KASP molecular marker primer combination related to soybean root rot resistance and application

Abstract

The application discloses a KASP molecular marker primer combination related to soybean root rot resistance and an application thereof, and belongs to the technical field of molecular marker development and molecular marker assisted breeding of soybean agronomic traits. The KASP molecular marker primer combination related to soybean root rot resistance disclosed by the application has sequences as shown in SEQ ID NO. 3-5. By developing a functional KASP marker for regulating the resistance and susceptibility of soybean root rot, a set of efficient and convenient molecular marker assisted selection system is provided, and accurate typing and early screening of the resistance and susceptibility of soybean root rot can be realized. The marker can quickly identify the genotypes of different soybean root rot resistance and susceptibility materials in a natural population, and by replacing traditional phenotype screening through molecular marker assisted breeding, the cost of field tests can be greatly reduced, and the selection efficiency and accuracy of breeding can be significantly improved.

Description

Technical Field

[0001] This invention relates to the field of molecular marker development for soybean agronomic traits and molecular marker-assisted breeding technology, and more specifically to KASP molecular marker primer combinations and applications related to soybean root rot resistance. Background Technology

[0002] Soybean (Glycine max L.) is one of the world's most important oilseed and protein crops. Soybean root rot is a devastating disease caused by a combination of various soil-borne pathogenic fungi, leading to root decay, plant wilting, and severe reductions in yield and quality. The occurrence of this disease is influenced by multiple factors, including soil environment, climate conditions, and cultivation practices, making its control extremely difficult. Breeding and promoting disease-resistant varieties is the most economical, effective, and environmentally friendly strategy for controlling this disease. However, soybean resistance to root rot is a typical quantitative trait, controlled by multiple genes and significantly influenced by environmental factors, posing a significant challenge to traditional phenotypic selection breeding.

[0003] Traditional breeding relies on identifying disease resistance phenotypes in candidate lines under artificial inoculation conditions. For diseases like root rot, which involve complex root traits and soil-borne pathogen interactions, phenotypic identification faces numerous bottlenecks. Environmental variations, including pathogen community structure, soil temperature and humidity, and microbial flora, lead to unstable and poorly reproducible resistance phenotypic evaluations. Furthermore, identification is costly and time-consuming, requiring standardized inoculation systems, destructive sampling, and precise disease grading, consuming significant manpower, resources, and time. Moreover, resistance expression may differ across growth stages, increasing the complexity of resistance evaluation throughout the entire growth cycle.

[0004] The emergence of marker-assisted selection (MAS) technology has provided an effective way to overcome bottlenecks in disease resistance breeding. By utilizing DNA molecular markers closely associated with soybean root rot resistance, breeders can rapidly and accurately screen for disease-resistant genotypes in seedlings, without relying on disease phenotypic identification at the adult stage. This significantly shortens the breeding cycle and greatly improves the efficiency and accuracy of selecting disease-resistant materials. Over the past few decades, researchers have identified a series of quantitative trait loci (QTLs) related to root rot resistance in the soybean genome using various genetic mapping methods such as linkage analysis and association analysis, laying a solid theoretical foundation for the practical application of MAS in this resistance breeding.

[0005] Soybean root rot is a major limiting factor in soybean production, and elucidating its resistance genetic mechanism is of significant theoretical value and practical guiding significance for breeding resistant soybean varieties. Sang et al. (2023) detected eight SNP loci significantly associated with resistance to Fusarium oxysporum root rot in a natural soybean population in Northeast China using GWAS analysis on 280 soybean germplasm resources. They converted two closely linked, high-effect SNPs, ss715595462 and ss715595463, located on chromosome 6, into KASP markers, which were then used to identify candidate genes associated with the SNPs. Glyma.06G088400 This gene encodes a disease-resistance protein rich in leucine repeats, which participates in the soybean immune response to Fusarium. Zhang et al. (2024) developed a series of KASP markers targeting the Rps gene in soybean Fusarium root rot, including specific markers based on resistance genes such as Rps1k and Rps1a. These markers can accurately distinguish between resistant and susceptible varieties and are suitable for large-scale germplasm resource screening and early identification of breeding materials. Soybean root rot resistance is not only a key breeding target but also an important entry point for research on resistance genetics and molecular mechanisms. In the future, by integrating multi-omics analysis and gene editing technologies, a deeper understanding of its resistance genetic basis will be obtained, providing important scientific support for disease-resistant molecular design breeding and the cultivation of highly resistant varieties.

