SNP molecular marker for identifying salvia reflexa and application thereof

Abstract

The application discloses a SNP molecular marker for identifying Salvia przewalskii and application thereof. The SNP molecular marker is located on a chloroplast genome of the Salvia przewalskii and comprises a SNP molecular marker 1 and a SNP molecular marker 2. The SNP molecular marker 1 contains two SNP sites, namely SNP-01 and SNP-02, and the SNP molecular marker 2 contains one SNP site, namely SNP-03. The SNP molecular marker and a primer pair thereof can be developed into a specific detection kit and are widely applied to the fields of quality control of garden greening seedlings, identification of germplasm resource library, identification of medicinal plant cultivation raw materials and molecular assisted breeding.

Description

Technical Field

[0001] This invention relates to the field of plant molecular marker technology, specifically to an SNP molecular marker for identifying *Salvia splendens* and its application. Background Technology

[0002] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by variations in a single nucleotide at the genomic level, including single base transitions, transversions, insertions, or deletions. SNPs are the most abundant form of genetic variation in plant genomes, possessing advantages such as wide distribution, high genetic stability, and ease of automated detection. They have become important molecular markers for plant variety identification, genetic diversity analysis, and molecular breeding.

[0003] Shady Sage ( Salvia nemorosa Sage (Salvia arborescens) is an important landscaping and medicinal plant belonging to the genus Sage (Lamiaceae family). Due to the large number of species in the genus Sage, many closely related species are highly morphologically similar. Traditional morphological identification methods suffer from strong subjectivity and are greatly influenced by environmental factors, making accurate and rapid variety identification difficult. This is especially true in the seedling stage, where shade sage and clary sage (Salvia arborescens) are particularly similar. S. sclarea ), European sage ( S. officinalis ), a string of red ( S. splendens Mexican sage ( S. leucantha Closely related species such as (e.g., those that are difficult to distinguish morphologically) can easily lead to confusion of varieties, affecting the effect of landscaping and the quality of medicinal plant cultivation.

[0004] Chloroplast genomes, characterized by maternal inheritance, high copy number, moderate evolutionary rate, and sequence conservation, are ideal materials for developing SNP markers for interspecific plant identification. Molecular identification techniques based on chloroplast genome SNP markers can directly reflect genetic differences between varieties at the DNA level. These techniques offer advantages such as accuracy, speed, and independence from environmental factors, providing a reliable technical means for the identification of *Salvia splendens* varieties and the protection of its germplasm resources.

[0005] Currently, research on specific SNP molecular markers for *Salvia splendens* is still in its infancy, lacking a rapid and accurate SNP marker system to distinguish *Salvia splendens* from other *Salvia* varieties. Therefore, developing specific SNP molecular markers for *Salvia splendens* and establishing SNP-based molecular identification methods are of great significance for protecting *Salvia splendens* germplasm resources, preventing variety confusion, and guiding production and application. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a SNP molecular marker for identifying *Salvia splendens* and its application. The three SNP loci of this invention are located at specific sites in the chloroplast genome of *Salvia splendens*. Based on direct detection of the DNA sequence, the identification results are accurate and reliable, unaffected by growth stage, tissue type, or environmental factors.

[0007] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides an SNP molecular marker for identifying *Salvia sylvatica*, wherein the SNP molecular marker is located on the chloroplast genome of *Salvia sylvatica*, and includes SNP molecular marker 1 and SNP molecular marker 2; The SNP molecular marker 1 contains two SNP sites, SNP-01 and SNP-02. SNP site SNP-01 is located at position 284 of the chloroplast genome of *Salvia sylvatica*, with alleles A / T; SNP site SNP-02 is located at position 285 of the chloroplast genome of *Salvia sylvatica*, with alleles A / T. The SNP molecular marker 2 contains an SNP site SNP-03, which is located at position 2637 of the chloroplast genome of *Salvia miltiorrhiza*, and its allele is T / C.

