InDel molecular markers related to pure color and variegation traits of pansy petal and application

Abstract

The application belongs to the technical field of plant molecular biology, and particularly discloses an InDel molecular marker related to the petal pure color and petal mottling traits of a pansy and application thereof. The InDel molecular marker is closely linked to the petal pure color or petal mottling traits of the pansy. The InDel molecular marker can be used to quickly, accurately and efficiently distinguish petal pure color resources and petal mottling resources at the seedling stage of the pansy, and can be used for assisted breeding to shorten the screening period of high-quality pansies, reduce the breeding workload, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and in particular to the InDel molecular markers and their applications related to the pure color and mottled traits of pansy petals. Background Technology

[0002] pansy( Viola × wittrockiana Pansies, also known as butterfly flowers or cat-faced flowers, are perennial herbaceous ornamental flowers belonging to the genus Viola in the family Violaceae. They are characterized by rich flower colors, varied flower shapes, long flowering periods, and strong adaptability, making them a core flower variety for flower beds, borders, potted plants, and landscaping worldwide. They possess both high horticultural and economic value. Petal characteristics are the core indicator determining the ornamental quality and commercial grade of pansies, with solid-color petals and variegated petals being the two most representative phenotypic types. The variegated petal pattern of pansies originated in the early 18th century, developed by the British horticulturist William Thompson through... V. tricolor , V. lutea , V. altacia Interspecific hybridization was conducted to select new horticultural hybrids with large colored spots (i.e., "cat face") on the lower part of the petals. V. × wittrockiana It is highly favored by consumers; while the pure color V. × wittrockiana The varieties originated in the early 20th century, first bred by Charles Stewart of Scotland; the solid-color pansy has uniform and elegant flowers, suitable for formal garden landscaping; the variegated pansy has petals with distinctive spots and stripes, making it unique, more ornamental, and with a higher market premium. The precise breeding of these two varieties is the core research direction for the cultivation of new pansy varieties, trait improvement, and targeted breeding.

[0003] Existing research indicates that the spotted and solid-color traits of pansies are typical quality traits. Scholars have preliminarily identified key genes in the anthocyanin synthesis pathway and MYB family transcription factors involved in the formation of petal spots. Differential expression of key pigment synthesis genes between spotted and non-spotted areas is a crucial molecular basis for petal trait differentiation. However, the core functional variation sites that can stably distinguish between solid-color and spotted traits have not yet been located. Currently, the breeding of solid-color and spotted pansies still relies primarily on traditional phenotypic selection, depending on direct observation of petal phenotypes during peak flowering. This requires a full life cycle from sowing and seedling raising to mature plants and flowering, resulting in long breeding cycles and high costs in terms of manpower and resources. Furthermore, due to the complex genetic background of solid-color and spotted traits, traditional hybridization breeding struggles to achieve targeted homozygous selection of traits. Even after multiple generations of selection, trait segregation is still common, leading to extremely low breeding efficiency. This severely restricts the large-scale and standardized cultivation of high-quality solid-color and uniquely spotted pansies.

[0004] Molecular marker-assisted breeding can overcome environmental and growth period limitations, enabling precise identification of target trait genotypes at the seedling stage, significantly improving breeding efficiency and accuracy. It has become a core technology for targeted selection of flower traits. InDel (insertion / deletion) molecular markers are functional molecular markers developed based on genomic fragment insertion and deletion variations. They have advantages such as wide genomic distribution, high polymorphism, stable typing, rapid detection, low cost, and high specificity. Moreover, the variation sites are mostly directly related to gene functional differences, making them more suitable for genotype identification and assisted selection of crop target traits. At present, the development of specific InDel molecular markers for the solid color and spotted traits of pansies is still lacking both domestically and internationally. There are no stable and accurate functional InDel markers that can distinguish between the solid color and spotted genotypes of pansies, making it impossible to achieve molecular-assisted screening of these two core traits at the seedling stage. This results in a lack of efficient and accurate molecular technology support for targeted breeding of pansies with spotted and solid color traits, greatly limiting the breeding iteration efficiency and variety improvement accuracy of high-quality new pansies. Therefore, developing an InDel molecular marker closely linked to the pure color and mottled traits of pansy petals, and establishing a corresponding rapid detection and breeding application system, is of great theoretical research value and practical application significance for breaking through traditional breeding bottlenecks, achieving precise and targeted breeding of pansy target traits, shortening the breeding cycle, and cultivating high-quality and distinctive new pansy varieties. Summary of the Invention