[0006] Therefore, providing KASP molecular marker primer combinations related to soybean root rot resistance and their application is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0007] In view of this, the present invention provides a combination of KASP molecular marker primers related to soybean root rot resistance and their application.

[0008] The molecular markers obtained in this invention are molecular markers that are significantly associated with soybean root rot resistance and can be used for screening soybean materials with root rot resistance and their offspring in assisted selection breeding.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] A KASP molecular marker primer combo for identifying resistance to soybean root rot, the primer combo sequence is as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTATCAGGAGTGTAGAAGGTCTCCCTA-3'; SEQ ID NO. 3.

[0011] Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTTCAGGAGTGTAGAAGGTCTCCCTG-3'; SEQ ID NO. 4.

[0012] Reverse primer R: 5'-GAGAAGGCAAATCTTGTTGCTTATGGT-3'; SEQ ID NO. 5.

[0013] Furthermore, the KASP molecular marker primer combination was developed from the KASP molecular marker located at 41530653 bp on chromosome 15 of soybean genome Wm82.a4.v1; the KASP molecular marker genotype is A or G.

[0014] Furthermore, when the KASP molecular marker genotype is A, the sequence of the first and last 50 bp is shown in SEQ ID NO.1, and the corresponding phenotype is soybean root rot susceptible genotype; when the KASP molecular marker genotype is G, the sequence of the first and last 50 bp is shown in SEQ ID NO.2, and the corresponding phenotype is soybean root rot resistant genotype.

[0015] GGATAGTCAGTATAACCCACAACTGGATCAGGAGTGTAGAAGGTCTCCCT A TTGTACTTGTTGAGTGGTGCATCAACCTCAAACCTCTTAGGCAAATCTGG; SEQ ID NO.1.

[0016] GGATAGTCAGTATAACCCACAACTGGATCAGGAGTGTAGAAGGTCTCCCT G TTGTACTTGTTGAGTGGTGCATCAACCTCAAACCTCTTAGGCAAATCTGG; SEQ ID NO. 2.

[0017] KASP molecular markers that are significantly associated with soybean root rot resistance can be used for molecular-assisted selection breeding of soybean materials or their progeny with root rot resistance.

[0018] A kit for identifying resistance to soybean root rot, comprising the aforementioned KASP molecular marker primer combination.

[0019] Specifically, the application of the KASP molecular marker primer combination or the kit in identifying or assisting in the identification of soybean root rot resistance traits.

[0020] The above molecular markers can be used to carry out molecular-assisted selection breeding for soybean root rot resistance traits: The KASP molecular marker, designed and developed, is significantly associated with soybean root rot resistance. This marker can be used for preliminary screening of soybean root rot-resistant varieties, thus accelerating the breeding process through marker-assisted breeding. In production, this molecular marker can also be used to detect root rot resistance during the seedling stage, screening for plants with root rot resistance. This allows for the continuous development of new varieties that are both disease-resistant and high-yielding, forming a long-term disease-resistant breeding system.

[0021] A method for identifying resistance and susceptibility traits to soybean root rot includes the following steps: (1) Extract genomic DNA from soybean samples to be tested; use the KASP molecular marker primer combination to perform PCR amplification of soybean sample genomic DNA on an ABI Stepone PCR instrument; use an ABI Stepone PCR instrument to detect fluorescence signals and analyze genotyping; (2) Judgment based on genotype results: When the genotype result of the sample is consistent with the genotype GG of the root rot resistant soybean material, the soybean sample being identified exhibits root rot resistance; when the genotype result of the sample is consistent with the genotype AA of the root rot susceptible material, the soybean sample being identified exhibits root rot susceptibility.

