A dCAPS molecular marker related to barley grain uniformity and use thereof

Abstract

The application belongs to the field of molecular biology, and particularly relates to a dCAPS molecular marker related to barley grain uniformity and application thereof. The dCAPS molecular marker is located at 485037030 bp of barley 1H chromosome, and the base of the 485037030 bp is T or C. The application provides an efficient, simple and reliable assisted selection molecular marker for screening of a good grain uniformity barley strain genotype, and the screening of a good grain uniformity barley strain genotype can be realized by using high-throughput genotype detection in a high generation excellent strain, and the improvement efficiency of barley grain quality and yield is significantly improved.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a dCAPS molecular marker related to barley grain uniformity and its application. Background Technology

[0002] Barley grain uniformity (GU) refers to the degree of consistency in morphology, size, and weight among grains from different parts (top, middle, and base) of the same ear within a sample. It is mainly manifested in the in-sample variation of indicators such as grain length, grain width, and thousand-grain weight, and can be measured by the standard deviation. It is a key factor affecting barley yield and specific quality. Poor grain uniformity usually means significant grain size differentiation, poor thousand-grain weight stability, and low and unstable yield. As a raw material for brewing barley, poor grain uniformity leads to inconsistencies in malting, germination, and roasting processes, causing fluctuations in quality indicators such as malt extraction rate and saccharification power, ultimately affecting the stability of beer flavor and quality. Therefore, developing barley varieties with good grain uniformity has become one of the important goals of modern high-quality and high-yield barley breeding.

[0003] Barley grain development is subject to complex regulation by the interaction of genetic factors and the environment. Traditional breeding methods rely on phenotypic selection, which is time-consuming, inefficient, and easily affected by the environment, making it difficult to accurately screen for lines with good grain uniformity in early generations. With the development of molecular marker technology, linkage analysis or genome-wide association analysis can be used to locate molecular markers closely associated with target traits, and then marker-assisted selection (MAS) can be carried out, providing an effective means to efficiently improve complex traits. Currently, most studies have reported association markers related to barley grain size such as thousand-grain weight, grain length, and grain width, but studies reflecting grain uniformity, such as grain shape or grain weight coefficient of variation, have relatively weak localization and gene mining. Existing loci and their linkage markers are mainly concentrated on genes related to the developmental heterogeneity of lateral spikelets and central spikelets in six-row barley, such as vrs1, vrs3, and int-c, but these markers are difficult to apply in the breeding practice of two-row malting barley.

[0004] Discovering molecular markers closely linked to grain uniformity from natural variation and establishing rapid, accurate, and low-cost genotyping methods is of significant theoretical and practical value for improving barley grain uniformity and accelerating the breeding of high-quality, specialized barley varieties. Single nucleotide polymorphisms (SNPs), as the latest molecular markers, have advantages such as wide distribution, high genetic stability, and easy allelic typing, making them the preferred marker type for genome-wide association analysis and marker-assisted breeding. However, conventional SNP detection methods are costly, limiting their direct application in large-scale breeding. Therefore, developing simple, economical, and reliable SNP-derived marker technologies is of great practical value. The dCAPS (derived Cleaved Amplified Polymorphic Sequences) technology targets a specific SNP site by introducing 1-2 mismatched bases at the 3' end of a primer, thereby artificially creating a restriction endonuclease site on a specific allele of the SNP. After PCR amplification, the product was digested with the corresponding restriction endonuclease. The size differences of fragments produced by different alleles could be distinguished by agarose or polyacrylamide gel electrophoresis. Therefore, the development of molecular markers for barley grain uniformity based on dCAPS technology has important practical value for stable yield and quality-assisted selection breeding. Summary of the Invention

[0005] Based on the above background, the purpose of this invention is to provide a dCAPS molecular marker related to barley grain uniformity and its application, so as to provide an effective and reliable resource for the genetic improvement of barley grain uniformity and the screening of strains with good grain uniformity.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] A dCAPS molecular marker associated with barley grain uniformity is disclosed, wherein the molecular marker is located at 485037030 bp on barley chromosome 1H, and the base at 485037030 bp is either T or C. For barley with good grain uniformity, the base at 485037030 bp on chromosome 1H is T, and its nucleotide sequence is shown in SEQ ID No. 1; for barley with poor grain uniformity, the base at 485037030 bp on chromosome 1H is C, and its nucleotide sequence is shown in SEQ ID No. 2.