[0005] To address the aforementioned technical challenges, this invention provides an InDel molecular marker associated with the solid color and mottled phenotype of pansy petals. This marker is characterized by the presence of either AATTTTCCATGTATTTTACCTTGTT or A polymorphism at position 47 of the nucleotide sequence shown in SEQ ID NO.1. When the genotype at the InDel site is AATTTTCCATGTATTTTACCTTGTT, or AATTTTCCATGTATTTTACCTTGTT, the phenotype is mottled petals; when the genotype at the InDel site is AATTTTCCATGTATTTTACCTTGTT, or A, the phenotype is solid-colored petals.

[0006] SEQ ID NO.1: TCGAGGCGAGCATCGTTTAAGTGTGGGGATTTCTGATTGAAGCGTAATTTCCATGTATTTTACCTTGTTATTTCCATGATTTACTAGGTAAAGTACAAGATATTTCATCATTTCCCTACATTTTTGTAGGTTTGTCCTGACGAAGCATATTCGGTCAAAGTTGACCACGCAGGGAGGCAAGGTTGACGGAAGAGCGGAG; Furthermore, the present invention provides primers for amplifying the InDel molecular marker.

[0007] Preferably, the primers are those shown in SEQ ID NO.2 and SEQ ID NO.3.

[0008] SEQ ID NO.2 (upstream primer F, 5' to 3' direction): TCGAGGGCGAGCATCGTTTA; SEQ ID NO.3 (downstream primer R, 5' to 3' orientation): CTCCGCTCTTCCGTCAACCT.

[0009] Furthermore, the present invention provides the application of the InDel molecular marker and the primer in at least one of the following aspects: (1) Identify the pure color and mottled characteristics of pansy petals; (2) Marker-assisted breeding of pansy petal solid color and mottled trait; (3) Develop DNA molecular markers to identify the spotted and spotless solid color traits of pansies.

[0010] Furthermore, the present invention provides a method for identifying solid-color and spotted petals of pansies, comprising: detecting the genotype of the InDel molecular marker; when the genotype of the InDel locus is AATTTTCCATGTATTTTACCTTGTT, AATTTTCCATGTATTTTACCTTGTT, the phenotype is spotted; when the genotype of the InDel locus is AATTTTCCATGTATTTTACCTTGTT, A, the phenotype is solid-color petals.

[0011] Preferably, using the genomic DNA of the pansy to be tested as a template, PCR amplification is performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the PCR amplification product.

[0012] Preferably, the PCR amplification products are 200 bp and 177 bp in size.

[0013] Preferably, the PCR amplification product is subjected to agarose gel electrophoresis, and the pansy to be tested is determined to be either a solid color petal or a spotted pattern based on the electrophoresis results; The judgment method is as follows: If the PCR product contains only a 200 bp main band, the pansy to be tested is a variegated variety; if the PCR product contains two main bands, 200 bp and 177 bp, the pansy to be tested is a solid-colored variety.

[0014] Preferably, the PCR amplification reaction program includes: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 15 s, 35 cycles; 72℃ final extension for 10 min.

[0015] Preferably, the PCR amplification reaction system comprises: 5 μL of DNA template solution, 17.5 μL of 2×Taq Mix, 1 μL each of forward and reverse primers at a concentration of 10 μM / L, and 10.5 μL of ddH2O to bring the total volume to 35 μL.

[0016] Preferably, the agarose gel electrophoresis uses a 2.5% agarose gel.

