KASP molecular markers linked to a wheat stripe rust resistance site, detection method and breeding application thereof

Abstract

The present application belongs to the technical field of plant disease resistance identification and molecular marker assisted breeding, and discloses a group of KASP molecular markers linked to a wheat stripe rust resistance site, a detection method and breeding application thereof. The present application takes the 4DS chromosome stripe rust resistance site QYrPI660122.swust-4DS of wheat strain PI660122 as a target, develops the KASP molecular markers Kasp119375, Kasp397582 and Kasp703074 and corresponding primer combinations which can be stably typed, establishes a matched amplification detection and genotype interpretation method, finely locates the target site to a 0.42Mb physical interval of the 4DS chromosome, and completes expression verification of a preferred candidate gene. The present application can rapidly identify the target resistance allele of the wheat to be tested at the seedling stage, is suitable for molecular assisted breeding of the stripe rust resistant wheat, and improves the accuracy and efficiency of breeding selection.

Description

Technical Field

[0001] This invention belongs to the field of plant disease resistance identification and molecular marker-assisted breeding technology, and relates to a set of KASP molecular markers linked to wheat stripe rust resistance loci, detection methods, and their breeding applications. Background Technology

[0002] Wheat stripe rust, caused by the wheat-specific strain of *Striga styracifolium*, is an airborne fungal disease that seriously affects wheat yield stability and quality safety. The physiological races of stripe rust exhibit frequent and rapid virulence variations, making it highly susceptible to loss of resistance due to reliance on single resistance genes or a limited number of resistant germplasm. Therefore, continuously exploring novel resistance resources, accurately locating resistance loci, and developing molecular markers suitable for large-scale breeding screening are key technological directions in wheat stripe rust resistance breeding.

[0003] Currently, the screening of wheat stripe rust resistant materials mainly relies on phenotypic identification methods such as artificial inoculation in greenhouses or natural induction in the field. Although this method can reflect the disease resistance performance of materials under specific inoculum and environmental conditions, the identification results are easily affected by external conditions such as field temperature and humidity, spore inoculation uniformity, survey period, and field race composition, resulting in insufficient identification stability. When targeting early generation large-scale breeding materials, phenotypic traits alone cannot distinguish the resistance effects brought about by different genetic backgrounds, making it difficult to accurately screen individual plants carrying specific exogenous disease resistance loci. The overall screening cycle is long and requires a large amount of manpower.

[0004] Competitive allele-specific PCR genotyping, also known as KASP, offers advantages such as closed-tube detection, high throughput, and no need for gel electrophoresis. It has been gradually applied to wheat SNP genotyping and disease resistance gene detection in breeding, and is more suitable for simultaneous detection of large batches of breeding materials compared to traditional molecular markers. The wheat germplasm PI660122 exhibits stable stripe rust resistance. Existing research has identified the major resistance locus QYrPI660122.swust-4DS on the short arm of chromosome 4D. However, this locus has only been roughly mapped, with a corresponding physical interval spanning 7.85 Mb. This large interval means that the flanking markers are genetically distant from the target resistance locus. Direct use of this locus for marker-assisted selection can lead to a disconnect between genotype and resistance phenotype due to chromosomal recombination events, posing a high risk of misjudgment during screening.

[0005] Existing publicly available information only discloses the coarse localization region and marker name of this disease resistance locus, without providing standardized KASP primer sequences for stable genotyping, a complete and supporting amplification reaction system, and fluorescence clustering interpretation specifications. Furthermore, it lacks verification of pathogen-induced expression of candidate disease resistance genes within the localization region. Those skilled in the art cannot fully reproduce the locus detection process based on existing information, making it difficult to apply this disease resistance locus to early-generation screening in large-scale breeding. In addition, some breeding populations contain recipient parents with inherent stripe rust resistance backgrounds. Phenotypic identification alone cannot distinguish whether the resistance trait originates from QYrPI660122.swust-4DS or the recipient's own background disease resistance genes, significantly increasing the difficulty of targeted selection for homozygous disease-resistant superior lines. Summary of the Invention

[0006] The technical problem this invention aims to solve is that traditional wheat stripe rust breeding and screening relies on field or greenhouse phenotypic identification. The identification results are easily affected by external conditions such as temperature, humidity, pathogen races, and inoculation uniformity. In early-generation large populations, it is impossible to distinguish the resistance effects brought about by different genetic backgrounds, resulting in long screening cycles and insufficient accuracy. The 4DS chromosome stripe rust resistance locus QYrPI660122.swust-4DS carried by wheat germplasm PI660122 has only completed coarse mapping, with a corresponding physical interval spanning 7.85 Mb. The flanking markers are genetically far from the target locus, and chromosomal recombination during breeding and screening can easily cause a mismatch between genotype and disease-resistant phenotype, posing a high risk of misjudgment. Existing publicly available information only records the coarse mapping interval of this locus, without disclosing standardized KASP primer sequences for stable genotyping, a complete amplification reaction system, and fluorescence clustering interpretation criteria. Those skilled in the art cannot fully reproduce the locus detection process, making it difficult to directly use for large-scale breeding and screening. Meanwhile, some recipient parents in the breeding population possess stripe rust resistance, and relying solely on the disease phenotype cannot distinguish whether the resistance trait originates from the target locus or the recipient's background resistance gene, which is not conducive to the targeted selection of homozygous resistant strains. Furthermore, the large number of candidate genes within the coarse localization interval, coupled with a lack of pathogen-induced expression verification of the resistance gene at that locus, makes subsequent gene function analysis difficult. This invention aims to overcome these shortcomings by providing a complete and stable target resistance locus detection technology system. This system narrows the localization interval of the resistance locus, is equipped with a standardized high-throughput genotyping process, and enables accurate identification of wheat materials carrying the target resistance allele at the seedling stage. Simultaneously, it identifies the core resistance candidate gene at that locus, reduces the probability of misjudgment in breeding screening, and improves the efficiency of targeted breeding of stripe rust-resistant wheat.

[0007] To address the aforementioned technical problems, this invention uses PI660122 as the disease-resistant donor material, and constructs recombinant inbred lines, F2 segregating populations, and F3 transgenic populations using multiple susceptible wheat materials. Combining stripe rust resistance identification at the seedling and adult stages, initial localization using 15K SNP chips, and screening for polymorphic SNPs within specific regions using parental exon capture sequencing, KASP marker development, population validation, and multi-environment linkage analysis are completed, forming a complete technical system adapted to QYrPI660122.swust-4DS. This invention provides the following detailed technical solutions:

[0008] In a first aspect, the present invention provides a set of KASP molecular markers linked to the wheat stripe rust resistance site QYrPI660122.swust-4DS, wherein the KASP molecular markers include: Kasp119375, Kasp397582, and Kasp703074; The Kasp119375 is located at chromosome 2,119,375 bp on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome; The Kasp397582 is located at chromosome 4,397,582 bp on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome; The Kasp703074 is located at chromosome 7,703,074 bp on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome.