[0008] SEQ ID No. 1: AGCTAACAAATGTTACACAGAACCATCGATCGGCCAAGAAGACAGCTAATGGTCTAGCCTAAGCGGATGTGAACTTGGTGATGGCCTTGGTGCCCTCGGTCGAGGTTAACTGAAAGTTACATCTTACTGGGGAAAAGGCGAGCGCTTCGGTCGATGTTAAGGAGGCTGATGGTGGCGGAGCGTGGAAGAATCTGCATGGTCAATGAAGGGAGAACAAGTTAGCAAGGCCATTACATAG.

[0009] SEQ ID No. 2:

[0010] AGCTAACAAATGTTACACAGAACCATCGACCGGCCAAGAAGACAGCTAATGGTCTAGCCTAAGCGGATGTGAACTTGGTGATGGCCTTGGTGCCCTCGGTCGAGGTTAACTGAAAGTTACATCTTACTGGGGAAAAGGCGAGCGCTTCGGTCGATGTTAAGGAGGCTGATGGTGGCGGAGCGTGGAAGAATCTGCATGGTCAATGAAGGGAGAACAAGTTAGCAAGGCCATTACATAG.

[0011] This invention also provides primers for the above-mentioned dCAPS molecular marker related to barley grain uniformity, the nucleotide sequences of which are as follows:

[0012] Forward primer: AGCTAACAAATGTTACACAGAACCGTCGA;

[0013] Reverse primer: CTATGTAATGGCCTTGCTAACT.

[0014] The present invention also provides the application of the above-mentioned dCAPS molecular markers related to barley grain uniformity or the above-mentioned primers in the identification of barley grain traits.

[0015] The present invention also provides the application of the above-mentioned molecular dCAPS markers related to barley grain uniformity or the above-mentioned primers in the breeding of barley with uniform grains.

[0016] This invention also provides a method for identifying the uniformity of barley grains, which detects the allelic variation type at the 485037030 bp site on chromosome 1H of the barley DNA sample to be tested.

[0017] Furthermore, the identification method includes: extracting genomic DNA from barley germplasm to be tested; using the extracted barley genomic DNA as a template, performing PCR amplification using the primer pairs described above to obtain amplification products; digesting the amplification products with the restriction endonuclease SalI; separating the digested products by polyacrylamide gel electrophoresis, and determining the genotype based on the band size.

[0018] Furthermore, if the enzyme digestion product is a long band, it indicates that the allelic variation of the tested barley line at this locus is T, which is a dominant genotype for grain uniformity; if the enzyme digestion product is a short band, it indicates that the allelic variation of the tested barley line at this locus is C, which is a suboptimal genotype for grain uniformity.

[0019] Furthermore, the amplification program was as follows: denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 30 seconds, for a total of 30 cycles.

[0020] Furthermore, the present invention provides a method for detecting the above-mentioned molecular markers, comprising the following steps:

[0021] (1) Using barley genomic DNA as a template, PCR amplification was performed using the primer pair to obtain an amplification product containing the polymorphic site;

[0022] (2) The amplification product obtained in step (1) was digested with the restriction endonuclease SalI;

[0023] (3) Separate the enzyme digestion products by polyacrylamide gel electrophoresis and determine the genotype based on the band size.

[0024] Furthermore, the PCR amplification reaction system in step (1) contains Novizan 2×Taq Master Mix (DyePlus) enzyme, and the amplification program is as follows: 95℃ pre-denaturation for 3 min; 30 cycles: 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s; and finally 72℃ extension for 5 min.

