A molecular marker, primer, detection system and application for identifying "sujun 90" chinese cabbage hybrid

Abstract

The application discloses a molecular marker, a primer, a detection system and an application for identifying a'sujun 90' Chinese cabbage hybrid, develops parent polymorphism KASP primers through double parent resequencing data, combines quick seed germination, DNA extraction and fluorescence detection, and quickly and accurately completes hybrid authenticity and purity identification work.The application has the advantages compared with the prior art that the application uses a whole genome resequencing variation detection method, screens 4 SNP sites different between two parents of'sujun 90', successfully develops corresponding SNP markers and 4 groups of KASP primers, and can quickly distinguish the'sujun 90' Chinese cabbage male parent, female parent and hybrid by using fluorescence detection technology, can be directly used for authenticity identification of the commodity'sujun 90' Chinese cabbage, and further relies on the molecular marker to evaluate true and false hybrid of the commodity.

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology, specifically to molecular markers, primers, detection systems, and applications for identifying the "Sujun 90" non-heading Chinese cabbage hybrid. Background Technology

[0002] Agriculture is the foundation of a nation, and seeds are the foundation of agriculture. Cultivating and producing high-quality seeds is the core task of the seed industry. Seed quality is the lifeblood of seed production and sales, the foundation of seed sales, and a key factor in controlling production risks. Seed purity is the most crucial indicator determining seed quality; seed purity testing is an important part of internal seed quality control and a major quality indicator for market supervision.

[0003] Non-heading Chinese cabbage (Brassica campestris sp. chinensis L.) is a widely cultivated and popular vegetable in my country. Hybrid varieties are widely used in production due to their strong growth, high yield, and good uniformity. Currently, the mainstream methods for identifying the purity and authenticity of vegetable varieties are morphological identification and molecular marker identification. Morphological identification relies on the phenotypic appearance of the plant, but it has drawbacks such as long identification cycle and high manpower input. It is also easily affected by climatic conditions and cultivation management levels, making it difficult to meet the practical needs of rapid variety detection. Traditional molecular marker technology mainly uses SSR molecular markers, and the detection process relies on gel electrophoresis for band interpretation. This process is complex, has low throughput, and is not suitable for large-scale testing of large numbers of samples.

[0004] With the development of genome sequencing technology, SNP markers, due to their large number, wide distribution, and suitability for high-throughput detection, have been recommended by international organizations such as the International Seed Testing Association (ISTA) and the International Union for the Protection of New Varieties of Plants (UPOV) as a method for variety identification at the DNA level. KASP technology, as a mainstream SNP detection platform, has advantages such as moderate throughput, accurate results, and convenient operation. However, a specific SNP marker and rapid purity detection system for the "Sujun 90" non-heading Chinese cabbage variety has not yet been reported.

[0005] "Sujun 90" is a spring- and autumn-type non-heading Chinese cabbage hybrid bred from the self-incompatible lines "KR08-1" and "Y-3". It is characterized by rapid growth, high quality and yield, strong disease resistance, and good marketability, and its application area has been expanding year by year. Establishing a rapid and accurate molecular marker identification system for this variety is of significant practical importance for seed quality internal control, market supervision, and variety rights protection. Summary of the Invention

[0006] The purpose of this invention is to provide molecular markers, primers, detection systems, and applications for identifying the "Sujun 90" non-heading Chinese cabbage hybrid. By developing polymorphic KASP primers for both parents using parental resequencing data, and combining rapid seed germination, DNA extraction, and fluorescence detection, the authenticity and purity of the hybrid can be identified quickly and accurately.

[0007] To solve the above-mentioned technical problems, the technical solution provided by the present invention is: a molecular marker for identifying the "Sujun 90" non-heading Chinese cabbage hybrid, including molecular marker 1, molecular marker 2, molecular marker 3 and molecular marker 4;

[0008] The molecular marker 1 is a T-to-G mutation occurring at position 10014740bp on chromosome A03 of non-heading Chinese cabbage;

[0009] The molecular marker 2 is a T-to-G mutation occurring at position 19659242bp on chromosome A04 of non-heading Chinese cabbage;

[0010] The molecular marker 3 is a G-to-T mutation occurring at position 10315291bp on chromosome A06 of non-heading Chinese cabbage;

[0011] The molecular marker 4 is a T-to-C mutation occurring at position 29231898bp on chromosome A07 of non-heading Chinese cabbage.