[0009] Secondly, the present invention provides a primer set for amplifying the above-mentioned KASP molecular marker, wherein the primer set includes at least one of primer set A, primer set B, and primer set C: The primer set A is a primer set used to amplify Kasp119375, consisting of an allele I-specific forward primer as shown in SEQ ID NO:1, an allele II-specific forward primer as shown in SEQ ID NO:2, and a universal reverse primer as shown in SEQ ID NO:3. The primer set B is a primer set used to amplify the Kasp397582 site, consisting of an allele I-specific forward primer as shown in SEQ ID NO:4, an allele II-specific forward primer as shown in SEQ ID NO:5, and a universal reverse primer as shown in SEQ ID NO:6. The primer set C is a primer set used to amplify Kap703074, consisting of an allele I-specific forward primer as shown in SEQ ID NO:7, an allele II-specific forward primer as shown in SEQ ID NO:8, and a universal reverse primer as shown in SEQ ID NO:9.

[0010] Furthermore, in each primer set, the 5′ end of the allele I-specific forward primer is ligated with the FAM universal adapter sequence, and the 5′ end of the allele II-specific forward primer is ligated with the HEX universal adapter sequence. The FAM universal connector sequence is shown in SEQ ID NO:10; The HEX universal connector sequence is shown in SEQ ID NO:11.

[0011] Thirdly, the present invention provides a method for detecting whether wheat materials carry the QYrPI660122.swust-4DS resistance allele, comprising the following steps: S1. Extract genomic DNA from the wheat material to be tested; S2. Using at least one of the primer sets mentioned above, perform a KASP amplification reaction using the genomic DNA to be tested as a template; S3. After the amplification reaction is complete, collect the FAM fluorescence signal and the HEX fluorescence signal; S4. Perform cluster analysis on the fluorescence signals and determine the genotype of the wheat material to be tested based on the clustering results.

[0012] Furthermore, in the above method, the specific criteria for genotype determination are as follows: Each batch of tests was simultaneously set up with a positive control, a negative control, and a template-free control. The test was considered valid when the template-free control was in the fluorescent background area. If the test sample and the positive control cluster into the same fluorescent cluster, it is determined to be a homozygous type of the resistance allele QYrPI660122.swust-4DS; If the test sample and the negative control cluster together in the same fluorescent cluster, it is determined to be a non-QYrPI660122.swust-4DS resistance allele homozygous type; If the sample to be tested forms an intermediate fluorescent cluster between the two fluorescent clusters mentioned above, it is determined to be a heterozygous type of the resistance allele QYrPI660122.swust-4DS.

[0013] Furthermore, the SNP base variations of Kasp119375, Kasp397582, and Kasp703074 at the corresponding sites on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome are G / T, A / G, and A / G, respectively; when the KASP primers are designed with opposite strands, the differential bases at the 3′ end of the allele-specific primers at the above sites are A / C, T / C, and T / C, respectively.

[0014] It should be noted that G:G, T:T and G:T in the embodiments of the present invention are genotype names of KASP fluorescent clusters, which respectively represent the homozygous type of the target resistance allele, the homozygous type of the non-target allele, and the heterozygous type. The fluorescent cluster names do not represent the actual bases.

[0015] Fourthly, the present invention claims protection for a kit for detecting the wheat QYrPI660122.swust-4DS resistance allele, the kit comprising the aforementioned primer set, KASP fluorescent PCR reaction mixture, positive control DNA, negative control DNA, and nuclease-free water.

[0016] Fifthly, the present invention seeks protection for the application of the aforementioned KASP molecular marker in wheat-assisted breeding.

[0017] Sixthly, this invention claims protection for a KASP molecular marker-assisted breeding method for stripe rust-resistant wheat: the method described above for detecting whether wheat materials carry the QYrPI660122.swust-4DS resistance allele is used to perform genotyping on the wheat materials to be tested, materials carrying the target resistance allele are screened, and offspring are selected by combining field disease resistance and agronomic traits.

[0018] Furthermore, in the above-mentioned assisted breeding method, the wheat breeding materials to be tested include segregating populations, transitional populations, and germplasm resources, and genotyping is performed during the seedling stage.

[0019] Compared with the prior art, the present invention has the following significant advantages: This invention, through multi-population linkage analysis and the development of encrypted markers, narrowed the physical location interval of the wheat stripe rust resistance locus QYrPI660122.swust-4DS from approximately 7.85 Mb to approximately 0.42 Mb, simultaneously reducing the genetic distance and significantly decreasing the probability of chromosomal recombination between the marker and the target resistance locus. This effectively reduces misselection and missed selection during breeding, improving the accuracy of marker-assisted selection. The developed KASP molecular marker possesses well-defined primer nucleotide sequences, a standardized amplification reaction system, and genotype interpretation rules, enabling stable genotyping in wheat materials with different genetic backgrounds. Those skilled in the art can directly apply it to detection practices without additional marker development or reaction condition optimization. Furthermore, KASP detection employs a closed-tube fluorescence reading method, eliminating the need for gel electrophoresis, making it suitable for high-throughput batch sample detection and meeting the rapid screening needs of large breeding populations.

[0020] Based on the detection method of this invention, the identification of target resistance alleles can be completed at the wheat seedling stage, without relying on field disease conditions and phenotypic surveys at the adult stage. This effectively shortens the screening cycle for disease-resistant materials and reduces the interference of environmental factors, pathogen race composition, and survey period on the selection results. For the transfer population of recipient parents carrying disease-resistant background, this set of markers can accurately identify the target resistance alleles from PI660122, distinguish the resistance contributed by the target locus from the resistance contributed by the background gene, realize the targeted transfer and precise tracking of disease-resistant loci, and, combined with field screening of disease-resistant phenotypes and agronomic traits, efficiently breed wheat lines with both stable stripe rust resistance and excellent agronomic traits.

[0021] Furthermore, this invention screened multiple NBS-LRR-type disease resistance-related candidate genes within a finely localized region, and identified priority candidate genes through stripe rust-induced expression verification. This clarified the range of candidate genes at the target site and the response characteristics of the pathogen, providing precise research targets for subsequent cloning, functional verification, and analysis of disease resistance molecular mechanisms. It also laid the foundation for further development of functional molecular markers. Attached Figure Description

[0022] Figure 1 This is a frequency distribution diagram of stripe rust resistance phenotypes in the F6-53 F2 segregating population of AvS / ZM9023 / PI660122. Figure A shows the frequency distribution of stripe rust infection types, with the horizontal axis representing the infection type level and the vertical axis representing the number of F2 plants at the corresponding infection type level. Figure B shows the frequency distribution of stripe rust disease severity, with the horizontal axis representing the percentage range of disease severity and the vertical axis representing the number of F2 plants at the corresponding severity range. The phenotypic positions of the resistant parent PI660122 and the susceptible parent AvS are marked in the figures.

[0023] Figure 2 This figure shows the fine genetic map and LOD value curve of QYrPI660122.swust-4DS constructed based on 15K SNP and KASP markers. The figure marks the genetic arrangement of multiple SNP and KASP markers within the target chromosomal segment, and the vertical axis represents the LOD value, used to present the linkage analysis peak and localization interval of the target stripe rust resistance locus.

[0024] Figure 3 This is a fine-mapping physical map of QYrPI660122.swust-4DS. The map shows the physical coordinates of multiple markers on the wheat 4DS chromosome, clarifies the fine-mapping interval defined by AX-111093894 and Kasp119375, and marks the location and gene number of NBS-LRR disease resistance candidate genes within this interval. Detailed Implementation

[0025] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] Unless otherwise specified, the experimental and detection methods in the following embodiments are conventional methods; the reagents and materials mentioned are commercially available unless otherwise specified; and the index data are measured using conventional methods unless otherwise specified.

