Molecular marker linked to cotton drought resistance locus qdr-d02 and application

Abstract

The application discloses a molecular marker linked with a cotton drought resistance locus qDR-D02 and application thereof, and belongs to the technical field of molecular markers. The molecular marker is SNP-66947160 and SNP-67170798. The application takes drought-resistant and drought-sensitive upland cotton strains "Su Zhi 2175" and "Su Zhi 2261" as parents, constructs a separation population, identifies a drought-resistant candidate interval on a D02 chromosome of cotton through a BSA-seq method, uses a homozygous strain carrying the drought-resistant candidate locus in the population to construct a secondary separation population with "Su Zhi 2261", and finely locates the drought-resistant locus qDR-D02 between 66947160-67170798 of the D02 chromosome through substitution mapping. Through marker-assisted selection, the qDR-D02 is transgenically introduced into six upland cotton varieties that have been approved, and the drought resistance identification result shows that the drought resistance of the upland cotton varieties carrying the qDR-D02 locus is significantly higher than that of the upland cotton varieties not carrying the qDR-D02 locus. The drought-resistant locus and the linked marker disclosed by the application can be applied to cotton drought resistance marker-assisted breeding, and the cotton drought resistance breeding process can be accelerated.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to molecular markers linked to the cotton drought resistance site qDR-D02 and their applications. Background Technology

[0002] Drought stress is one of the most significant abiotic stresses in agricultural production. Improving water resource utilization by breeding and promoting high-quality, high-yield, drought-resistant cotton varieties is the most economical and effective way to mitigate the impact of drought on cotton production. Traditional breeding methods for developing drought-resistant varieties suitable for production are time-consuming and inefficient. Therefore, screening and creating new drought-resistant cotton germplasm, deeply analyzing the genetic mechanisms of cotton drought resistance, and aggregating drought-resistant loci through molecular marker-assisted selection will be one of the important directions for future cotton drought-resistant breeding.

[0003] Domestic and international cotton breeders have conducted extensive and effective work to improve cotton drought resistance, and have now formed a systematic research chain encompassing "resource identification - genetic mapping - locus aggregation - variety breeding." Evaluating the drought resistance of cotton germplasm resources and screening drought-resistant materials from existing cotton varieties (lines) is fundamental to rapidly and efficiently elucidating the genetic mechanisms of cotton drought resistance and breeding high-quality drought-resistant cotton varieties. Early drought resistance identification relied heavily on single morphological indicators. In recent years, different breeders have constructed multi-indicator comprehensive evaluation systems to evaluate the drought resistance of existing germplasm resources at the germination, seedling, and boll-forming stages, screening out multiple materials with different levels of drought resistance. This provides a material basis for locating cotton drought resistance loci and elucidating drought resistance mechanisms.

[0004] Clarifying the genetic basis of drought resistance hinges on locating the genetic loci controlling this trait. In recent years, a series of drought resistance loci have been successfully identified in cotton, providing crucial guidance for elucidating the genetic mechanisms of drought resistance and improving breeding practices. For example, based on previously located drought resistance QTL intervals, researchers developed 22 KASP markers and validated them in 502 core germplasm accessions. Phenotype-genotype association analysis identified 10 significantly associated markers, with the selection accuracy of markers "22079" and "22089" exceeding 85%. Specific haplotypes such as "Hap8" even achieved 100% accuracy in identifying drought-resistant germplasm. As of 2017, meta-analysis has yielded 248 drought resistance QTLs distributed across 26 cotton chromosomes. It is noteworthy that among the 248 drought-resistance-related QTLs reported, only 9 chromosomes contain drought-resistance QTL hotspot regions, comprising 49 QTLs, approximately 19.75% of the total reported QTLs. Furthermore, these drought-resistance-related hotspot regions are associated with different evaluation indicators for drought resistance identification. These results indicate that drought resistance is a complex quantitative trait regulated by multiple genes, and its outcome is influenced by multiple factors, including genetic population, stress intensity, evaluation indicators, and statistical methods. Future research should focus on standardizing indoor and field drought resistance identification criteria based on practical production needs, screening core drought resistance indicators, and determining drought resistance standards. Multi-environment and multi-phenotype validation should be conducted to confirm the stability and breeding value of drought-resistance loci. Simultaneously, fine mapping should be used to develop tightly linked molecular markers to provide molecular markers for subsequent marker-assisted transfer of drought-resistance loci. Summary of the Invention

[0005] One of the objectives of this invention is to provide a cotton drought-resistant site qDR-D02.