[0017] The beneficial effects achieved by this invention are: This invention provides an InDel molecular marker related to the solid color and variegation traits of pansy petals. This molecular marker is closely linked to both the solid color and variegation traits of pansy petals. Using this molecular marker, the solid color and variegation traits of pansy petals can be identified at an early stage. It can quickly, accurately, and efficiently identify pansy resources with solid color and variegation of petals during the seedling stage. When used to assist breeding, it can shorten the screening cycle for high-quality pansies and reduce the workload of breeding, and has broad application prospects. Attached Figure Description

[0018] Figure 1 Genetic mapping of the InDel locus (Chr11:47989217_AATTTCCATGTATTTTACCTTGTT / A); Figure 2 For resources of pure-colored pansies and spotted pansies VwWRKY7 The sequence alignment results of the InDel site (Chr11:47989217_AATTTCCATGTATTTTACCTTGTT / A) on the gene promoter region; Figure 3 Electrophoresis images of InDel molecular marker PCR amplification of 7 pansy inbred lines; Figure 4 Electrophoresis images of 24 F2 generation individuals obtained by InDel molecular marker detection; Figure 5 Electrophoresis images of 24 F2 generation individuals obtained by InDel molecular marker detection. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. In the embodiments provided in this specification, if no specific technology or conditions are specified, the technology or conditions described in the literature in this field shall be followed, or the product instructions shall be followed; if the manufacturers of the reagents or instruments used are not specified, they are all conventional products that can be purchased through legitimate channels. This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book "Molecular Cloning" (by J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art can complete the corresponding experiments under the guidance of the operation manuals accompanying various commercial reagent kits or entrust them to specialized companies.

[0020] Using the F2 population constructed by crossing the variegated inbred line DSRFY and the pure-colored inbred line EYO of pansies as experimental material, BSA mapping data were analyzed to examine the variegation traits of pansies. The results showed... VwWRKY7 Genes are highly associated with the formation of the flower spot trait in pansies, therefore... VwWRKY7 Identified as a candidate gene associated with the solid color / spotted trait of pansy petals; in VwWRKY7 A single InDel site (Chr11:47989217_AATTTCCATGTATTTTACCTTGTT / A) was identified in the promoter region of the gene that was significantly associated with the solid color and variegated traits of pansy petals. Figure 1 Using Clustal software, the nucleotide sequences of pansies in solid-color and spotted petals were compared. The results showed that the InDel site in the spotted petal resource was AATTTTCCATGTATTTTTACCTTGTT, while the InDel site in the solid-color petal resource was a deletion mutation of ATTTCCATGTATTTTTACCTTGTT. Figure 2 ).