[0027] The experimental materials involved in this invention are: PI660122, Avocet S (abbreviated as AvS), Zhengmai 9023 (abbreviated as ZM9023), Mianmai 902 (abbreviated as MM902), Yangmai 33 (abbreviated as YM33), Yannong 1212 (abbreviated as YN1212), PI660122 is produced by Avocet The Mexican spring wheat material obtained by crossing S with PI610755 was preserved and used by our research group as the disease-resistant donor QYrPI660122.swust-4DS; abbreviated as AvS, it is an Australian spring wheat variety used as a stripe rust susceptible control; ZM9023 is a wheat variety bred by the Wheat Research Institute of Henan Academy of Agricultural Sciences, used as recipient or non-target allele material; MM902 was bred by Mianyang Academy of Agricultural Sciences, used as a parent with excellent agronomic background; YM33 was bred by Jiangsu Academy of Agricultural Sciences, used as a parent with high-quality strong gluten wheat background; YN1212 was bred by Yantai Academy of Agricultural Sciences, Shandong Province, used as a parent with high-yield winter wheat background; stripe rust physiological races CYR32 and CYR34 were provided by the Wheat Research Institute of Southwest University of Science and Technology. For ease of description, AvS, ZM9023, MM902, YM33, and YN1212 will be used as abbreviated names for the corresponding materials in the following text for population names and marker typing results.

[0028] Example 1: Development and assisted selection of KASP molecular markers for the stripe rust resistance gene QYrPI660122.swust-4DS.

[0029] 1. Experimental materials and genetic population construction 1.1 Basic Experimental Materials: The disease-resistant donor material was the wheat variety PI660122; the susceptible control and non-target allele materials included Avocet S (AvS) and Zhengmai 9023 (ZM9023); ZM9023 / PI660122 F6-53 was a disease-resistant derivative single-gene line carrying QYrPI660122.swust-4DS, obtained from the offspring of the cross between ZM9023 and PI660122, which could be used as a KASP genotyping positive control and a disease-resistant locus transfer donor. Mianmai 902 (MM902), Yangmai 33 (YM33), and Yannong 1212 (YN1212) served as excellent agronomical background parents for the transfer population. The uses and key descriptions of each material are detailed in Table 1.

[0030] Table 1: Experimental Materials and Population Information

[0031] 1.2 Locating and Validation Population Construction: In this embodiment, three types of genetic populations were constructed, as follows: The first type was the Zhengmai 9023 / PI660122 F6 recombinant inbred line population, consisting of 239 families, used for QTL mapping of agronomic traits, disease resistance phenotype analysis, and 15K SNP / KASP co-mapping; the second type was the AvS / ZM9023 / PI660122 F6-53 F2 segregating population, consisting of 160 individual plants, used for validation of resistance and susceptibility segregation of target disease resistance loci and KASP marker linkage analysis; the third type was two F3 conversion populations, MM902 / YM33 / ZM9023 / PI660122 F6-53 and MM902 / YN1212 / ZM9023 / PI660122 F6-53, used for validation of KASP marker-assisted selection breeding applications.

[0032] 1.3 F2 segregating population construction: The susceptible material AvS was crossed with ZM9023 / PI660122F6-53 carrying the target locus. During hybridization, ears of the female parent that had not yet naturally flowered after heading, with normal stigma development and unshed pollen, were artificially emasculated. Immediately after emasculation, the ears were bagged and isolated, and tagged with the combination name, female parent number, male parent number, and emasculation date. One to two days after emasculation, when the stigma was pollinating, fresh pollen was collected from the male parent for pollination. After pollination, the ears were bagged again, and F1 seeds were harvested per ear upon maturity. The authenticity of F1 plants could be verified by phenotypic differences or molecular markers between parents after sowing. Confirmed genuine F1 plants were self-pollinated, and F2 seeds were harvested per plant upon maturity, forming the AvS / ZM9023 / PI660122 F6-53 F2 segregating population. Each F2 plant was independently numbered, and DNA was extracted from each plant, with simultaneous field stripe rust resistance identification.

[0033] 1.4 Construction of the Transgenic Population: Mianmai 902, Yangmai 33, and Yannong 1212 were used as superior agronomical background parents, and ZM9023 / PI660122 F6-53 was used as the donor parent carrying the target disease resistance locus. First, a composite recipient background of MM902 / YM33 or MM902 / YN1212 was constructed, then crossed with ZM9023 / PI660122 F6-53, and self-pollinated to form the F3 transgenic population. Each combination was individually numbered during sowing, hybridization, harvesting, and storage to avoid mixing. To ensure accurate offspring origin, the authenticity of F1 or transgenic offspring could be confirmed using KASP markers or distinguishable molecular markers between parents. If the tested plant contained specific allelic signals from both the target donor and recipient backgrounds, it was determined to be a true hybrid offspring; if it only showed a recipient self-pollination type or lacked donor-specific signals, it was discarded.

[0034] 2. Identification of stripe rust races and disease resistance 2.1 Test pathogens: The physiological races of stripe rust fungus CYR32 and CYR34 were used, both provided by the Wheat Research Institute of Southwest University of Science and Technology. These races are representative and have a broad toxicity spectrum, and can be used to evaluate the disease resistance effect of the resistance site derived from PI660122 under the current major toxicity background.

[0035] 2.2 Seedling Resistance Identification: Seedling resistance identification was conducted in a controlled greenhouse. Approximately 30 plump seeds were taken from each sample and sown in 9cm×9cm×9cm plastic pots, with about 10 seeds per pot. When the seedlings reached the one-leaf-one-heart stage, they were inoculated with CYR32 and CYR34, respectively. Before inoculation, the waxy layer on the leaf surface was gently rubbed with a moistened finger, cotton swab, or equivalent method to facilitate the adhesion of stripe rust spores. Then, fresh, activated stripe rust spores were evenly applied to the upper surface of the leaves. After inoculation, the plants were kept moist and cultured at 8℃ in the dark for 20-30 hours, preferably 24 hours, to promote spore germination. Subsequently, they were transferred to a greenhouse at 13-17℃ with 16 hours of light / 8 hours of darkness. 14-18 days after inoculation, when the susceptible control AvS showed full disease development, the infection type (IT) was recorded according to the 0-9 infection type standard, where 0-1 was immune or near-immune, 1-3 was highly resistant, 4-6 was moderately resistant, and 7-9 was susceptible.

[0036] 2.3 Field identification at the mature plant stage: Field identification at the mature plant stage was conducted under naturally induced or artificially induced stripe rust conditions; one row of susceptible control AvS was planted every 20 rows, and induction plants could be set up around the field to improve the uniformity of disease incidence; after AvS fully developed disease, surveys were conducted weekly for a total of 3 times; Infectivity Indication (IT) was recorded on a scale of 0 to 9, and Disease Severity (DS) was recorded visually on a scale of 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 and 100%, with the highest IT and final DS used to evaluate resistance.

