Molecular marker of qmsc.c06-1 significantly associated with methionine selenocysteine content in brassica napus and application thereof

Abstract

The application belongs to the technical field of biology, and discloses a molecular marker of a site significantly related to the content of methionine selenium cysteine of Brassica napus and application qMSC.C06-1 . The applicant identifies a QTL qMSC.C06-1 stably related to the methionine selenium cysteine trait of the oilseed rape, and develops a molecular marker for the key SNP at the peak in the above interval, respectively. The KASP molecular marker provided by the application can be used to efficiently identify the high-methionine selenium cysteine genotype of the oilseed rape, and introduce the same into the corresponding oilseed rape parent for variety improvement, has a remarkable effect in the genetic breeding of the selenium biofortification of the oilseed rape, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker qMSC.C06-1, a site significantly associated with the content of methyl selenocysteine ​​in rapeseed, and its application. Background Technology

[0002] Selenium (Se) is an essential nutrient for humans and animals, and is closely related to bodily health. Selenium deficiency can lead to cardiovascular diseases, Keshan disease, cirrhosis, and other health problems. Dietary selenium supplementation can prevent the occurrence of chronic diseases and plays a key role in the health of the nervous, immune, and reproductive systems.

[0003] Rapeseed (Brassica napu. L.) is one of the world's most important oilseed crops. As a Brassica genus crop in the Brassicaceae family, it has developed a highly active and complex sulfur assimilation and redistribution system during its long evolution, exhibiting a stronger selenium accumulation potential compared to grasses or legumes. In traditional grasses rich in selenium, selenomethionine (SeMet) is accumulated as a "reserve" form of selenium nutrient; however, rapeseed is more likely to form methyl-selenocysteine ​​(MeSeCys) and its derivatives. This organic selenium component has high biological activity and shows superior functional potential in antioxidant regulation, disease prevention, and anti-cancer treatment. As an allotetraploid (AACC) crop, rapeseed possesses high genetic diversity and a complex metabolic network. Achieving selenium enrichment in rapeseed through crop genetic breeding can efficiently realize the high-quality conversion of selenium nutrients from "source-sink-flow".

[0004] The applicant's preliminary phenotypic survey of selenium nutrition-related traits in natural rapeseed populations revealed significant variations in the content of MeSeCys and related traits in the aboveground parts of rapeseed seedlings. Improving the selenium absorption capacity and MeSeCys conversion efficiency of rapeseed can effectively enhance the selenium nutrition level of rapeseed, which is a major direction for selenium biofortification breeding of rapeseed. Summary of the Invention

[0005] The purpose of this invention is to provide the application of molecular markers of MeSeCys-related traits in rapeseed in the screening and breeding of methyl selenocysteine ​​content in rapeseed.

[0006] To achieve the above objectives, the present invention adopts the following technical measures:

[0007] Identification of MeSeCys-related trait QTL loci and development of molecular markers in Brassica napus:

[0008] The applicant screened two samples with significant differences in MeSeCys accumulation under hydroponic conditions from a natural population of Brassica napus through a large-scale phenotypic survey. Two extreme mixed pools of MeSeCys content were constructed for BSA analysis, identifying a specific SNP locus significantly associated with the MeSeCys phenotype, named MSCC06-c. This locus is located at base 46468639 on chromosome C06 of the Brassica napus ZS11.v0 reference genome, representing a T / C mutation with a ΔSNP index of 0.51. Based on KASP primer design principles, allele-specific primers and universal reverse primers were designed around this SNP locus, within 300 bp intervals upstream and downstream:

[0009] MSCC06-c detection primers:

[0010] MSCC06-cR: 5'- GTGTGCTGTTGTATGGACGTGAC-3', as shown in SEQ ID NO.3;

[0011] MSCC06-cF1: 5'- GAAGGTGACCAAGTTCATGCT AGCTTTTTGCATGAAAAGAAAGAT-3', as shown in SEQ ID NO.4, the underlined part is the FAM signal fluorescent probe sequence;

[0012] MSCC06-cF2: 5'- GAAGGTCGGAGTCAACGGATT AGCTTTTTGCATGAAAAGAAAGAC-3', as shown in SEQ ID NO.5, the underlined part is the HEX signal fluorescent probe sequence.