[0012] A primer for amplifying the molecular marker used to identify the "Sujun 90" non-heading Chinese cabbage hybrid, wherein the primer consists of four sets of KASP primers, each set containing two allele-specific forward primers and one universal reverse primer, the specific sequences of which are as follows:

[0013]

[0014] Furthermore, each of the allele-specific forward primers is connected to a fluorescent adapter at its 5' end; wherein the forward primer named "-F" is connected to a FAM fluorescent adapter at its 5' end, and the forward primer named "-R" is connected to a HEX fluorescent adapter at its 5' end.

[0015] The nucleotide sequence of the FAM fluorescent linker is: GAAGGTGACCAAGTTCATGCT;

[0016] The nucleotide sequence of the HEX fluorescent linker is: GAAGGTCGGAGTCAACGGATT.

[0017] A molecular marker detection system for identifying the "Sujun 90" non-heading Chinese cabbage hybrid, the molecular marker detection system comprising: the molecular marker and the primer.

[0018] Application of molecular marker detection system in identifying the authenticity or seed purity of the "Sujun 90" non-heading Chinese cabbage variety.

[0019] A detection method for identifying the authenticity of the "Sujun 90" non-heading Chinese cabbage hybrid, wherein the detection method comprises a molecular marker detection system and the detection method includes: using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the four sets of primers described in claim 2, and obtaining amplification products;

[0020] Fluorescence detection of the amplification products showed that samples in which both FAM and HEX fluorescence signals were detected at all four sites were identified as true hybrids.

[0021] Samples in which only a single fluorescent signal is detected at any locus, and the combination of locus signals is consistent with the genotype of the father or mother, are identified as pseudohybrids;

[0022] Samples for which no effective fluorescence signal was detected were identified as other types of hybrids.

[0023] Furthermore, the PCR amplification is Touchdown PCR;

[0024] The Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.

[0025] Furthermore, the pseudo-hybrids include paternal pseudo-hybrids and maternal pseudo-hybrids;

[0026] Samples that showed only HEX fluorescence signals at loci A03_10014740 and A06_10315291, and only FAM fluorescence signals at loci A04_19659242 and A07_29231898, were identified as paternal pseudohybrids, corresponding to the paternal genotype "KR08-1".

[0027] Samples that showed only FAM fluorescence signals at loci A03_10014740 and A06_10315291, and only HEX fluorescence signals at loci A04_19659242 and A07_29231898, were identified as maternal pseudohybrids, corresponding to the maternal "Y-3" genotype.

[0028] A detection method for identifying the purity of the "Sujun 90" non-heading Chinese cabbage hybrid, the detection method being based on the molecular marker detection system, the detection method comprising: performing PCR amplification and fluorescence detection on the genomic DNA of individual plants of the seed population to be tested, and distinguishing between true hybrids and false hybrids according to the judgment criteria described in claim 6;

[0029] The seed purity of the "Sujun 90" non-heading Chinese cabbage hybrid is calculated by the ratio of true hybrids to the total valid samples tested.

[0030] Furthermore, the PCR amplification was Touchdown PCR, and the amplification program was: 94℃ for 15 min; 95℃ for 20 s;

[0031] 65℃-56℃ for 60s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20s; 57℃ for 60s, 26 cycles; and / or, the false hybrids include paternal false hybrids and maternal false hybrids;

[0032] Samples that showed only HEX fluorescence signals at sites A03_10014740 and A06_10315291, and only FAM fluorescence signals at sites A04_19659242 and A07_29231898, were identified as paternal pseudohybrids.

[0033] Samples that showed only FAM fluorescence signals at sites A03_10014740 and A06_10315291, and only HEX fluorescence signals at sites A04_19659242 and A07_29231898, were identified as maternal type pseudohybrids.