[0037] 2.4 Identification Results: AvS and Zhengmai 9023 showed susceptibility to the disease at both the seedling and mature stages, while PI660122 and ZM9023 / PI660122 F6-53 showed high resistance at both stages. In the AvS / ZM9023 / PI660122 F6-53 F2 population (out of 160 individual plants), 129 plants showed resistance and 31 plants showed susceptibility, with a 3:1 segregation ratio, indicating that the resistance was mainly controlled by a single dominant locus. The phenotypic distribution of this population corresponds to... Figure 1 The figure contains two subplots, A and B: Subplot A is a frequency distribution of stripe rust infection type in the F2 population, with the horizontal axis representing the infection type level and the vertical axis representing the number of F2 plants at the corresponding level. The phenotypic positions of the resistant parent PI660122 and the susceptible parent AvS are marked in the figure. Subplot B is a frequency distribution of disease severity in the F2 population, with the horizontal axis representing the disease severity range and the vertical axis representing the number of F2 plants in the corresponding range. The phenotypic positions of the resistant parent PI660122 and the susceptible parent AvS are marked in the figure.

[0038] 3. Extraction and quality control of leaf genomic DNA 3.1 Sample collection and pretreatment: Fresh leaves were collected from the two-leaf stage or suitable growth period of the parental line, RIL population, F2 population and F3 conversion population seedlings; the leaves were placed into 2.0mL centrifuge tubes with pre-placed steel balls, flash-frozen in liquid nitrogen for 3-5 minutes and then thoroughly ground into powder using a tissue homogenizer.

[0039] 3.2 CTAB Extraction of Genomic DNA: Add 1000 μL of preheated CTAB extraction buffer (65°C) to the powder, vortex thoroughly to mix, and incubate at 65°C for 60 min, inverting the container every 10-15 min during this period. After the incubation, add 200 μL of chloroform, inverting the container until it becomes emulsified, and centrifuge at 4°C and 12000 rpm for 10 min. After centrifugation, transfer approximately 500-600 μL of the clear supernatant to a new centrifuge tube, add an equal volume of pre-chilled isopropanol, and slowly invert the container until a white flocculent DNA precipitate appears. Incubate the centrifuge tube at -20°C for at least 30 min, then centrifuge at 4°C and 12000 rpm for 10 min, discarding the supernatant. Wash the precipitate 1-2 times with 500 μL of 75% ethanol, and allow the ethanol to evaporate at room temperature for 5-10 min. Depending on the amount of precipitate, add 50-100 μL of ddH2O or TE buffer to dissolve the DNA.

[0040] 3.3 DNA Quality Control: DNA concentration and purity were detected using NanoDrop or an equivalent instrument. The preferred standards were an A260 / A280 ratio of 1.8–2.0, an A260 / A230 ratio close to 2.0, and a DNA concentration of 50–100 ng / μL. The DNA was stored at -20°C for later use. For KASP genotyping, the DNA concentration could be adjusted to 10–100 ng / μL, preferably 50–100 ng / μL. If residual polysaccharides, polyphenols, or salt ions in the sample caused amplification instability, ethanol precipitation or purification using a commercial column could be performed before PCR.

[0041] 4. 15K SNP initial localization, exon capture sequencing, and variant screening 4.1 Preliminary mapping of 15K SNP chips: QTL mapping was performed using the stripe rust resistance phenotype and 15K SNP chip genotype of the Zhengmai 9023 / PI660122 F6 recombinant inbred line population. The stripe rust resistance locus from PI660122 was initially located in the 1,702,954~9,555,772bp interval on chromosome 4DS. This interval spans approximately 7.85Mb, and further development of encrypted markers is needed to narrow down the mapping range.

[0042] 4.2 Exon capture sequencing library construction: To obtain polymorphic SNPs that can be converted into KASP markers within the target region, exon capture sequencing was performed on the parents AvS and PI660122. Library construction included genomic DNA fragmentation, end repair, phosphorylation, dA tail addition, ligation of sequencing adapters, magnetic bead purification, and screening of 200-300bp fragments. After PCR amplification and quality control, the pre-library was hybridized and captured using capture probes. After washing to remove non-specific fragments, it was amplified and purified again by PCR to obtain the exon capture library.

[0043] 4.3 High-throughput sequencing and data quality control: Sequencing was performed using DNBSEQ-T7 or an equivalent high-throughput sequencing platform at 150 bp paired ends. Raw data underwent quality control using FASTP, removing adapter sequences, paired reads with more than 15 N bases, and paired reads with a low-quality base ratio exceeding 40% of the read length. Filtered clean reads were aligned to the Chinese Spring reference genome IWGSC RefSeq v2.1 using the BWA mem algorithm. SNPs and InDels were detected using the GATK pipeline, and functional annotation was performed using SnpEff. To ensure variant reliability, variant sites with QUAL > 100 and DP ≥ 5 were selected. For heterozygous sites, at least 4 reads were required to support each allele; otherwise, they were treated as deletions.

[0044] 4.4 Sequencing and variant screening results: 163,907,262 raw reads were obtained from the AvS sample, with a Q30 of 88.8%; 60,726,876 raw reads were obtained from the PI660122 sample, with a Q30 of 82.3%. After filtering, the clean read rates for AvS and PI660122 were 99.96% and 99.93%, respectively. After alignment to IWGSC RefSeq v2.1, the alignment rates for AvS and PI660122 were 99.96% and 99.95%, respectively. A total of 12,190 SNP loci were identified on chromosome 4D, and 920 inter-parental polymorphic SNPs were screened within the target region of QYrPI660122.swust-4DS. Detailed sequencing data statistics are shown in Table 2. Further screening of the above 920 polymorphic SNPs prioritized sites that were homozygous in both parents, had reliable sequencing depth, good uniqueness of flanking sequences, strong A / B / D subgenome specificity, and were suitable for KASP primer design. Ten candidate SNP sites were selected for KASP primer design, and three markers (Kasp119375, Kasp397582, and Kasp703074) were finally verified by parents and population to be stable for genotyping.

[0045] Table 2: Statistical Table of Parental Exon Capture Sequencing Data

[0046] 5. KASP marker design, screening, and primer sequencing 5.1 Primer design rules: When designing KASP markers, extract the sequences flanking the candidate SNP sites from the IWGSC RefSeq v2.1 reference sequence, and design two allele-specific forward primers and one universal reverse primer using PolyMarker or equivalent software; the 3′ ends of the two allele-specific forward primers correspond to the differential bases between the parents, and their 5′ ends are connected to the FAM universal adapter GAAGGTGACCAAGTTCATGCT (SEQ ID NO:10) and the HEX universal adapter GAAGGTCGGAGTCAACGGATT (SEQ ID NO:11), respectively.

[0047] 5.2 Primer specificity screening: Homology comparison and specificity checks were performed on the designed primers. Priority was given to sites that have stable amplification specificity only in the 4D target region, have no obvious risk of non-specific amplification of A / B / D subgenomes, and have moderate primer Tm values ​​and GC content. Candidate primers were first tested in parental or control materials such as PI660122, AvS, Zhengmai 9023, and ZM9023 / PI660122 F6-53 to eliminate markers that did not amplify, had unclear clustering, could not be distinguished between positive and negative controls, or had poor reproducibility.

[0048] 5.3 Marker Screening Results: After the above screening, three KASP markers, Kasp119375, Kasp397582, and Kasp703074, were obtained that could be stably genotyped. These markers formed clear G:G, T:T, and G:T clusters in both the AvS / ZM9023 / PI660122 F6-53 F2 population and the ZM9023 / PI660122F6 recombinant inbred line population, which can be used for subsequent linkage analysis, fine mapping, and breeding screening. Kasp119375 is located on one side of the final fine mapping region and is the preferred core marker of this invention. The second allele-specific forward primer for Kasp703074 contains a HEX universal adapter and was used as the second allele-specific forward primer according to the KASP system. The physical location, primer type, sequence number, and complete nucleotide sequence of each marker are detailed in Table 3.