[0013] The scope of protection of this invention includes:

[0014] Application of reagents for detecting base position 46468639 on chromosome C06 of the Brassica napus genome in screening and breeding of methyl selenocysteine ​​content in Brassica napus.

[0015] Application of reagent for detecting base 46468639 on chromosome C06 of the Brassica napus genome in the preparation of a screening kit for methyl selenocysteine ​​content in Brassica napus.

[0016] In the above-described application, if a homozygote is detected with a base of T at position 46468639 on chromosome C06 of the Brassica napus genome, the Brassica napus is determined to have a high content of methylselenocysteine; if a homozygote is detected with a base of C at position 46468639 on chromosome C06 of the Brassica napus genome, the Brassica napus is determined to have a low content of methylselenocysteine.

[0017] In the above-described applications, preferably, the reagent is a primer.

[0018] The primers described above are preferably KASP primers, and more preferably the primers provided by this invention, namely: 5'-GTGTGCTGTTGTATGGACGTGAC-3', as shown in SEQ ID NO.3, 5'- GAAGGTGACCAAGTTCATGCT AGCTTTTTGCATGAAAAGAAAGAT-3', as shown in SEQ ID NO.4 and 5'- GAAGGTCGGAGTCAACGGATT AGCTTTTTGCATGAAAAGAAAGAC-3', as shown in SEQ ID NO.5.

[0019] A method for screening and breeding rapeseed with high methylselenocysteine ​​content includes detecting the 46,468,639th base of chromosome C06 in the rapeseed genome using conventional methods in the art. These conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry. If a homozygous individual is found to have a T base at the 46,468,639th base of chromosome C06 in the rapeseed genome, the rapeseed is determined to have a high methylselenocysteine ​​content; if a homozygous individual is found to have a C base at the 46,468,639th base of chromosome C06 in the rapeseed genome, the rapeseed is determined to have a low methylselenocysteine ​​content.

[0020] The reference genome of rapeseed used in this invention is ZS11.v0.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] (1) This invention developed a molecular marker for the SNP site MSCC06-c, which is closely related to the qMSC.C06-1 site, which is significantly associated with the content of methyl selenocysteine ​​in rapeseed. The detection site is clear and has high specificity.

[0023] (2) The marker provided by the present invention is a codominant marker, which can effectively distinguish between homozygous genotype and heterozygous genotype. It has the advantages of clear typing results, simple operation and suitability for high-throughput detection.

[0024] (3) The molecular markers provided by the present invention have been validated in both the F2 population and the natural population, and can effectively screen for favorable genotypes with high MeSeCys content or a high proportion of total selenium.

[0025] (4) This invention can screen target materials by DNA typing in the early stage of breeding, reduce the workload of hydroponic treatment and HPLC-ICP-MS phenotypic detection, reduce detection costs, shorten the breeding cycle, and improve the screening efficiency of high MeSeCys Brassica napus materials. Attached Figure Description

[0026] Figure 1 Genotyping of the MSCC06-c molecular marker in the F2 population;

[0027] The diagram shows the total selenium content in the aboveground parts of rapeseed of different genotypes. The middle diagram shows the proportion of MeSeCys to the total quantified selenium speciation in rapeseed of different genotypes. The right diagram shows the MeSeCys content in the aboveground parts of rapeseed of different genotypes.

[0028] Figure 2 Genotyping of the MSCC06-c molecular marker pair in a natural population;

[0029] The diagram shows the total selenium content in the aboveground parts of rapeseed of different genotypes. The middle diagram shows the proportion of MeSeCys to the total quantified selenium speciation in rapeseed of different genotypes. The right diagram shows the MeSeCys content in the aboveground parts of rapeseed of different genotypes. Detailed Implementation

[0030] Unless otherwise specified, the experimental methods and conditions in the embodiments of this invention are conventional methods. These embodiments are only for illustrating the present invention, and the scope of protection of the present invention is not limited by these embodiments. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; unless otherwise specified, the reagents or materials are all from commercial sources, and the reference genome of Brassica napus used in this invention is ZS11.v0.