[0022] As can be seen from the above technical solution, compared with the prior art, this invention discloses a combination of KASP molecular marker primers related to soybean root rot resistance and their application. Based on the obtained KASP markers of soybean genes regulating root rot resistance and susceptibility traits, a novel and simple molecular marker and marker-assisted selection method is provided, suitable for rapid screening of soybean root rot resistance and susceptibility traits and marker-assisted breeding. This molecular marker can detect the genotype of root rot resistance and susceptibility traits in natural populations and can also be used for molecular-assisted selection breeding of soybean materials with root rot resistance and susceptibility traits, replacing large-scale phenotypic screening, reducing field workload, and greatly improving the accuracy and efficiency of screening. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0024] Figure 1 The molecular marker gene typing diagram and phenotypic association verification results are shown for some of the natural population materials of soybean root rot resistance in this invention; allele 1 represents FAM, indicating genotype AA; allele 2 represents HEX, indicating genotype GG; yellow indicates negative control with no signal. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] Example 1: Development of KASP molecular markers for resistance to soybean root rot This study first constructed a natural variation population consisting of 320 soybean germplasm resources. Genome sequencing was performed on all materials to mine genetic variations within the population and locate target SNP sites with sequence polymorphisms. Subsequently, Fusarium oxysporum (… Fusarium oxysporum ATCC 16064 was used as the test strain. Sorghum grains were used as the culture medium for propagation (the sorghum grains were soaked, boiled, dried, sterilized, and inoculated with pre-cultured mycelium cakes on PDA, then cultured at 26 ℃ in the dark for 14 days until the mycelium was fully grown). At inoculation, inoculated sorghum grains were evenly mixed into culture pots containing vermiculite at a weight ratio of 4%, with 5 soybean seeds sown in each pot. The pots were then cultured at 25 ℃ under 12-hour light-dark cycles, with an uninoculated control as the standard, and three replicates were performed. Fourteen days after inoculation, the disease severity was assessed according to a 0-7 standard, and the disease index was calculated (disease index % = [∑(number of diseased plants at each level × relative level value) / (total number of plants investigated × 7)] × 100). Disease indices ≤30 were classified as resistant, and >30 as susceptible. Based on this, the resistance and susceptibility of all germplasm were determined. Association analysis verified that SNP sites with significant correlations between sequence variations and soybean root rot resistance and susceptibility were identified. Data processing and statistical analysis were completed using Excel 2019.

[0027] The SNP marker is located at 41530653 bp on soybean chromosome 15. The molecular marker is an SNP mutation marker, classified into A and G genotypes. The 50 bp sequences before and after the molecular marker site are as follows: GGATAGTCAGTATAACCCACAACTGGATCAGGAGTGTAGAAGGTCTCCCT A TTGTACTTGTTGAGTGGTGCATCAACCTCAAACCTCTTAGGCAAATCTGG; SEQ ID NO.1.

[0028] or GGATAGTCAGTATAACCCACAACTGGATCAGGAGTGTAGAAGGTCTCCCT GTTGTACTTGTTGAGTGGTGCATCAACCTCAAACCTCTTAGGCAAATCTGG; SEQ ID NO. 2.

[0029] By screening molecular markers, the KASP molecular marker, which is significantly associated with resistance to soybean root rot, was finally obtained. The primer combination sequence for this molecular marker is as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCT ATCAGGAGTGTAGAAGGTCTCCCTA -3';SEQ ID NO.3.

[0030] Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATT TCAGGAGTGTAGAAGGTCTCCCTG -3';SEQ ID NO.4.

[0031] Reverse primer R: 5'-GAGAAGGCAAATCTTGTTGCTTATGGT-3'; SEQ ID NO. 5.

[0032] The resistance and susceptibility traits to root rot in natural soybean populations were measured, as follows: (1) DNA extraction Genomic DNA was extracted from natural soybean populations using the CTAB method.

[0033] (2) PCR amplification The PCR reaction system consisted of: 5.0 μl of 30-50 ng / μl soybean genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (the three primers, F-HEX, F-FAM, and R, were each dissolved in sterile water to prepare stock solutions with a concentration of 10 ng / μl; then mixed according to a molar ratio of F-HEX:F-FAM:R = 2:2:5 to obtain a primer mixture; 0.14 μl of this mixture was used for the PCR reaction), for a total volume of 10.14 μl. (Note: Each of the three primers was prepared as a 10 ng / μl stock solution. Because the three primers have different lengths, their molar concentrations differ even at the same mass concentration, so they need to be mixed in different volumes).

[0034] The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 31-35 cycles. 30℃, 1 minute (read fluorescence signal).

[0035] PCR amplification was performed on the ABI Step One PCR instrument, and the genotyping information could be obtained directly after the instrument detected the fluorescence signal.