[0008] This invention also provides an application of the aforementioned SNP molecular marker in the identification of shade sage varieties, germplasm resource protection, or molecular-assisted breeding.

[0009] The present invention also provides a primer pair for obtaining the aforementioned SNP molecular marker, wherein the nucleotide sequence of the primer pair for obtaining SNP molecular marker 1 is as follows: SNP-1F:GATCTTCTTTCTTTATTCTCTAATGG; SNP-1R: TGGCTAAGACTTGTTTTTAGTGTG; The nucleotide sequences of the primer pairs for obtaining SNP molecular marker 2 are as follows: SNP-3F: AATTGGTTTATCGAAATCCTTTTTGGATG; SNP-3R: AGAACGTCTTATGAACGTCTTTGTTAAGG.

[0010] Furthermore, the nucleotide sequence of the SNP molecular marker 1 is shown in SEQ ID NO: 1, and the SNP site SNP-01 is located at the 95th base of the sequence, and the SNP site SNP-02 is located at the 96th base of the sequence. The nucleotide sequence of the SNP molecular marker 2 is shown in SEQ ID NO: 2, and the SNP site SNP-03 is located at the 89th base of the sequence.

[0011] This invention also provides a method for detecting SNP molecular markers of *Salvia splendens*, wherein the method uses the primer pair described above for amplification and sequencing comparison to complete the detection.

[0012] This invention also provides the application of the primer pair described above in the identification of shade sage varieties, germplasm resource protection, or molecular-assisted breeding.

[0013] The present invention also provides a kit for identifying *Salvia splendens*, the kit comprising the primer pair described above.

[0014] The present invention also provides a method for identifying *Salvia splendens* using the aforementioned kit, comprising the following steps: Detect SNP molecular markers on the chloroplast genome of Sage species to identify shade sage, and determine whether the Sage species to be tested is shade sage based on the base information of the SNP sites. When the base of SNP-01 is T, the base of SNP-02 is A, and the base of SNP-03 is T, the plant to be tested is *Salvia spp.*

[0015] Furthermore, the detection method includes the following steps: (1) Extract genomic DNA from the *Salvia* species to be tested; (2) Use the primer pairs in the kit to perform PCR amplification of genomic DNA; (3) Sequencing analysis of the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, the base information of the SNP sites is obtained.

[0016] The present invention also provides an application of the kit described herein in the identification of shade sage varieties, germplasm resource conservation, or molecular-assisted breeding.

[0017] The beneficial effects of this invention are: This invention successfully screened and obtained SNP molecular markers for identifying *Salvia miltiorrhiza*, and developed allele-specific PCR primers and detection methods based on these SNP molecular markers. This invention utilizes SNP sites unique to the chloroplast genome of *Salvia miltiorrhiza* to effectively distinguish it from other *Salvia* varieties, offering the following advantages: (1) High accuracy: Based on DNA sequence SNP markers, it is not affected by environmental factors, and the identification results are accurate and reliable; (2) High specificity: Allele-specific PCR primers are effective only for amplifying specific alleles of Sage in the shade, with high specificity; (3) Easy to operate: PCR detection technology is mature, the equipment is simple, and it is easy to promote and apply; (4) Fast and efficient: It only takes 3 to 4 hours from DNA extraction to result interpretation, which can realize high-throughput detection; (5) Early identification: Molecular identification can be carried out during the seedling stage, shortening the breeding cycle. Attached Figure Description