[0049] Table 3: KASP marker primer sequence information

[0050] 6. KASP detection system, amplification procedure, and result interpretation 6.1 KASP Reaction System: The KASP reaction can be performed using a 5-20 μL system; a preferred 10 μL system is: 5 μL 2×KASP Master Mix, 0.14 μL KASP primer mixture, 10-50 ng template DNA, and nuclease-free water to a final volume of 10 μL; in the primer mixture, the two allele-specific forward primers and the universal reverse primer can be prepared in a ratio of 1:1:2 to 1:1:4, preferably 1:1:2; if prepared according to the stock solution concentration, a mixture of 12 μM each of the two allele-specific primers and 24-30 μM of the universal reverse primer can be used. The reaction system parameter ranges and preferred conditions are detailed in Table 4.

[0051] Table 4: Parameters of the KASP Reaction System

[0052] 6.2 Amplification program: A feasible amplification program is as follows: pre-denaturation at 94℃ for 15 min; followed by 10 falling annealing cycles, each cycle being 94℃ for 20 s and 61℃ for 60 s, with the temperature decreasing by 0.6℃ each cycle until reaching 55℃; then perform 26-35 conventional amplification cycles, each cycle being 94℃ for 20 s and 55℃ for 60 s; after amplification, read the FAM and HEX fluorescence signals; if cluster separation is insufficient, 3-10 additional amplification cycles can be added before reading the fluorescence again.

[0053] 6.3 Result Interpretation Rules: When interpreting results, all plates should have a positive control, a negative control, and a template-free control; the template-free control should be located close to the background area; G:G clusters consistent with the positive control PI660122 or ZM9023 / PI660122 F6-53 are identified as homozygous for the target disease resistance allele; T:T clusters consistent with negative parents such as AvS, Zhengmai 9023, Mianmai 902, Yangmai 33, or Yannong 1212 are identified as homozygous for the non-target allele; G:T clusters located between G:G and T:T clusters are identified as heterozygous.

[0054] It should be noted that G:G, T:T, and G:T in this invention are interpretation names based on the fluorescence clustering positions of positive controls, negative controls, and hybrid materials, and do not indicate that all three markers are G / T polymorphic on the positive strand of the reference genome. The one-to-one correspondence is as follows: the SNP base variations of Kasp119375, Kasp397582, and Kasp703074 at their corresponding sites on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome are G / T, A / G, and A / G, respectively; the corresponding KASP allele-specific primers show A / C, T / C, and T / C at their 3′ ends, respectively. Clusters that cluster with PI660122 or ZM9023 / PI660122 F6-53 positive controls are named G:G; clusters that cluster with AvS, ZM9023, MM902, YM33 or YN1212 negative materials are named T:T; and intermediate clusters located between the two are named G:T.

[0055] 6.4 Breeding Application Strategy: In actual breeding, G:G materials are preferentially retained for fixing the target disease resistance allele; G:T materials can continue to self-pollinate in subsequent generations, and the KASP marker of this invention is used to screen for G:G homozygous materials; T:T materials are usually not retained as QYrPI660122.swust-4DS import materials, but can be used as background selection or negative control.

[0056] 7 Genetic linkage analysis and fine mapping 7.1 Linkage analysis of F2 population: First, the AvS / ZM9023 / PI660122 F6-53 F2 population was genotyped using 5 KASP markers, and linkage analysis was performed in conjunction with the field IT and DS phenotypes of each F2 individual plant. Genetic maps of the target segment could be constructed using IciMappingV4.2, MapDisto, JoinMap, or equivalent software, with the LOD threshold set to 2.5, and the genetic distance between markers, LOD value, phenotypic variation explained rate (PVE), and additive effects were calculated. F2 population analysis showed that QYrPI660122.swust-4DS was located between Kasp119375 and Kasp397582, with a genetic distance of 4.16 cM, corresponding to a physical distance of approximately 2.12 Mb. This interval explained 30.18% and 41.86% of the phenotypic variation in infectious type IT and disease severity DS, respectively, with LOD values ​​of 11.58 and 18.02, indicating a strong linkage between the newly developed KASP marker and the target resistance locus. The genetic linkage results in this section correspond to... Figure 2 The figure shows the fine genetic map and LOD value curve of QYrPI660122.swust-4DS constructed based on 15K SNP and KASP markers. The figure marks the genetic sequence of markers and the corresponding LOD peak within the target segment, intuitively presenting the linkage localization interval of the target site.

[0057] 7.2 Fine mapping of multiple populations: To further narrow the mapping interval, five KASP markers were combined with 15K SNP chip markers, and the field disease resistance phenotype, 15K SNP genotype, KASP genotype of the ZM9023 / PI660122 F6 recombinant inbred line population, as well as the F2 population phenotype and KASP genotype, were used for joint mapping. Finally, QYrPI660122.swust-4DS was finely mapped to the interval between AX-111093894 and Kasp119375; AX-111093894 corresponds to 4DS: 1,702,954 bp, and Kasp119375 corresponds to 4DS: 2,119,375 bp, with a genetic distance of 3.41 cM and a physical distance of approximately 0.42 Mb. In multi-environment data, the PVE for IT or DS in this interval was 13.38–23.50%, and the LOD value was 7.06–16.89, with a negative additive effect, indicating that the target effect comes from the resistant parent PI660122. Detailed multi-environment mapping data are shown in Table 5. The physical mapping results in this section correspond to... Figure 3 The figure shows the fine mapping physical map of QYrPI660122.swust-4DS. The figure indicates the physical coordinates of each marker on the 4DS chromosome, clarifies the range of the initial mapping interval and the fine mapping interval, and marks the location and number of NBS-LRR disease resistance candidate genes within the interval.

[0058] Table 5: Statistical Table of QTL Location Results for Multiple Groups and Multiple Environments

[0059] Note: 21MY and 22MY represent the field trial environment in Qingyi Town, Fucheng District, Mianyang City, Sichuan Province (31°33′N, 104°55′E) in 2020–2021 and 2021–2022, respectively; 22GY represents the field trial environment in Guangyuan City, Sichuan Province (31°28′N, 104°51′E) in 2021–2022; IT represents the stripe rust infection type, and DS represents the stripe rust disease severity.

[0060] 7.3 Positioning effect: Compared with the initial positioning interval of 1,702,954~9,555,772bp, the length of the fine positioning interval was reduced from about 7.85Mb to about 0.42Mb. The range of candidate genes was reduced accordingly, which helps to reduce the risk of misjudgment of recombination in breeding selection and provides a clearer target region for candidate gene cloning and functional verification.

[0061] 8. Candidate gene screening and expression pattern validation 8.1 Selection of candidate genes within the region: Within the finely mapped region 4DS: 1,702,954~2,119,375bp defined by AX-111093894 and Kasp119375, gene annotation was performed using WheatOmics and IWGSC RefSeq v2.1. A total of 5 candidate genes were found within this region: TraesCS4D03G0006600, TraesCS4D03G0006700LC, TraesCS4D03G0006800LC, TraesCS4D03G0006900, and TraesCS4D03G0007000LC. Among them, TraesCS4D03G0006700LC encodes an RNA-directed DNA polymerase or reverse transcriptase-related family protein, while the function of TraesCS4D03G0006800LC is not yet clear. TraesCS4D03G0006600, TraesCS4D03G0006900, and TraesCS4D03G0007000LC are all annotated as NBS-LRR class disease resistance-related proteins and possess typical disease resistance protein domains. Annotation information and validation conclusions for each candidate gene are detailed in Table 6.