[0025] Furthermore, the conventional restriction endonuclease SalI mentioned in step (2) is a product sold by Takara.

[0026] Further, in step (3), an 8% non-denaturing polyacrylamide gel was used for electrophoresis at 160V for 2 hours, and the band size was observed after silver staining. If the enzyme digestion product is a high band, it indicates that the allelic variation of the tested line at this locus is T, which is a dominant genotype for grain uniformity; if the enzyme digestion product is a low band, it indicates that the allelic variation of the tested line at this locus is C, which is a suboptimal genotype for grain uniformity.

[0027] This invention also provides the application of the above-mentioned molecular markers or primer pairs in assisting in the identification of barley grain uniformity.

[0028] The present invention also provides the application of the above-mentioned molecular markers or primer pairs in the identification of barley varieties or selected barley products.

[0029] Furthermore, the product can be any one of reagents, test strips, or kits.

[0030] This invention also provides a method for breeding barley with uniform grain size, which uses the above-mentioned primers to amplify barley DNA by PCR and selects barley germplasm with a base of T at 485037030 bp on chromosome 1H.

[0031] The present invention also provides a kit for identifying the uniformity of barley grains, the kit containing the primers described above.

[0032] Beneficial effects

[0033] This invention locates an MTA at 485037030 bp on barley chromosome 1H that is significantly associated with grain uniformity. At 485037030 bp, the MTA is T, which, compared to C, increases the standard deviation within grain samples from 0.88 to 0.79, representing a 10.97% improvement in uniformity. This provides a theoretical basis for the discovery of barley grain uniformity genes. Based on this locus, this invention develops a dCAPS marker. The detection method is simple, low-cost, and yields stable and reliable results, making it suitable for large-scale breeding screening. This invention allows for genotyping at the barley seedling stage, enabling early elimination of inferior plants, significantly improving breeding efficiency and shortening the breeding cycle. This marker can be directly used for marker-assisted selection of barley lines with good grain uniformity, showing broad application prospects. Attached Figure Description

[0034] To more clearly illustrate the technical solution of the present invention, the accompanying drawings related to the embodiments will be briefly described below. It should be noted that the drawings are only schematic diagrams of some exemplary embodiments, and those skilled in the art can deduce other feasible implementation methods based on their understanding of the principles of the present invention.

[0035] Figure 1 Manhattan plot of MLM association analysis results for grain homogeneity BLUP of 334 barley germplasms in 6 environments over 2 years. The ordinate is the negative logarithm of the p-value. 10 (p), the horizontal axis represents chromosomes, and one point represents one SNP locus; the dashed line is the threshold, and the red point is a significantly associated SNP. Points above the dashed line indicate that the corresponding SNP marker is significantly associated with the grain uniformity phenotype. The point pointed to by the arrow above chromosome 1H corresponds to the 485037030 bp SNP.

[0036] Figure 2 Box plots showing phenotypic differences among different allelic variants at 485037030 bp in 334 barley germplasms. *** indicates significant differences at the 0.001 level.

[0037] Figure 3 This is an electrophoresis diagram of the enzyme digestion detection results of the dCAPS label described in this invention. M represents the DNA molecular weight standard, with band sizes from top to bottom being 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, and 100 bp. Lanes 1-10 represent amplification products from barley varieties (lines) with poor grain uniformity, and lanes 21-30 represent the corresponding low-band products after enzyme digestion. Lanes 11-20 represent barley varieties (lines) with good grain uniformity, and lanes 31-40 represent the corresponding products with unchanged band sizes after enzyme digestion. Detailed Implementation

[0038] The following embodiments are intended to further illustrate the present invention in detail to facilitate understanding of the technical solution, and their content does not constitute any limitation on the scope of protection of the present invention.

[0039] In the embodiments, unless otherwise specified: all instruments and equipment used were of conventional type; all reagents, carriers, and other materials used were commercially available conventional products; primer synthesis and sequencing were performed by Beijing Qingke Biotechnology Co., Ltd.; and all experimental and detection methods involved were standard methods in the field. All quantitative experiments were performed in triplicate, and the data results were averaged.