[0018] Figure 1 Figure showing the results of chloroplast genome sequence alignment; Figure 2 Electrophoresis diagram of primer pair SNP-1F / R amplification; In the diagram, M represents the DNA marker, and lanes 1-5 are respectively lined with sage (Salvia splendens). S. nemorosa Clary sage ( S. sclarea ), European sage ( S. officinalis ), a string of red ( S. splendens Mexican sage ( S. leucantha ); Figure 3 Electrophoresis diagram of primer pair SNP-3F / R amplification; In the diagram, M represents the DNA marker, and lanes 1-5 are respectively lined with sage (Salvia splendens). S. nemorosa Clary sage (S. sclarea), European sage ( S. officinalis ), a string of red ( S. splendens Mexican sage ( S. leucantha ); Figure 4 A comparison of the SNP-1F / R amplification and sequencing results of primer pairs for five species of Sage. In the picture, Sn is sage, Ssc is clary sage, So is European sage, Ssp is scarlet sage, and Sl is Mexican sage. Figure 5 A comparison of the SNP-3F / R amplification and sequencing results of primer pairs for five species of Sage. In the picture, Sn is sage, Ssc is clary sage, So is European sage, Ssp is scarlet sage, and Sl is Mexican sage. Figure 6 This is a comparison diagram of the SNP-1F / R amplification and sequencing results of primer pairs for unknown Sage species. Figure 7 This is a comparison diagram of the SNP-3F / R amplification and sequencing results of primer pairs for an unknown species of the genus *Salvia*. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0020] The chloroplast genome of *Salvia splendens* in this invention is the chloroplast genome of *Salvia splendens* in the invention patent application number 2026110620573.

[0021] Example 1 Screening of SNP molecular markers in *Salvia miltiorrhiza* Based on the chloroplast genome sequence of *Salvia sylvestris* (151,316 bp), and through comparison with *Clerodendrum cherubim* (…), Salvia sclarea NCBI login number is NC_050900.1), Sage ( Salvia officinalis NCBI login number is MN520021), a string of red flowers ( Salvia splendens NCBI accession number NC_050901.1), Mexican sage ( Salvia leucantha Alignment analysis of the chloroplast genome sequence (NCBI accession number MT156367.1) identified 123 SNP sites. After polymorphism analysis, specificity verification, and stability testing, the results are as follows: Figure 1 As shown in Table 1, the following three highly specific SNP sites were selected.

[0022] Table 1. Information on SNP-specific sites of *Salvia splendens* In this embodiment, three SNP loci were screened. SNP-01 is located at position 284 of the overall genome sequence of *Salvia miltiorrhiza* chloroplasts (i.e., position 284 in xl-1 of invention patent application number 2026110620573), with an allele of A / T, where *Salvia miltiorrhiza* has a T base and other *Salvia* species have an A base. SNP-02 is located at position 285 of the overall genome sequence of *Salvia miltiorrhiza* chloroplasts (i.e., position 284 in xl-1 of invention patent application number 202611). The 285th base in xl-1 of the invention patent application number 0620573 has an allele of A / T, with *Salvia splendens* having an A base and other *Salvia* species having a T base; the SNP site SNP-03 is located at position 2637 of the overall chloroplast genome sequence of *Salvia splendens* (i.e., the 2637th base in xl-1 of the invention patent application number 2026110620573), with an allele of T / C, with *Salvia splendens* having a T base and other *Salvia* species having a C base.

[0023] Example 2 Functional Verification of SNP Molecular Markers and Identification of Sage in the Shade of the Forest 1. Design primers based on the location information of the SNP sites screened in Example 1: (1) The primers for amplifying sequences containing SNP sites SNP-01 and SNP-02 are SNP-1F and SNP-1R; SNP-1F:GATCTTCTTTCTTTATTCTCTAATGG (SEQ ID NO: 3); SNP-1R: TGGCTAAGACTTGTTTTTAGTGTG (SEQ ID NO: 4); (2) The primers for amplifying the sequence containing the SNP site SNP-03 are SNP-3F and SNP-3R; SNP-3F: AATTGGTTTATCGAAATCCTTTTTGGATG (SEQ ID NO: 5); SNP-3R: AGAACGTCTTATGAACGTCTTTGTTAAGG (SEQ ID NO: 6); 2. Genomic DNA was extracted from five common and easily confused species of the *Salvia* genus: *Salvia shadiola*, *Salvia claryii*, *Salvia variegata*, *Salvia splendens*, and *Salvia meliflora*. Fresh leaves of these plants were flash-frozen in liquid nitrogen, and genomic DNA was extracted from the plant samples according to the instructions of the Takara Plant DNA Extraction Kit.