[0062] Table 6: Annotation and Validation Results of Candidate Genes in Finely Mapped Regions

[0063] 8.2 Pathogen-induced expression assay: To verify the response pattern of candidate genes to stripe rust infection, ZM9023 / PI660122 F6-53 samples were inoculated with CYR32 and CYR34, respectively. Samples were collected at 0, 6, 12, 24, 48, 72, 96, and 120 h after inoculation, with three biological replicates for each treatment. Total RNA was extracted from the samples after liquid nitrogen flash freezing and reverse transcribed into cDNA. TaEF was used as an internal reference gene, and the relative expression level was calculated using the 2^-ΔΔCt method. The qRT-PCR reaction system was 10 μL, including 5 μL of 2×Universal SYBR qPCR Mix, 1 μL of cDNA, 0.4 μL each of 10 μM forward and reverse primers, and 3.2 μL of ddH2O. The amplification program was 95℃ for 30 s, followed by 40 cycles, each cycle consisting of 95℃ for 10 s and 60℃ for 30 s. The primer sequences of the internal reference gene and candidate gene used in the experiment are detailed in Table 7.

[0064] Table 7: qRT-PCR Primer Sequence Information

[0065] 8.3 Expression Validation Results: TraesCS4D03G0006600 was significantly upregulated under both CYR32 and CYR34 treatments; after CYR32 inoculation, the gene reached an early expression peak at 6 h, approximately 28 times that at 0 h; after CYR34 inoculation, the gene was significantly upregulated at 6 h, reaching its highest expression level at 96 h, approximately 33 times that at 0 h. Compared with TraesCS4D03G0006600, TraesCS4D03G0006900 showed smaller expression variations and inconsistent response patterns among different species; TraesCS4D03G0007000LC did not exhibit a stable positive induction pattern; therefore, TraesCS4D03G0006600 was identified as a priority candidate gene for QYrPI660122.swust-4DS.

[0066] 9. Application of KASP-assisted selection in transitional populations 9.1 Transformation populations and parental traits: Using ZM9023 / PI660122F6-53 carrying QYrPI660122.swust-4DS as the donor parent, and Mianmai 902, Yangmai 33, and Yannong 1212 as parents with superior agronomic backgrounds, two F3 transformation populations were constructed: the first population was MM902 / YM33 / ZM9023 / PI660122 F6-53, and the second population was MM902 / YN1212 / ZM9023 / PI660122 F6-53. Phenotypic analysis of the parent lines showed that ZM9023 / PI660122 F6-53 and MM902 exhibited high resistance (IT=2, DS=10%); YM33 showed high susceptibility (IT=8, DS=60%); and YN1212 showed moderate susceptibility (IT=5, DS=70%). Differences also existed among the parents in plant height, panicle length, number of spikelets, number of grains per panicle, and thousand-grain weight, which can be used to evaluate the transformation effect of the target locus under different agronomic backgrounds. Detailed trait data of the parents are shown in Table 8.

[0067] Table 8: Statistical Table of Disease Resistance and Agronomic Traits of Parental Lines

[0068] 9.2 Typing Results of Transgenic Population: The parents and offspring lines of the transgenic population were typed using three markers: Kasp119375, Kasp397582, and Kasp703074. The three markers formed clear clusters in both the parents and offspring materials, and could distinguish between the homozygous G:G type of the target disease resistance allele, the homozygous T:T type of the non-target allele, and the heterozygous G:T type. The parental line ZM9023 / PI660122 F6-53 was G:G, while MM902, YM33, and YN1212 were T:T, indicating that the markers can stably typify in complex genetic backgrounds.

[0069] 9.3 Genotype-Phenotype Association Analysis: In the two F3 transgenic populations, a total of 37 lines carrying the target QYrPI660122.swust-4DS resistance allele were detected, with average IT and DS values ​​of 2.69 and 18.33%, respectively, which were lower than those of lines without the detected locus (3.60 and 22.04%). Specifically, in the MM902 / YM33 / ZM9023 / PI660122 F6-53 population, the average IT and DS values ​​of lines carrying the target locus were 2.38 and 13.08%, respectively, while those of lines without the detected locus were 3.64 and 20.90%, respectively. In the MM902 / YN1212 / ZM9023 / PI660122 F6-53 population, the average IT and DS values ​​of lines carrying the target locus were 2.87 and 21.30%, respectively, while those of lines without the detected locus were 3.50 and 25.00%, respectively. Detailed statistics for each group are shown in Table 9.

[0070] Table 9: Statistical Table of Association Between Genotype and Disease Resistance Phenotype in Transgenic Populations

[0071] 9.4 Application Effect Description: Since the common parent MM902 itself exhibits strong resistance to stripe rust, some lines that did not show QYrPI660122.swust-4DS may still show a certain degree of resistance. This phenomenon indicates that phenotype alone cannot distinguish the source of resistance, while the KASP marker of this invention can identify the target disease resistance allele from PI660122, making it suitable for combined use with field resistance identification and agronomic trait surveys.

[0072] Example 2: Standard operating procedure for detecting wheat materials using the KASP marker of the present invention.

[0073] This embodiment provides a standardized testing procedure that can be directly used in breeding laboratories. All reagents and testing equipment used in molecular biology operations can be replaced by conventional equivalent products in the field without changing the accuracy of the test results.

[0074] 1. Scope of materials to be tested and sample collection The materials to be tested include parents, F1, F2, F3, backcross populations, recombinant inbred lines, high-generation breeding materials, or wheat germplasm resources. For each material, fresh leaves of 2-5 cm were cut at the two-leaf stage or other suitable growth stage and placed in clearly labeled 2.0 mL centrifuge tubes. Genomic DNA was extracted according to the CTAB method described in Example 1; alternatively, commercially available plant genomic DNA extraction kits or other conventional and equivalent methods in the art could be used for extraction.

[0075] 2. Genomic DNA quality control Before detection, adjust the DNA concentration to 10-100 ng / μL, preferably 50-100 ng / μL, and use an A260 / A280 ratio of 1.8-2.0 and an A260 / A230 ratio close to 2.0 as the quality standard. If the sample concentration is too high or contains amplification inhibitors, it can be diluted with nuclease-free water or purified by column before use.

[0076] 3. KASP Detection Tag Selection Strategy Kasp119375 was used as the preferred core marker for the initial detection. This marker is the right flanking marker of the QYrPI660122.swust-4DS fine-mapping region. Its physical location on chromosome 4D and its linkage relationship with the target site can be found in [reference needed]. Figure 3For populations that have undergone target locus conversion, backcross selection, or have complex genetic backgrounds, at least one auxiliary marker from Kasp397582 and Kasp703074 can be used for verification. If the genotyping results of the core marker and auxiliary marker are inconsistent, they should be recorded as suspected recombinant materials and further judged in conjunction with field disease resistance phenotypes and progeny segregation verification.

[0077] 4. Control settings for the test reaction plate Each 96-well or 384-well plate includes a positive control, a negative control, and a template-free control. The preferred positive control is PI660122 or ZM9023 / PI660122 F6-53, or other homozygous materials verified to carry the target resistance allele. The preferred negative control is AvS, Zhengmai 9023, or the corresponding recipient parent of the tested population, or other homozygous materials verified not to carry the target resistance allele. An equal volume of nuclease-free water is added to the template-free control.