[0031] Example 1:

[0032] Identification of MeSeCys-related trait QTL loci in Brassica napus

[0033] The applicant screened two materials with significant differences in MeSeCys accumulation under hydroponic conditions from a natural population of Brassica napus through large-scale phenotypic surveys: 8S292 with high MeSeCys accumulation and 8S042 with low MeSeCys accumulation. These were hybridized in 2022 to construct an F2 population. From the F2 population, 30 individual plants with extremely high and 30 with extremely low MeSeCys content were selected. Genomic DNA was extracted from the leaves of each material using the CTAB method, and after concentration determination, they were mixed in equal volumes to construct two pools with extreme MeSeCys content for BSA analysis. Using the ZS11.V0 sequence as the reference genome, a total of 2599 significant polymorphic SNPs were identified and retained for subsequent analysis. Based on the pooled ΔSNP method, the locus qMSC.C06-1 (42.83-46.73 Mb region on chromosome C06, with the peak SNP located at 46.26 Mb) closely related to MeSeCys was identified on chromosome C06 of the Brassica napus genome.

[0034] Example 2:

[0035] Design and development of molecular markers in the qMSC.A06-1 region

[0036] Based on the interval location information and F2 single plant genotype and phenotype information in Example 1, a specific SNP locus significantly associated with the MeSeCys phenotype was identified and named MSCC06-c. It is located at the 46468639th base on chromosome C06 of the Brassica napus ZS11.v0 reference genome, and is a T / C mutation with a ΔSNP index value of 0.51.

[0037] Based on the KASP primer design principles, allele-specific primers and universal reverse primers were designed around the 300 bp sequences upstream and downstream of this SNP site, as follows:

[0038] MSCC06-c detection primers:

[0039] MSCC06-cR: 5'-GTGTGCTGTTGTATGGACGTGAC-3', as shown in SEQ ID NO.3;

[0040] MSCC06-cF1: 5'- GAAGGTGACCAAGTTCATGCT AGCTTTTTGCATGAAAAGAAAGAT-3', as shown in SEQ ID NO.4, the underlined part is the FAM signal fluorescent probe sequence;

[0041] MSCC06-cF2: 5'- GAAGGTCGGAGTCAACGGATTAGCTTTTTGCATGAAAAGAAAGAC-3', as shown in SEQ ID NO.5, the underlined part is the HEX signal fluorescent probe sequence.

[0042] The sequence amplified by this primer in rapeseed variety 8S097 (Table 1 in CN113736903B) is as follows:

[0043] AGCTTTTTGCATGAAAAGAAAGA T CACATTTATATATACGCATTAGGCATAGATGCCAATAAATATAGTCACGTCCATACAACAGCACAC, as shown in SEQ ID NO.1;

[0044] The sequence amplified by this primer in rapeseed variety 8S002 (Table 1 in CN113736903B) is as follows:

[0045] AGCTTTTTGCATGAAAAGAAAGA C CACATTTATATATACGCATTAGGCATAGATGCCAATAAATATAGTCACGTCCATACAACAGCACAC, as shown in SEQ ID NO.2.

[0046] Example 3:

[0047] Verification of the effectiveness of the KASP marker obtained in Example 2 in screening breeding of MeSeCys content in Brassica napus:

[0048] KASP marker material selection: The F2 population parents, F1 single plants, and single plants with extreme MeSeCys content in the F2 population from Example 1 were used as validation materials to verify the genotyping effect of the developed molecular marker. The specific experimental steps are as follows:

[0049] (1) Phenotypic investigation of selected materials: All rapeseed plants were subjected to hydroponic treatment with selenite at the five-leaf stage. The concentration of selenite applied was 40 μM. All samples were taken at the five-leaf stage. The aboveground parts of each plant were wrapped with tin foil, frozen quickly in liquid nitrogen, ground into powder, treated with protease, and the total selenium content and MeSeCys content in the samples were determined by HPLC-ICP-MS.

[0050] (2) Extract genomic DNA from the corresponding rapeseed material;

[0051] (3) Using two MeSeCys accumulating extreme parents and F1 as experimental materials, competitive allele-specific PCR (KASP) reaction was performed using the primer set of Example 2;

[0052] (4) The genotypes of the above sites are determined by fluorescence signal analysis. Based on the genotyping of the parents and F1 single plants by the primer set, it is determined whether the primer set can clearly classify the two known homozygous and heterozygous genotypes.