[0024] 3. Using the above plant sample genomic DNA as a template, and the above primer pairs, perform allele PCR amplification with Takara rTaq enzyme according to the reaction components in Table 2 and the reaction procedure in Table 3 to obtain PCR amplification products.

[0025] Table 2 PCR reaction components Table 3 PCR reaction procedure 4. Configure a 1.0% agarose gel for electrophoresis to detect the PCR amplification products. The results are as follows: Figure 2 and Figure 3 As shown in the figure. The PCR amplified bands were excised from the gel, recovered, ligated into the T vector, and then sequenced.

[0026] The results are as follows Figure 4 and Figure 5As shown, in *Salvia splendens*, the base at SNP-01 is T, the base at SNP-02 is A, and the base at SNP-03 is T. However, in *Clary Salvia splendens*, *Salvia gramineus*, *Salvia splendens*, and *Salvia gracilis*, the base at SNP-01 is always A, the base at SNP-02 is always T, and the base at SNP-03 is always C. Therefore, the three SNP sites of this invention can be used to identify *Salvia splendens*.

[0027] Example 3 Obtaining SNP molecular markers for identifying *Salvia miltiorrhiza* Using the chloroplast genome of *Salvia splendens* as a template, PCR amplification was performed on it using primer pairs SNP-1F / R and SNP-3F / R from Example 2.

[0028] The gene sequence snpxl-1 containing SNP sites SNP-01 and SNP-02 was obtained. Its nucleotide sequence is shown in SEQ ID NO: 1. The degenerate base W is A / T, and SNP-01 is located at the 95th base of the sequence snpxl-1 with an allele of A / T. SNP-02 is located at the 96th base of the sequence snpxl-1 with an allele of A / T. The gene sequence snpxl-2 containing the SNP site SNP-03 was obtained. Its nucleotide sequence is shown in SEQ ID NO: 2. The degenerate base Y is C / T, and SNP-03 is located at the 89th base of the sequence snpxl-2. The allele is C / T.

[0029] Example 4 Kits for identifying shady sage The kit in this embodiment contains the primer pairs SNP-1F / R and SNP-3F / R from Example 2.

[0030] Example 5 Methods for identifying shady sage The SNP molecular markers on the chloroplast genome of plants in the genus *Salvia* that identify *Salvia shadiola* were detected. Based on the base information of the SNP sites, it was determined whether the *Salvia* species to be detected was *Salvia shadiola*.

[0031] When the base of SNP-01 is T, the base of SNP-02 is A, and the base of SNP-03 is T, the plant to be tested is *Salvia spp.*

[0032] The detection method includes the following steps: 1. Extract genomic DNA from the *Salvia* species to be tested; 2. Genomic DNA was amplified by PCR using the primer pairs SNP-1F / R and SNP-3F / R from the kit in Example 4. The reaction components and reaction procedures are shown in Tables 2 and 3.

[0033] 3. Sequencing analysis of the PCR amplification products to obtain sequencing results; 4. Based on the sequencing results, the base information of the SNP sites is obtained.

[0034] Example 6 Identification of unknown species of the genus *Salvia* In this embodiment, eight Sage seedlings were randomly selected and numbered S.sp-1 to S.sp-8. Genomic DNA was extracted from S.sp-1 to S.sp-8, and the genomic DNA was detected using the method in Example 5.

[0035] The results are as follows Figure 6 and Figure 7 The amplified fragments were sequenced. In samples S.sp-2 and S.sp-8, the base at SNP-01 was T, the base at SNP-02 was A, and the base at SNP-03 was T. However, in samples S.sp-1 and S.sp-3 through S.sp-7, the base at SNP-01 was always A, the base at SNP-02 was always T, and the base at SNP-03 was always C. Therefore, samples S.sp-2 and S.sp-8 are *Salvia splendens*.