[0040] Example 1

[0041] Discovering SNP sites associated with grain homogeneity

[0042] To eliminate the interference of ridge shape and bare husk on grain uniformity, this invention selected 334 two-row barley materials (including local varieties, modern varieties, and breeding lines) and conducted randomized block experiments for two consecutive years at three experimental sites in Jiangsu Province. After threshing five main ears of each variety, the standard deviation of grain length (GL_SD) was measured using the WSeen SC-G automated seed analysis system to characterize uniformity. The best linear unbiased predictive value (BLUP) was calculated using the lme4 package. Genome-wide association analysis was performed on GL_SD using 233,451 high-density SNP markers obtained from SLAF-seq and a mixed linear model based on the GAPIT3 package. The significance threshold was calculated to be 1.85 × 10⁻⁶. -5 Genome-wide association analysis identified a SNP at 485037030 bp on chromosome 1H that was significantly associated with grain uniformity. Figure 1This locus exhibits T / C polymorphism. The standard deviation within the grain sample of material carrying the T allelic variation was 0.79, while the standard deviation within the grain sample of material carrying the C allelic variation was 0.88. This indicates that the grain homogeneity of material carrying the T allelic variation was significantly higher than that of material carrying the C allelic variation. Figure 2 Grain uniformity was improved by 10.97%.

[0043] Example 2

[0044] dCAPS molecular marker development

[0045] dCAPS primers were designed to target the aforementioned SNPs. The design results show that the upstream primer introduces the SalI restriction endonuclease site. The specific primer sequences are as follows:

[0046] Forward primer: AGCTAACAAATGTTACACAGAACCGTCGA (SEQ ID No. 3);

[0047] Reverse primer: CTATGTAATGGCCTTGCTAACT (SEQ ID No. 4).

[0048] The primers described above can amplify a 238 bp fragment (SEQ ID No. 1 and SEQ ID No. 2) containing the target SNP. The C allelic variant carries a SalI restriction site and can be cleaved; the T allelic variant does not carry the corresponding restriction site and cannot be cleaved.

[0049] SEQ ID No. 1: AGCTAACAAATGTTACACAGAACCATCGATCGGCCAAGAAGACAGCTAATGGTCTAGCCTAAGCGGATGTGAACTTGGTGATGGCCTTGGTGCCCTCGGTCGAGGTTAACTGAAAGTTACATCTTACTGGGGAAAAGGCGAGCGCTTCGGTCGATGTTAAGGAGGCTGATGGTGGCGGAGCGTGGAAGAATCTGCATGGTCAATGAAGGGAGAACAAGTTAGCAAGGCCATTACATAG.

[0050] SEQ ID No. 2:

[0051] AGCTAACAAATGTTACACAGAACCATCGACCGGCCAAGAAGACAGCTAATGGTCTAGCCTAAGCGGATGTGAACTTGGTGATGGCCTTGGTGCCCTCGGTCGAGGTTAACTGAAAGTTACATCTTACTGGGGAAAAGGCGAGCGCTTCGGTCGATGTTAAGGAGGCTGATGGTGGCGGAGCGTGGAAGAATCTGCATGGTCAATGAAGGGAGAACAAGTTAGCAAGGCCATTACATAG.

[0052] Example 3

[0053] dCAPS molecular marker detection method

[0054] Genomic DNA was extracted from barley leaves using the conventional CTAB method. Using the extracted DNA as a template, PCR amplification was performed using primers shown in SEQ ID NO:3 and SEQ ID NO:4. The PCR reaction system consisted of: 5 μL 2×Taq Master Mix (DyePlus), 0.5 μL each of forward and reverse primers, 1 μL template DNA, and ddH2O to a final volume of 10 μL. The amplification program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 30 cycles; and a final extension at 72℃ for 5 min. The enzyme digestion reaction system consisted of: 2 μL PCR amplification product, 1 μL SalI enzyme, 2 μL 10×H buffer, and ddH2O to a final volume of 20 μL, digested at 37℃ for 1 hour. The digested products were separated by 8% polyacrylamide gel electrophoresis at 160 V for 2 hours, and the bands were observed after silver staining.