[0053] (5) Determine the phenotypic trait of MeSeCys based on genotype.

[0054] The PCR amplification reaction system consisted of: 2 × KASP PCR mix (5 μL), 10 μmol primer premix (1.4 μL), template DNA (1 μL), and deionized water (2.6 μL). The PCR amplification program was as follows: 95 ℃ pre-denaturation for 10 min; 95 ℃ denaturation for 30 s, 60 ℃ annealing and extension for 40 s, for 10 cycles, with the extension temperature decreasing by 0.6 ℃ per cycle; 95 ℃ denaturation for 20 s, 55 ℃ annealing and extension for 30 s, for 45 cycles; and fluorescence signal acquisition at 37 ℃ for 60 s.

[0055] Results detection and analysis: After the above PCR reaction was completed, fluorescence signals were collected and cluster analysis was performed using the Roche LightCycler® 96 real-time fluorescence PCR instrument.

[0056] The identification results of the MSCC06-c molecular marker in the qMSC.C06-1 interval showed that MSCC06-c successfully divided the parent with extremely high MeSeCys content (homozygous TT type), the parent with extremely low MeSeCys content (homozygous CC type), and the F1 single plant (heterozygous TC type) into three groups.

[0057] Example 4:

[0058] Application of MSCC06-c molecular marker in screening breeding of MeSeCys content in F2 population materials

[0059] Material selection and phenotypic identification: 50 plants with extremely high MeSeCys content and 50 plants with extremely low content were selected from the F2 population. The total selenium content, the ratio of MeSeCys content to total selenium content, and the total MeSeCys content were investigated according to the phenotypic investigation method in Example 3.

[0060] Genotyping: The above materials were genotyped using the molecular marker primers developed in Example 2, following the method in Example 3.

[0061] KASP test results and analysis: (e.g., ...) Figure 1 As shown in Table 1, the molecular markers developed in this invention can effectively distinguish MeSeCys-related traits in the F2 population. Specific results are as follows: Figure 1As shown, in the F2 population, compared with the low MeSeCys genotype (CC genotype), the high MeSeCys genotype material (TT genotype) screened using MSCC06-c had significantly higher total selenium content, the ratio of MeSeCys content to total selenium content, and MeSeCys content. Figure 1 ).

[0062] Table 1 Screening of MeSeCys content in F2 population materials using MSCC06-c

[0063] .

[0064] Example 5:

[0065] Application of MSCC06-c in MeSeCys content screening breeding of natural population materials of Brassica napus

[0066] A natural population consisting of 349 Brassica napus germplasm resources was selected and hydroponic experiments and phenotypic identification were conducted according to the method described in Example 3. The investigated traits included the content of methyl selenocysteine ​​(MSC) in the aboveground parts, the proportion of MSC to the total content of the five selenium forms (RMT), and the proportion of MSC to the total organic selenium content (RMO). In this example, the total content of the five selenium forms refers to the sum of the contents of the five selenium forms obtained by HPLC detection, and is not equivalent to the total selenium content of the sample determined by independent methods.

[0067] Genomic DNA was extracted from each material in the above natural population. Genotyping was performed using the MSCC06-c molecular marker primers described in Example 2, following the reaction system, amplification procedure, and fluorescence signal interpretation method described in Example 3. Materials with the NA genotype, Other genotype, and H genotype were excluded. One-way ANOVA was used to compare the phenotypic differences between the TT and CC genotypes. The results are as follows: Figure 2 As shown.

[0068] Among the materials with valid genotype identification results, 81 were of the TT genotype and 201 were of the CC genotype. Phenotypic statistics showed that the average total selenium content of the five selenium forms in the aerial parts of the TT genotype materials was 2590.33 μg·kg⁻¹. -1 The average value of CC genotype materials was 2530.22 μg·kg⁻¹. -1 The difference between the two groups did not reach a statistically significant level (P = 0.412). For the RMT trait, the mean value for the TT genotype was 25.20%, and the mean value for the CC genotype was 22.00%; the RMT of the TT genotype was significantly higher than that of the CC genotype (P = 0.003). The mean value of MSCs in the aboveground parts of the TT genotype was 501.24 μg·kg⁻¹.-1 The average value of CC genotype materials was 413.89 μg·kg⁻¹. -1 The average MSC value of the TT genotype material was significantly higher than that of the CC genotype material (P = 0.004).