[0034] And / or, samples in which both FAM and HEX fluorescence signals are detected simultaneously at all four loci are considered true hybrids, with each locus representing a heterozygous genotype.

[0035] The advantages of this invention compared with the prior art are as follows: This invention uses the whole genome resequencing variation detection method to screen four SNP sites that are different between the two parents of "Sujun 90", and successfully developed the corresponding SNP markers and four sets of KASP primers. Using fluorescence detection technology, the male parent, female parent and hybrid of "Sujun 90" non-heading Chinese cabbage can be quickly distinguished. It can be directly used for the authenticity identification of commercial variety "Sujun 90" non-heading Chinese cabbage, and then the evaluation of true and false hybrids of commercial varieties can be based on this molecular marker.

[0036] This invention enables rapid identification of variety purity at the seed stage using this molecular marker, effectively reducing production losses caused by false hybrids, minimizing seed quality disputes, improving identification efficiency and accuracy, and providing molecular evidence for variety protection. The detection method of this invention can complete seed purity identification within the same day, offering advantages such as speed, low cost, and ease of operation, and has significant application value for quality control by breeders and seed companies. Attached Figure Description

[0037] Figure 1 This is the structural gene typing diagram of the present invention.

[0038] Figure 2 From left to right, the phenotypic diagrams are of the father, mother, and F1 materials. Detailed Implementation

[0039] To further illustrate the present invention, the molecular markers, primers, detection system, and applications for identifying the "Sujun 90" non-heading Chinese cabbage hybrid provided by the present invention are described below in conjunction with the accompanying drawings and embodiments. However, it should be understood that these embodiments are implemented under the premise of the technical solution of the present invention, providing detailed implementation methods and specific operating procedures, and are only for further illustrating the features and advantages of the present invention, not for limiting the scope of the claims of the present invention. The protection scope of the present invention is not limited to the following embodiments.

[0040] Example 1: Obtaining Molecular Markers for the "Sujun 90" Non-Heading Chinese Cabbage Hybrid

[0041] I. Whole-genome resequencing variant detection

[0042] Using the paternal self-incompatible line "KR08-1" and maternal self-incompatible line "Y-3" of "Sujun 90" as materials, whole-genome resequencing and variant analysis were performed to screen for homozygous SNP sites between the parents. After the sequencing data were processed, bioinformatics analysis was performed according to the following procedure.

[0043] Raw data quality control: The raw sequencing data is filtered to obtain CleanData for analysis. The sequencing data filtering steps are as follows: (1) Remove reads containing adapters; (2) Remove reads with more than 3 N; (3) Remove low-quality reads (the number of bases with quality value Q < 5 accounts for more than 20% of the entire read).

[0044] Reference genome alignment: CleanData was aligned with the Chinese cabbage reference genome. BWA software was used to align cleanreads with the reference genome; the initial alignment results were in SAM format, which were then converted to BAM format and sorted using SAMtools software. If a sample's results contained multiple libraries, SAMtools was used to merge the BAM results from multiple libraries, repeat sequences were labeled with picard, and basic data information was statistically analyzed.

[0045] SNP mutation detection: SNPs were detected using GATK software.

[0046] SNP screening: Filter out sites with QUAL values ​​less than 30, MQ values ​​less than 30, and DP values ​​less than 2, and select SNP sites that are homozygous and differentially related to both parents as candidate sites.

[0047] II. Molecular Marker Development

[0048] Based on the differences in sequencing sequences between parents, candidate SNP sites with uniform genomic distribution and conserved flanking sequences were selected. KASP primers were designed using the online primer design software SNPPrimer. Each primer set contained a pair of SNP allele-specific forward primers with different fluorescent adapters and a reverse common primer. One forward primer carried a FAM fluorescent adapter (GAAGGTGACCAAGTTCATGCT), and the other forward primer carried a HEX fluorescent adapter (GAAGGTCGGAGTCAACGGATT). Primer pairs with suitable specificity and annealing temperature were selected. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. Finally, four sets of KASP primers with clear genotypes and good stability were obtained. The primer information is shown in Table 1.