[0055] Example 4

[0056] Validation of molecular markers

[0057] Ten barley germplasm accessions with differences in grain uniformity phenotype and genotype were selected from the localized population. The T allele numbers 1-10 were: 91dan2 (0.66), Nongmu48 (0.67), Yan10J-56 (0.68), Zhe96-30 (0.68), Yangxuan11 (0.69), Fengdamai15hao (0.69), Yangnongpi8 (0.69), Rudong6109 (0.69), Kepin4hao (0.69), and Ganmuert. The alleles were: iao (0.77); the C allele types were: Zhe07-6 (0.95), Zhu7 (0.95), Zhudamai7 (1.01), Huadamai5hao (1.01), Baodamai13-J10 (1.05), Hua2 (1.08), Baodamai14-J29 (1.13), Hua8 (1.16), Huadamai7hao (1.17), Hua2328 (1.22). Labelling and typing were performed according to the method in Example 3. The results are as follows... Figure 3 As shown, germplasm with good grain uniformity exhibits a high-banding pattern, while germplasm with poor grain uniformity exhibits a low-banding pattern. These results demonstrate that the dCAPS marker developed in this invention can accurately distinguish between dominant and inferior allelic variations and can be used for marker-assisted selection of barley lines with good grain uniformity.

[0058] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A dCAPS molecular marker associated with barley grain uniformity, characterized in that, The molecular marker is located at 485037030 bp on the 1H chromosome of barley. The base at 485037030 bp is either T or C. For barley with good grain uniformity, the base at 485037030 bp on the 1H chromosome is T, and its nucleotide sequence is shown in SEQ ID No.

1. For barley with poor grain uniformity, the base at 485037030 bp on the 1H chromosome is C, and its nucleotide sequence is shown in SEQ ID No.

2.

2. The primers for the dCAPS molecular marker related to barley grain uniformity according to claim 1, characterized in that, The nucleotide sequence of the primer is as follows: Forward primer: AGCTAACAAATGTTACACAGAACCGTCGA; Reverse primer: CTATGTAATGGCCTTGCTAACT.

3. The application of the dCAPS molecular marker associated with barley grain uniformity as described in claim 1 or the primers as described in claim 2 in the identification of barley grain traits.

4. The application of the molecular dCAPS marker associated with barley grain uniformity as described in claim 1 or the primer as described in claim 2 in the breeding of barley with uniform grains.

5. A method for identifying the uniformity of barley grains, characterized in that, The allelic variant type at chromosome 485037030 bp was detected in the barley DNA sample to be tested.

6. The method for identifying the uniformity of barley grains according to claim 5, characterized in that, The identification method includes: extracting genomic DNA from barley germplasm to be tested; using the extracted barley genomic DNA as a template, performing PCR amplification using the primer pair described in claim 2 to obtain amplification products; digesting the amplification products with the restriction endonuclease SalI; separating the digested products by polyacrylamide gel electrophoresis, and determining the genotype based on the band size.

7. The method for identifying the uniformity of barley grains according to claim 6, characterized in that, If the enzyme digestion product is a long band, it indicates that the allelic variation of the tested barley line at this locus is T, which is a dominant genotype for grain uniformity; if the enzyme digestion product is a short band, it indicates that the allelic variation of the tested barley line at this locus is C, which is a suboptimal genotype for grain uniformity.

8. The method for identifying the uniformity of barley grains according to claim 6, characterized in that, The amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, for a total of 30 cycles; and finally 72℃ extension for 5 min.

9. A method for breeding barley with uniform grain size, characterized in that, Barley DNA was amplified by PCR using the primers described in claim 2, and barley germplasm with a base of T at 485037030 bp on chromosome 1H was selected.

10. A kit for identifying the uniformity of barley grains, characterized in that, The kit contains the primers as described in claim 2.

Images