[0021] 1. Pansy materials tested: Leaves of 7 pansy breeding materials were collected from the pansy experimental field of Henan University of Science and Technology, including 3 solid-colored petal resources and 4 variegated petal resources (Table 1); Leaves of 48 hybrid offspring were collected from the F2 population constructed by hybridization of pansy inbred lines DSRFY and EYO as parents, including 23 solid-colored petal individuals and 25 variegated petal individuals; Table 1 Information on 7 Pansy Resources 2. Verification of InDel molecular marker polymorphism and its association with petal solid color and petal mottled traits. (1) Extract DNA from pansy samples: Genomic DNA was extracted from 55 pansy leaves using the CTAB method. (2) Using the above DNA as a template, PCR amplification was performed using the specific primer pair shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification product; SEQ ID NO.2, F: 5'-TCGAGGGCGAGCATCGTTTA-3'; SEQ ID NO.3, R: 5'-CTCCGCTCTTCCGTCAACCT-3'; The 35 μL PCR amplification reaction system includes: 5 μL DNA template solution, 17.5 μL 2×Taq Mix, 1 μL each of forward and reverse primers at a concentration of 10 μM / L, and 10.5 μL ddH2O; PCR amplification reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 15 s, 35 cycles; 72℃ final extension for 10 min. (3) The PCR amplification products were detected by 2.5% agarose gel electrophoresis, and the electrophoretic banding was observed on a gel imaging instrument to analyze the experimental results; 3. Results Analysis Figure 3 These are electrophoresis images of seven pansy resources obtained in this embodiment using InDel molecular markers. Figure 4 The images shown are electrophoretic images obtained by InDel molecular marker detection from 24 F2 generation individuals in this embodiment (1, 2, 4, 6, 8, 10, 12, 13, 16, 17, 18, 21, and 22 are individuals with solid-colored petals, and 3, 5, 7, 9, 11, 14, 15, 19, 20, 23, and 24 are individuals with mottled petals). Figure 5The images shown are electrophoretic images obtained by InDel molecular marker detection from 24 F2 generation individuals in this embodiment (25, 26, 28, 30, 33, 36, 38, 44, 47, and 48 are individuals with solid-colored petals, and 27, 29, 31, 32, 34, 35, 37, 39, 40, 41, 42, 43, 45, and 46 are individuals with mottled petals). The PCR product consists of one main band with a length of 200 bp, corresponding to the pansy resource showing mottled petals; the PCR product includes two main bands with lengths of 200 bp and 177 bp, respectively, corresponding to the pansy resource showing solid-colored petals. This demonstrates that the InDel molecular marker exhibits good polymorphism, and the banding pattern corresponds exceptionally well with the pure color and variegated characteristics of pansy petals, achieving an accuracy rate of 100%. This indicates that the InDel molecular marker developed using the aforementioned InDel molecular marker can effectively identify pansy resources with pure petal color and variegated petal color, demonstrating high accuracy and enabling early and rapid identification of pansy flower color.

[0022] The above specific embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

Claims

1. The application of InDel molecular markers related to the pure color and speckled morphology of pansy petals, characterized in that, The InDel molecular marker, as shown in SEQ ID NO.1, exhibits an AATTTTCCATGTATTTTACCTTGTT or A polymorphism at position 47; when the genotype at this site is AATTTTCCATGTATTTTACCTTGTT, A, the phenotype is pure-colored petals; while when the genotype at this site is AATTTTCCATGTATTTTACCTTGTT, AATTTTCCATGTATTTTACCTTGTT, the phenotype is petals with spots in the center; the application includes at least one of the following aspects: (1) Identify the solid color or mottled characteristics of pansy petals; (2) Marker-assisted breeding of pansies with solid color or mottled petal traits; (3) Develop molecular markers to identify the solid color or mottled characteristics of pansy petals.

2. A method for identifying the pure color and spots of pansy petals, characterized in that: include: The genotype of the InDel molecular marker described in claim 1 is detected. When the genotype of the InDel locus is AATTTTCCATGTATTTTACCTTGTT, A, the phenotype is pure-colored petals; when the genotype of the locus is AATTTTCCATGTATTTTACCTTGTT, AATTTTCCATGTATTTTACCTTGTT, the phenotype is petals with spots in the center.

3. The method according to claim 2, characterized in that, Using the genomic DNA of the pansy to be tested as a template, PCR amplification was performed using the primers shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the PCR amplification product.

4. The method according to claim 3, characterized in that, The PCR amplification products were subjected to agarose gel electrophoresis. Based on the electrophoresis results, the pansy materials to be tested were determined to be either solid-color petals or speckled petals. The determination method is as follows: if the PCR product contains only a 200 bp main band, the pansy to be tested is a solid-color petal resource; if the PCR product contains two main bands, 200 bp and 177 bp, the pansy to be tested is a speckled petal resource.

5. The method according to claim 3 or 4, characterized in that, The PCR amplification reaction program includes: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 15 s, 35 cycles; 72℃ final extension for 10 min.

6. The method according to claim 3 or 4, characterized in that, The PCR amplification reaction system includes: 5 μL DNA template solution, 17.5 μL 2×Taq Mix, 1 μL each of forward and reverse primers at a concentration of 10 μM / L, and 10.5 μL ddH2O to bring the total volume to 35 μL.

7. The method according to claim 4, characterized in that, The agarose gel electrophoresis was performed using 2.5% agarose gel.

Images