[0078] 5. KASP Amplification and Fluorescence Signal Acquisition The KASP reaction system and amplification procedure were performed according to Example 1. If fluorescence clustering separation was insufficient after amplification, 3-10 additional amplification cycles could be performed before re-reading the signal. After all amplification was completed, FAM and HEX fluorescence signals were collected to generate a two-dimensional fluorescence scatter plot for subsequent genotype interpretation.

[0079] 6. Determination of detection validity and interpretation of genotype The test is considered valid when the positive control forms stable G:G clusters, the negative control forms stable T:T clusters, and the hybrid material forms intermediate G:T clusters, with no template control located in the fluorescent background area. If the control sample does not form the expected clusters, the DNA quality, primer mixture preparation, PCR amplification program, and fluorescence reading parameters should be checked. After troubleshooting, the test should be repeated. See Table 10 for detailed test operation points and judgment criteria.

[0080] Table 10: Key Points of Testing Operation and Judgment Criteria

[0081] 7. Application of genotype screening for breeding materials For breeding to introduce target disease-resistant alleles, G:G genotype materials can be given priority for retention; G:T genotype materials can be retained and allowed to continue self-pollination in their offspring to select for G:G homozygous materials; T:T genotype materials are generally not retained as materials for introducing the target site QYrPI660122.swust-4DS if there are no other sources of resistance.

[0082] Example 3: Screening of superior wheat transgenic plants carrying QYrPI660122.swust-4DS based on KASP markers and field phenotypic analysis.

[0083] In this embodiment, all field cultivation, disease investigation, and molecular typing operations can be replaced by conventional equivalent equipment, reagents, and methods in the field. The field investigation cycle and planting specifications can be adjusted within a reasonable range. Each material is set up with no less than one biological replicate, and technical replicates are added for key breeding plants to ensure the reproducibility of results.

[0084] 1. Preparation of experimental population and basic experimental materials 1.1 The populations used in the screening experiment in this embodiment were two types of F3 transgenic populations, namely MM902 / YM33 / ZM9023 / PI660122 F6-53 and MM902 / YN1212 / ZM9023 / PI660122 F6-53; the donor parent was ZM9023 / PI660122 F6-53, which carries the homozygous disease-resistant material QYrPI660122.swust-4DS; and the recipient agronomical background parents were Mianmai 902, Yangmai 33, and Yannong 1212.

[0085] 1.2 Explanation of Experimental Observation Indicators: IT represents the stripe rust infection type; DS represents the stripe rust disease severity; PH represents plant height in cm; SL represents spike length in cm; SNS represents the number of effective spikelets; GNS represents the number of grains per spike; TG represents the thousand-grain weight in g. Mianmai 902 carries endogenous stripe rust resistance. Relying solely on the field IT and DS phenotypes cannot distinguish whether the resistance originates from an endogenous gene or the target 4DS resistance locus. Genotyping must be completed using the KASP markers of this invention. The linkage arrangement and physical interval boundaries of the 5 groups of KASP markers used in this embodiment can be referenced... Figure 2 Fine genetic map, Figure 3 Detailed physical map Figure 3 The annotations AX-111093894 and Kasp119375 define a fine-grained positioning interval of 0.42Mb.

[0086] 2. Simultaneous Investigation of Stripe Rust Resistance and Agronomic Traits in the Field 2.1 Field plots were planted according to the conventional layout for wheat breeding. Susceptible control AvS was planted every 20 rows in the experimental plots. Stripe rust induction sites were set up around the plots to ensure uniform disease development. After the susceptible control had developed sufficient disease, 2 to 4 field surveys were conducted consecutively, with one survey per week being preferred.

[0087] 2.2 Field evaluation screening thresholds: Lines with an infection type IT ≤ 3 and a disease severity DS ≤ 20% were selected as basic disease resistance retention targets. Plant height, panicle length, number of spikelets, number of grains per panicle, and thousand-grain weight were measured simultaneously. A comprehensive preliminary selection was conducted, taking into account both superior plant type and yield-related agronomic traits. The IT and DS grading standards were consistent with those described in Example 1.

[0088] 3. KASP molecular typing of whole lines in the transgenic population 3.1 Definition of Genotyping Markers: K1 represents Kasp119375, K2 represents Kasp275340, K3 represents Kasp397582, K4 represents Kasp172202, and K5 represents Kasp703074; Genotyping criteria: G:G is homozygous for the target resistance allele, G:T is heterozygous, and T:T is homozygous for the absence of the target resistance allele.

[0089] 3.2 All DNA extraction, KASP amplification, fluorescence reading, and genotyping of all strains were strictly performed according to the standardized detection procedure in Example 2. Multiple markers could be used for cross-checking during genotyping. If there were discrepancies in the marker genotyping results, the corresponding marker positions could be referenced. Figure 2 , Figure 3 Chromosomal coordinates were used to determine suspected recombinant single plants, which were then verified a second time using offspring segregation experiments.

[0090] 4. Multi-indicator comprehensive screening and experimental result analysis 4.1 By integrating KASP genotyping data, field stripe rust IT / DS resistance data, and complete data on panicle and yield agronomic traits, nine candidate breeding plants with the target resistance genotype, excellent field disease resistance, and agronomic traits were screened from two types of F3 breeding populations. Detailed data of candidate plants in the MM902 / YM33 / ZM9023F3 population are shown in Table 11, and detailed data of candidate plants in the MM902 / YN1212F3 population are shown in Table 12.

[0091] Table 11: Screening Results of Candidate Lines in the MM902 / YM33 / ZM9023 / PI660122 F6-53 F3 Transgenic Population

[0092] Table 12: Screening Results of Candidate Lines in the MM902 / YN1212 / ZM9023 / PI660122 F6-53 F3 Transgenic Population

[0093] Note: K1, K2, K3, K4 and K5 represent Kasp119375, Kasp275340, Kasp397582, Kasp172202 and Kasp703074 respectively; PH is plant height (cm), SL is spike length (cm), SNS is number of spikelets, and GNS is number of grains per spike.

[0094] 4.2 Population statistics: A total of 37 lines from the two F3 transgenic populations were found to contain the target QYrPI660122.swust-4DS resistance allele. The average infection type and average disease severity of the lines carrying the target locus were significantly lower than those of the lines without the target locus. Specific population statistics are shown in Tables 11 and 12.

[0095] 4.3 Application Effect Description: Field phenotypic screening alone cannot distinguish between the endogenous resistance of Mianmai 902 and the QYrPI660122.swust-4DS resistance derived from PI660122. By adopting the KASP marker + field trait combined screening scheme of this invention, superior lines with 4DS target disease resistance loci can be accurately and directionally selected, greatly reducing the probability of misselection and missed selection in breeding. It is suitable for backcrossing and conversion of wheat disease resistance genes, aggregation of multiple resistance genes, and screening of early generation large-scale breeding populations.

[0096] Comparative Example 1: Comparison of the initial positioning interval with the fine positioning interval of the present invention.

[0097] 1. Initial positioning scheme Initial localization limited QYrPI660122.swust-4DS to the 4DS:1,702,954~9,555,772bp interval, with a physical interval of approximately 7.85Mb and a genetic distance of approximately 12.15cM. This interval is large and may contain numerous recombination events. If directly used for breeding selection, recombination between flanking markers and the target locus could lead to misselection or missed selection.

