typing results] for details.) Figure 3 A.

[0044] Phenotypic results showed that the average pod length of the TT genotype was 8.701 cm and the average pod width was 2.066 cm; the average pod length of the CC genotype was 6.612 cm and the average pod width was 1.595 cm. Significance analysis showed that the differences in pod length and pod width were extremely significant (pod length P = 6.8 × 10⁻⁶). -9 Pod width P = 1.2 × 10 -8 ), the result is as follows Figure 3 As shown in B and C. The above results demonstrate that the KASP marker of this invention can accurately distinguish between large-pod and ordinary-pod soybean germplasm, and is suitable for molecular-assisted breeding screening of soybeans.

[0045] Table 3: Genotypic and phenotypic information of 70 soybean germplasms used for validation Small beans CC 5.300 1.237 August explosion CC 6.785 1.789 Green and white cowpeas CC 6.137 1.346 Haimen July White CC 7.636 1.879 purple tea beans CC 7.150 1.641 Verde TT 8.935 2.043 Guanyun Mud Soybeans CC 7.910 1.693 Wujin Fine-Seed Late Black Beans TT 8.678 1.932 Huaiyin Autumn Black Beans CC 5.921 1.355 Qidong Lantern Beans TT 8.089 1.946 Luanchuan Town Xiao Hei CC 5.445 1.258 Binhai 13-9 TT 8.239 2.085 Zongyang Black Beans CC 5.708 1.372 Four corners aligned TT 9.548 2.254 Mountain Yellow CC 5.165 1.298 Shengxian soybeans TT 8.837 2.059 Qingyuan small green beans CC 4.898 1.369 Big Tiger Eye TT 7.812 1.824 Longshan Nei Ziqing CC 4.977 1.289 Brown-skinned soybeans TT 4.450 1.167 Pingshan Black Beans CC 5.978 1.335 Zhexiandou No. 8 TT 9.231 2.153 Tiandeng Duning Black Beans CC 4.735 1.296 Zhejiang 77003 TT 8.224 2.134 Longan Black Beans CC 5.206 1.371 Edamame No. 3 TT 8.895 1.982 Comforting Green Beans CC 6.327 1.386 New Green TT 8.788 2.170 Black beans CC 6.073 1.389 Zhechun No. 4 TT 8.175 1.997 8157 CC 7.782 1.864 Liaoning No. 1 TT 8.737 1.974 Jiujiang June Explosion CC 5.306 1.342 Zhejiang 57001 TT 8.835 2.010 Yang Liuyan Green Skin Beans CC 5.901 1.398 A1049 TT 9.438 2.273 Gongdou 723-2 CC 7.797 1.841 Gongdou 20 TT 7.884 1.856 Binyang Small Green Beans CC 5.768 1.402 Nanjing Agricultural University 95C-13 TT 11.226 2.327 Jianshui Black Beans CC 4.804 1.211 A1058 TT 8.590 1.967 Quqiu No. 5 CC 8.254 1.954 Nanjing Agricultural University 99C-5 TT 8.661 2.093 Big Dugu Bean CC 8.254 2.025 Xiafeng Edamame TT 8.878 2.121 Junshan Green Beans CC 7.356 1.724 Zhejiang Fresh 86 TT 9.786 2.272 Keliyuan No. 8 CC 9.146 2.057 Emerald Pearl TT 9.833 2.279 tangzu CC 10.642 2.745 Suxian 21 TT 10.084 2.379 Big Green Silk CC 7.621 1.858 Nanjing Agricultural University 1445 TT 7.883 1.978 Zhe Nong No. 6 CC 5.614 1.223 Quxian No. 2 TT 9.101 2.305 Zhongke Maodou No. 4 CC 4.562 1.098 Large green-fleshed black beans TT 7.568 1.812 LXX Fork Beans CC 7.239 2.051 ZH633 TT 8.677 2.136 rat eyes CC 5.888 1.405 Shangrao Daqingsi TT 9.297 2.193 Cixi September White CC 7.034 1.678 Quxian No. 1 TT 9.200 2.332 Yuhang September White CC 9.498 2.192 Liping large green-skinned beans TT 6.764 1.795 Kaihua June White CC 6.995 1.736 Huaixian No. 9 TT 10.085 2.327 Hangzhou August CC 7.849 1.920 Danyang August White TT 8.696 2.013 In summary, the SNP locus S02_5725405 screened in this invention and the developed KASP molecular marker can stably and accurately identify the two-pod size trait in soybeans. The TT genotype is an excellent genotype for large-pod soybeans and can be directly applied to marker-assisted breeding of soybeans, providing technical support for the breeding of new large-pod fresh-eating soybean varieties.

[0046] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0047] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0048] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The KASP molecular marker S02_5725405 related to the size of two soybean pods, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The base at position 200 of the nucleotide sequence is an SNP site with a polymorphism of C or T. The pod length and pod width of soybean two-pod genotype with the SNP site being TT are greater than those of soybean two-pod genotypes with the same site being CC or CT.

2. A specific primer for amplifying the molecular marker of claim 1, characterized in that, The primers include upstream universal primers as shown in SEQ ID NO.2, and downstream allele-specific primers as shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A reagent kit for detecting the size of two soybean pods, characterized in that, The kit includes the specific primers as described in claim 3.

4. The reagent kit according to claim 3, characterized in that, The kit also includes 2×KASP MasterMix.

5. The use of the molecular marker of claim 1, the specific primer of claim 2, or the kit of claim 3 in identifying the size of two soybean pods.

6. The application of the molecular marker of claim 1, the specific primer of claim 2, or the kit of claim 3 in soybean breeding or assisted soybean breeding, characterized in that, The assisted soybean breeding refers to the cultivation of large-pod soybeans.

7. A method for determining the size of two soybean pods, characterized in that, Includes the following steps: (1) Extract genomic DNA from the soybeans to be tested; (2) Using the extracted DNA as a template, amplification is performed using the specific primers described in claim 2 to obtain the amplification product; (3) Identify the genotype of the SNP site corresponding to the amplification product, and determine the size of the two pods of the soybean to be tested based on the genotype.

8. The method for identifying the size of two soybean pods according to claim 7, characterized in that, The judgment method is as follows: when the SNP site corresponding to the amplification product is the TT genotype, the soybean to be tested is judged to have the large two-pod trait.

Images