[0036] The forward primers F-HEX and F-FAM each have their own fluorescent adapters (displayed as different colors on the genotyping map, e.g., red for AA genotype, blue for GG genotype, and yellow for the negative control with no fluorescent signal). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference indicates whether the tested material is homozygous AA or GG genotype. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus distinguishing heterozygous genotypes. When the genotyping result of the sample is AG, the soybean sample being tested is heterozygous, and its phenotype needs further verification using other methods or self-pollination purification before final determination.

[0037] Table 1 shows the identification results of root rot resistance and molecular markers in 320 natural soybean germplasm materials.

[0038] Table 1 Genotyping and root rot resistance / susceptibility data of natural populations

[0039] Table 2

[0040] Figure 1 (Where blue represents the GG genotype resistant to root rot; red represents the AA genotype susceptible to root rot; and yellow represents the negative control with no fluorescent signal.) Table 2 shows the genotyping results of 38 materials (part of the materials in Table 1), and the results are as follows: Based on theoretical predictions, soybeans with the GG genotype should be resistant to root rot, while soybeans with the AA genotype should be susceptible to root rot. The theoretical results are consistent with the experimentally measured results of root rot resistance and susceptibility. Molecular markers can detect different genotypes of root rot resistance and susceptibility in natural populations, further clarifying that these molecular markers can be used for molecular-assisted selection breeding of soybean materials with root rot resistance and susceptibility.

[0041] like Figure 1 Analysis of the data in Table 1 shows that the resistance to root rot in homozygous GG soybeans is significantly higher than that in soybeans with the AA genotype. Therefore, the molecular markers used in this invention are mainly used for the initial screening of soybean varieties with resistance to root rot, in order to achieve the purpose of marker-assisted breeding.

[0042] Example 2: Validation of KASP molecular markers for resistance to soybean root rot Following the genotyping procedure in Example 1, the genotyping of soybean germplasm was completed, and the relevant genotyping data are shown in Table 3.

[0043] Table 3

[0044] Based on theoretical predictions, soybeans with the GG genotype should be disease-resistant, while soybeans with the AA genotype should be disease-susceptible. The theoretical results largely align with the actual results. Molecular markers can detect different genotypes in natural populations, further clarifying that these molecular markers can be used for molecular-assisted selection breeding of different soybean materials resistant and susceptible to root rot.

[0045] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer set of KASP molecular markers associated with soybean root rot resistance, characterized in that, The primer combination sequence is as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTATCAGGAGTGTAGAAGGTCTCCCTA-3'; SEQ ID NO.3; Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTTCAGGAGTGTAGAAGGTCTCCCTG-3'; SEQ ID NO.4; Reverse primer R: 5'-GAGAAGGCAAATCTTGTTGCTTATGGT-3'; SEQ ID NO.

5.

2. The KASP molecular marker primer combination for soybean root rot resistance according to claim 1, characterized in that, The KASP molecular marker primer combination was developed from the KASP molecular marker located at 41530653 bp on chromosome 15 of soybean genome Wm82.a4.v1; the KASP molecular marker genotype is A or G.

3. The KASP molecular marker primer combination for soybean root rot resistance according to claim 2, characterized in that, When the KASP molecular marker genotype is A, the sequence of the first and last 50 bp is shown in SEQ ID NO.1, and the corresponding phenotype is soybean root rot susceptible genotype; when the KASP molecular marker genotype is G, the sequence of the first and last 50 bp is shown in SEQ ID NO.2, and the corresponding phenotype is soybean root rot resistant genotype.

4. A kit for identifying resistance and susceptibility traits to soybean root rot, characterized in that, Contains the KASP molecular marker primer combination as described in any one of claims 1-3.

5. The use of the KASP molecular marker primer combination according to any one of claims 1-3 or the kit according to claim 4 in identifying or assisting in the identification of soybean root rot resistance traits.

6. A method for identifying resistance and susceptibility traits to soybean root rot, characterized in that, Includes the following steps: (1) Extract genomic DNA from soybean samples to be tested; perform PCR amplification of soybean sample genomic DNA using the KASP molecular marker primer combination described in any one of claims 1-3 on a PCR instrument; detect fluorescence signal using a PCR instrument and analyze genotyping; (2) Judgment based on genotype results: When the genotype result of the sample is consistent with the genotype GG of the root rot resistant soybean material, the soybean sample being identified exhibits root rot resistance; when the genotype result of the sample is consistent with the genotype AA of the root rot susceptible soybean material, the soybean sample being identified exhibits root rot susceptibility.

Images