[0049] Table 1 Molecular marker primers and sequences

[0050]

[0051] Example 2: Detection method for identifying the purity of the "Sujun 90" non-heading Chinese cabbage hybrid.

[0052] A detection method for identifying the purity of the "Sujun 90" non-heading Chinese cabbage hybrid variety, the method specifically includes the following steps:

[0053] Using genomic DNA from the sample as a template, Touchdown PCR amplification was performed using the aforementioned molecular marker primers to obtain the amplification products. The Touchdown PCR program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.

[0054] Detection and analysis of the amplification products: If only HEX fluorescence signals are detected at loci A03_10014740 and A06_10315291, and only FAM fluorescence signals are detected at loci A04_19659242 and A07_29231898, corresponding to a homozygous paternal genotype, the sample is identified as a paternal type pseudohybrid; if only FAM fluorescence signals are detected at loci A03_10014740 and A06_10315291, and only HEX fluorescence signals are detected at loci A04_19659242 and A07_29231898, corresponding to a homozygous maternal genotype, the sample is identified as a maternal type pseudohybrid; if both FAM and HEX fluorescence signals are detected at all four loci, corresponding to heterozygous genotypes at each locus, the sample is identified as a true hybrid; if no effective fluorescence signal is detected or the locus combination is inconsistent with the above, the sample is identified as another type of hybrid.

[0055] The purity of non-heading Chinese cabbage hybrid seeds can be calculated by statistically analyzing the percentage of true hybrids in the total tested samples.

[0056] Specific application examples

[0057] Following the methods of Examples 1 and 2, two SNP markers were selected to test 192 samples. The proportion of true hybrids in the submitted samples was calculated based on the SNP marker detection results. Primers were cross-validated; if both primer pairs were heterozygous during F1 testing, the plant was considered a true hybrid. Plants with genotypes identical to the paternal parent or identical to the maternal parent at both loci were identified as paternal or maternal hybrids, respectively. The genotypes and true / false hybrids of the seeds were statistically analyzed; some results are shown in Table 2, and the purity statistics are shown in Table 3. The purity of the samples was 98.44%.

[0058] Table 2 Genotypes and determination of true and false hybrids based on four SNP markers (partial examples)

[0059]

[0060] Table 3 Purity Identification Results

[0061]

[0062] Field planting verification showed that the primers used in this invention have good stability, and the detection results are in good agreement with the field phenotypic identification results, enabling accurate purity identification of non-heading Chinese cabbage hybrid varieties.

[0063] In summary, the molecular marker identification and screening method of this invention can quickly distinguish between paternal and maternal false hybrids and true hybrids in breeding and seed testing, accurately determining the purity of "Sujun 90" non-heading Chinese cabbage seeds. The detection method of this invention can complete seed purity identification within the same day, offering advantages such as speed, low cost, and ease of operation, and has significant application value for quality control by breeders and seed companies.

[0064] The present invention and its embodiments have been described above. This description is not restrictive, and the actual structure is not limited thereto. In conclusion, if those skilled in the art are inspired by this description and, without departing from the spirit of the invention, design similar structures and embodiments without creative effort, all such designs should fall within the protection scope of the present invention.

Claims

1. A molecular marker for identifying the "Sujun 90" non-heading Chinese cabbage hybrid, characterized in that, Including molecular marker 1, molecular marker 2, molecular marker 3 and molecular marker 4; The molecular marker 1 is a T-to-G mutation occurring at position 10014740bp on chromosome A03 of non-heading Chinese cabbage; The molecular marker 2 is a T-to-G mutation occurring at position 19659242bp on chromosome A04 of non-heading Chinese cabbage; The molecular marker 3 is a G-to-T mutation occurring at position 10315291bp on chromosome A06 of non-heading Chinese cabbage; The molecular marker 4 is a T-to-C mutation occurring at position 29231898bp on chromosome A07 of non-heading Chinese cabbage.