[0098] 2. The fine positioning scheme of the present invention This invention utilizes exon capture sequencing, parental polymorphic SNP screening, KASP marker development, F2 segregating population validation, and RIL population joint mapping to narrow down the target region to 4DS: 1,702,954~2,119,375 bp between AX-111093894 and Kasp119375, with a physical distance of approximately 0.42 Mb and a genetic distance of 3.41 cM. Compared to the initial mapping, the physical region is significantly reduced, and the candidate gene range is narrowed to 5 genes, which is beneficial for marker-assisted selection and candidate gene validation. A detailed comparison of the parameters of the two schemes is shown in Table 13.

[0099] Table 13: Comparison of the initial positioning interval and the fine positioning interval of the present invention

[0100] Comparative Example 2: Comparison between simple phenotypic selection and marker-phenotype combined selection.

[0101] 1. Simple phenotypic selection scheme Simple phenotypic selection depends on the full occurrence of stripe rust and is influenced by disease evenness, pathogen race composition, climatic conditions, and the timing of the survey. In the breeding population with MM902 as a common parent, due to the strong resistance of MM902 itself, some lines that do not carry QYrPI660122.swust-4DS can still show lower IT or DS, making it impossible to determine whether the resistance originates from the PI660122 target locus.

[0102] 2. Marker-Phenomenon Joint Selection Scheme When using the KASP marker and field phenotype combined selection method of this invention, the first step is to determine whether the offspring carry the target disease resistance allele from PI660122 through KASP typing, followed by screening based on IT, DS, and agronomic traits. In the two F3 transgenic populations, the average IT and DS of lines carrying the target locus were generally lower than those of lines without the target locus, and nine candidate lines with the target genotype, good resistance, and superior agronomic traits were selected.

[0103] 3. Conclusions of the Comparison of Schemes Marker-phenotype combined selection can distinguish between resistance contributed by QYrPI660122.swust-4DS and resistance contributed by background genes, reducing the risk of misjudgment by simple phenotype selection. It is suitable for disease resistance gene introduction, backcrossing, hybridization breeding, and early generation material screening.

[0104] In summary, this invention discloses a complete set of KASP marker sequences, detection procedures, locus localization criteria, candidate gene verification results, and transformation application data. It can be widely applied to early-generation screening of wheat stripe rust resistant materials, transformation of target resistance loci, aggregation of resistance genes, and identification of resistance germplasm resources. Since KASP detection does not rely on field disease conditions, high-throughput detection can be carried out in seedling stages, greenhouses, or laboratory environments. This makes it suitable for large-scale applications by seed companies, breeding units, and research institutions, especially for stripe rust resistant breeding practices using PI660122 or ZM9023 / PI660122 F6-53 as resistance donors and Mianmai 902, Yangmai 33, Yannong 1212, Zhengmai 9023, and other superior wheat materials as recipients.

[0105] The above embodiments can well illustrate the technical solution of the present invention, but they are only describing preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, all kinds of changes and improvements made by those skilled in the art to the technical solution of the present invention should fall within the protection scope defined by the present invention.

Claims

1. A group of KASP molecular markers linked to the wheat stripe rust resistance site QYrPI660122.swust-4DS, characterized in that, The KASP molecular markers include: Kasp119375, Kasp397582, and Kasp703074; The Kasp119375 is located at chromosome 2,119,375 bp on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome; The Kasp397582 is located at chromosome 4,397,582 bp on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome; The Kasp703074 is located at chromosome 7,703,074 bp on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome.

2. The primer set for amplifying the KASP molecular marker according to claim 1, characterized in that, The primer set includes at least one of primer set A, primer set B, and primer set C: The primer set A is a primer set used to amplify Kasp119375, consisting of an allele I-specific forward primer as shown in SEQ ID NO:1, an allele II-specific forward primer as shown in SEQ ID NO:2, and a universal reverse primer as shown in SEQ ID NO:

3. The primer set B is a primer set used to amplify the Kasp397582 site, consisting of an allele I-specific forward primer as shown in SEQ ID NO:4, an allele II-specific forward primer as shown in SEQ ID NO:5, and a universal reverse primer as shown in SEQ ID NO:

6. The primer set C is a primer set used to amplify Kap703074, consisting of an allele I-specific forward primer as shown in SEQ ID NO:7, an allele II-specific forward primer as shown in SEQ ID NO:8, and a universal reverse primer as shown in SEQ ID NO:

9.

3. The primer set according to claim 2, characterized in that, In each primer set, the 5′ end of the allele I-specific forward primer is ligated to the FAM universal adapter sequence, and the 5′ end of the allele II-specific forward primer is ligated to the HEX universal adapter sequence. The FAM universal connector sequence is shown in SEQ ID NO:10; The HEX universal connector sequence is shown in SEQ ID NO:

11.

4. A method for detecting whether wheat materials carry the QYrPI660122.swust-4DS resistance allele, characterized in that, Includes the following steps: S1. Extract genomic DNA from the wheat material to be tested; S2. Using at least one of the primer sets described in claim 2 or 3, perform a KASP amplification reaction using the genomic DNA to be tested as a template; S3. After the amplification reaction is complete, collect the FAM fluorescence signal and the HEX fluorescence signal; S4. Perform cluster analysis on the fluorescence signals and determine the genotype of the wheat material to be tested based on the clustering results.

5. The method according to claim 4, characterized in that, The specific criteria for genotype determination are as follows: Each batch of tests was simultaneously set up with a positive control, a negative control, and a template-free control. The test was considered valid when the template-free control was in the fluorescent background area. If the test sample and the positive control cluster into the same fluorescent cluster, it is determined to be a homozygous type of the resistance allele QYrPI660122.swust-4DS; If the test sample and the negative control cluster together in the same fluorescent cluster, it is determined to be a non-QYrPI660122.swust-4DS resistance allele homozygous type; If the sample to be tested forms an intermediate fluorescent cluster between the two fluorescent clusters mentioned above, it is determined to be a heterozygous type of the resistance allele QYrPI660122.swust-4DS.

6. The method according to claim 5, characterized in that, The SNP base variations of Kasp119375, Kasp397582, and Kasp703074 at their corresponding sites on chromosome 4D of the wheat IWGSC RefSeq v2.1 reference genome are G / T, A / G, and A / G, respectively. When the KASP primers are designed with opposite strands, the differential bases at the 3′ end of the allele-specific primers at the above sites are A / C, T / C, and T / C, respectively.

7. A kit for detecting the resistance allele of wheat QYrPI660122.swust-4DS, characterized in that, The kit contains the primer set as described in claim 2 or 3, KASP fluorescent PCR reaction mixture, positive control DNA, negative control DNA, and nuclease-free water.

8. The application of the KASP molecular marker as described in claim 1 in wheat-assisted breeding.

9. A KASP molecular marker-assisted breeding method for wheat resistant to stripe rust, characterized in that, The method described in any one of claims 4 to 6 is used to perform genotyping on the wheat material to be tested, screen for materials carrying the target resistance allele, and combine field disease resistance and agronomic traits for offspring selection.

10. The breeding method according to claim 9, characterized in that, The wheat breeding materials to be tested include segregating populations, transgenic populations, and germplasm resources. Genotyping is performed during the seedling stage.

Images