[0036] Plant cultivar identification was performed on samples S.sp-1 to S.sp-8, and the results showed that samples S.sp-2 and S.sp-8 were *Salvia splendens*, which is consistent with the above results.

[0037] This invention successfully screened and obtained SNP molecular markers for identifying *Salvia miltiorrhiza*, and developed specific primer pairs and kits based on these SNP markers. This invention utilizes SNP sites unique to the chloroplast genome of *Salvia miltiorrhiza* to effectively distinguish it from other *Salvia* varieties, providing a reliable molecular tool for the protection of *Salvia miltiorrhiza* germplasm resources, variety identification, and landscaping applications. The method of this invention is simple, rapid, and accurate, allowing for early identification at the seedling stage, reducing breeding workload, and ensuring the correctness of seedling varieties.

[0038] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker for identifying *Salvia splendens*, characterized in that: The SNP molecular markers are located on the chloroplast genome of *Salvia sylvatica*, including SNP molecular marker 1 and SNP molecular marker 2; The SNP molecular marker 1 contains two SNP sites, SNP-01 and SNP-02. SNP site SNP-01 is located at position 284 of the chloroplast genome of *Salvia sylvatica*, with alleles A / T; SNP site SNP-02 is located at position 285 of the chloroplast genome of *Salvia sylvatica*, with alleles A / T. The SNP molecular marker 2 contains an SNP site SNP-03, which is located at position 2637 of the chloroplast genome of *Salvia miltiorrhiza*, and its allele is T / C.

2. The application of the SNP molecular marker as described in claim 1 in the identification of tree sage varieties, germplasm resource protection, or molecular-assisted breeding.

3. A primer pair for obtaining the SNP molecular marker of claim 1, characterized in that: The nucleotide sequences of the primer pairs for obtaining SNP molecular marker 1 are as follows: SNP-1F:GATCTTCTTTCTTTATTCTCTAATGG; SNP-1R: TGGCTAAGACTTGTTTTTAGTGTG; The nucleotide sequences of the primer pairs for obtaining SNP molecular marker 2 are as follows: SNP-3F: AATTGGTTTATCGAAATCCTTTTTGGATG; SNP-3R: AGAACGTCTTATGAACGTCTTTGTTAAGG.

4. The primer pair according to claim 3, characterized in that: The nucleotide sequence of the SNP molecular marker 1 is shown in SEQ ID NO: 1, and the SNP site SNP-01 is located at the 95th base of the sequence, and the SNP site SNP-02 is located at the 96th base of the sequence. The nucleotide sequence of the SNP molecular marker 2 is shown in SEQ ID NO: 2, and the SNP site SNP-03 is located at the 89th base of the sequence.

5. A method for detecting SNP molecular markers in *Salvia splendens*, characterized in that: The method uses the primer pair described in claim 3 for amplification, and sequencing comparison is used to complete the detection.

6. The application of the primer pair according to claim 3 in the identification of sage varieties, germplasm resource conservation or molecular-assisted breeding.

7. A kit for identifying *Salvia splendens*, characterized in that: The kit includes the primer pair as described in claim 3.

8. A method for identifying *Salvia splendens* using the kit described in claim 7, characterized in that: Includes the following steps: Detect SNP molecular markers on the chloroplast genome of Sage species to identify shade sage, and determine whether the Sage species to be tested is shade sage based on the base information of the SNP sites. When the base of SNP-01 is T, the base of SNP-02 is A, and the base of SNP-03 is T, the plant to be tested is *Salvia spp.* 9. The method according to claim 8, characterized in that: The detection method includes the following steps: (1) Extract genomic DNA from the *Salvia* species to be tested; (2) Use the primer pairs in the kit to perform PCR amplification of genomic DNA; (3) Sequencing analysis of the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, the base information of the SNP sites is obtained.

10. The application of the kit according to claim 7 in the identification of shade sage varieties, germplasm resource protection or molecular-assisted breeding.

Images