[0069] The above results indicate that different genotypes of the MSCC06-c marker are significantly associated with the aboveground RMT trait in Brassica napus, with the CC genotype being a favorable genotype for improving RMT. Therefore, the MSCC06-c molecular marker can be used alone to identify the genotype of natural Brassica napus populations, with priority given to CC genotype materials for screening germplasm resources with high methylselenocysteine ​​content and for marker-assisted breeding of related traits. To visually demonstrate the selection effect of the MSCC06-c molecular marker on natural population materials, 40 materials from the two genotypes mentioned above were selected for presentation. Their phenotypic and genotypic data are listed in Table 2. In Table 2, NA represents missing data, and MSC represents the aboveground methylselenocysteine ​​content (μg·kg⁻¹). -1 TSe represents the total content of the five selenium forms in the aboveground parts (μg·kg⁻¹). -1 RMT represents the percentage (%) of methylselenocysteine ​​content relative to the total content of the five selenium forms.

[0070] Table 2. Partial typing data of MSCC06-c molecular markers for 349 natural populations of Brassica napus.

[0071] .

[0072] The above results show that the qMSC.C06-1 region KASP molecular marker developed in this invention can identify major haplotypes with significantly different MSC contents in Brassica napus-related populations with different genetic backgrounds, and can be used for auxiliary screening of high MSC materials. For materials with other types or missing morphologies, core marker retesting and phenotypic identification can be combined to improve the accuracy of actual breeding selection. The above description is only a specific embodiment of the present invention, and the scope of protection of the present invention is not limited thereto. Any changes or substitutions made by those skilled in the art within the scope of the technology disclosed in the present invention should be covered within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. Application of a reagent for detecting the 46,468,639th base of chromosome C06 in the rapeseed genome in the screening breeding of methylselenocysteine ​​content in rapeseed, wherein the rapeseed genome is ZS11.v0. If a homozygous individual is found to have a T base at the 46,468,639th base of chromosome C06 in the rapeseed genome, the rapeseed is determined to have a high methylselenocysteine ​​content. If a homozygous individual is found to have a C base at the 46,468,639th base of chromosome C06 in the rapeseed genome, the rapeseed is determined to have a low methylselenocysteine ​​content.

2. Application of a reagent for detecting the 46468639th base of chromosome C06 in the Brassica napus genome in the preparation of a screening kit for methylselenocysteine ​​content in Brassica napus, wherein the Brassica napus genome is ZS11.v0. If a homozygous individual is found to have a T base at the 46468639th base of chromosome C06 in the Brassica napus genome, the Brassica napus is determined to have a high methylselenocysteine ​​content. If a homozygous individual is found to have a C base at the 46468639th base of chromosome C06 in the Brassica napus genome, the Brassica napus is determined to have a low methylselenocysteine ​​content.

3. The application according to claim 1 or 2, wherein the reagent is a primer.

4. The application according to claim 3, wherein the primers are: 5'-GTGTGCTGTTGTATGGACGTGAC-3', 5'-GAAGGTGACCAAGTTCATGCTAGCTTTTTGCATGAAAAGAAAGAT-3' and 5'-GAAGGTCGGAGTCAACGGATTAGCTTTTTGCATGAAAAGAAAGAC-3'.

5. A method for screening and breeding of methylselenocysteine ​​content in Brassica napus, comprising detecting the 4242981st base of chromosome A06 of the Brassica napus genome, wherein the detection method is: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry. If a homozygous individual is found to have a T base at the 46468639th base of chromosome C06 of the Brassica napus genome, the Brassica napus is determined to have a high methylselenocysteine ​​content; if a homozygous individual is found to have a C base at the 46468639th base of chromosome C06 of the Brassica napus genome, the Brassica napus is determined to have a low methylselenocysteine ​​content.

Images