2. A primer for amplifying the molecular marker as described in claim 1 for identifying the "Sujun 90" non-heading Chinese cabbage hybrid, characterized in that, The primers consist of four sets of KASP primers, each set containing two allele-specific forward primers and one universal reverse primer, with the specific sequences as follows:

3. The primer according to claim 2, characterized in that, Each of the allele-specific forward primers is connected to a fluorescent adapter at its 5' end; wherein the forward primer named "-F" is connected to a FAM fluorescent adapter at its 5' end, and the forward primer named "-R" is connected to a HEX fluorescent adapter at its 5' end. The nucleotide sequence of the FAM fluorescent linker is: GAAGGTGACCAAGTTCATGCT; The nucleotide sequence of the HEX fluorescent linker is: GAAGGTCGGAGTCAACGGATT.

4. A molecular marker detection system for identifying the "Sujun 90" non-heading Chinese cabbage hybrid, characterized in that, The molecular marker detection system includes: the molecular marker as described in claim 1 and the primer as described in claim 2 or 3.

5. The application of the molecular marker detection system according to claim 4 in identifying the authenticity or seed purity of the "Sujun 90" non-heading Chinese cabbage variety.

6. A detection method for identifying the authenticity of the "Sujun 90" non-heading Chinese cabbage hybrid, characterized in that, The detection method is based on the molecular marker detection system of claim 4, and the detection method includes: using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the four sets of primers described in claim 2, and obtaining amplification products; Fluorescence detection of the amplification products showed that samples in which both FAM and HEX fluorescence signals were detected at all four sites were identified as true hybrids. Samples in which only a single fluorescent signal is detected at any locus, and the combination of locus signals is consistent with the genotype of the father or mother, are identified as pseudohybrids; Samples for which no effective fluorescence signal was detected were identified as other types of hybrids.

7. The detection method for identifying the "Sujun 90" non-heading Chinese cabbage hybrid according to claim 6, characterized in that, The PCR amplification was performed using Touchdown PCR. The Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.

8. The detection method for identifying the "Sujun 90" non-heading Chinese cabbage hybrid according to claim 6, characterized in that, The pseudo-hybrids include paternal pseudo-hybrids and maternal pseudo-hybrids; Samples that showed only HEX fluorescence signals at loci A03_10014740 and A06_10315291, and only FAM fluorescence signals at loci A04_19659242 and A07_29231898, were identified as paternal pseudohybrids, corresponding to the paternal genotype "KR08-1". Samples that showed only FAM fluorescence signals at loci A03_10014740 and A06_10315291, and only HEX fluorescence signals at loci A04_19659242 and A07_29231898, were identified as maternal pseudohybrids, corresponding to the maternal "Y-3" genotype.

9. A method for determining the purity of the "Sujun 90" non-heading Chinese cabbage hybrid, characterized in that, The detection method is based on the molecular marker detection system of claim 4, and the detection method includes: performing PCR amplification and fluorescence detection on the genomic DNA of individual plants of the seed population to be tested, and distinguishing between true hybrids and false hybrids according to the judgment criteria of claim 6; The seed purity of "Sujun 90" non-heading Chinese cabbage hybrid is the ratio of true hybrids to the total valid test samples.

10. The method for detecting the purity of the "Sujun 90" non-heading Chinese cabbage hybrid variety according to claim 9, characterized in that, The PCR amplification was Touchdown PCR, and the amplification program was: 94℃ for 15 min; 95℃ for 20 s. 56℃ for 60s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20s; 57℃ for 60s, 26 cycles; and / or, the false hybrids include paternal false hybrids and maternal false hybrids; Samples that showed only HEX fluorescence signals at sites A03_10014740 and A06_10315291, and only FAM fluorescence signals at sites A04_19659242 and A07_29231898, were identified as paternal pseudohybrids. Samples that showed only FAM fluorescence signals at sites A03_10014740 and A06_10315291, and only HEX fluorescence signals at sites A04_19659242 and A07_29231898, were identified as maternal type pseudohybrids. And / or, samples in which both FAM and HEX fluorescence signals are detected simultaneously at all four loci are considered true hybrids, with each locus representing a heterozygous genotype.

Images