[0006] Another objective of this invention is to provide a molecular marker that is closely linked to the cotton drought resistance site qDR-D02.

[0007] Another objective of this invention is to provide an application of the drought resistance locus qDR-D02 and its closely linked molecular markers in marker-assisted breeding for drought resistance in cotton.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: Molecular markers linked to the cotton drought resistance locus qDR-D02, located on the cotton D02 chromosome, and SNP-66947160 and SNP-67170798 linked to the cotton drought resistance locus qDR-D02. The nucleotide sequence of the molecular marker SNP-66947160 is shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the sequences of SEQ ID NO.1 and SEQ ID NO.2 differ in bases A and G at position 51. The nucleotide sequence of the molecular marker SNP-67170798 is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the sequences of SEQ ID NO.3 and SEQ ID NO.4 differ in bases T and A at position 51.

[0009] The primer sets for amplifying the molecular marker SNP-66947160 are as follows: SNP-66947160-F1: GAAGGTGACCAAGTTCATGCTcagaaaatgggcaaactggttcttG (SEQ IDNO.5); SNP-66947160-F2: GAAGGTCGGAGTCAACGGATTcagaaaatgggcaaactggttcttA (SEQ IDNO.6); SNP-66947160-R: CAAAAAGTATCGATTTGCTCTTTAATC (SEQ ID NO.7); The primer sets corresponding to the molecular marker SNP-67170798 are as follows: SNP-67170798-F1: GAAGGTGACCAAGTTCATGCTggatgcatgttcaaattgtaagaA (SEQ IDNO.8); SNP-67170798-F2:GAAGGTCGGAGTCAACGGATTggatgcatgttcaaattgtaagaT (SEQ IDNO.9); SNP-67170798-R: CAATAACCTCATCTTTTTTCTCCC (SEQ ID NO. 10).

[0010] Add universal fluorescent tags to the 5' end of the primers: F1 (FAM): GAAGGTGACCAAGTTCATGCT, F2 (HEX): GAAGGTCGGAGTCAACGGATT.

[0011] In addition to the molecular markers mentioned above, reagents, kits, or gene chips containing the aforementioned molecular marker primer pairs also fall within the scope of protection of this invention.

[0012] The primary objective of this invention is to provide applications of the aforementioned molecular markers or reagents, kits, or gene chips containing the aforementioned molecular marker primer pairs, wherein the applications include at least one of the following: (1) Application in molecular marker-assisted breeding for drought resistance in cotton; (2) Application in the improvement of drought-resistant cotton germplasm resources; (3) Application in the identification or screening of drought resistance traits in cotton.

[0013] Based on the above applications, this invention provides a method for transferring drought resistance traits in cotton using the aforementioned molecular markers, comprising: extracting genomic DNA from the transferred progeny material, detecting the genotypes of the two SNP molecular markers, and showing that the drought resistance of the transferred progeny material with the genotype AA / TT is significantly higher than that of individuals with the genotype GG / AA. That is, the drought resistance of the transferred progeny material with SNP-66947160 being AA and SNP-67170798 being TT is significantly higher than that of individuals with SNP-66947160 being GG and SNP-67170798 being AA.

[0014] More specifically, SNP-66947160 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2, and this position exhibits a base polymorphism A / G, with a genotype of AA in drought-resistant materials and a genotype of GG in drought-susceptible materials; SNP-67170798 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4, and this position exhibits a base polymorphism T / A, with a genotype of TT in drought-resistant materials and a genotype of AA in drought-susceptible materials.

[0015] Advantages of this invention: 1. This invention provides a cotton drought resistance locus qDR-D02, which can significantly improve the drought resistance of cotton. Therefore, the qDR-D02 locus can be applied to molecular breeding for cotton drought resistance.

[0016] 2. This invention provides an SNP molecular marker linked to the cotton drought resistance site qDR-D02 and its primer sequence, which can be used to select and transfer this drought resistance site through molecular marker-assisted selection, which can significantly improve the selection efficiency and breeding speed of cotton drought resistance breeding. Attached Figure Description

[0017] Figure 1This study examines the mortality rate and various physiological parameters of the drought-resistant parent SZ2175 (SZ2175) and the drought-sensitive parent SZ2261 (SZ2261) after drought stress. A and B: Phenotypes of the drought-resistant parent SZ2175 and the drought-sensitive parent SZ2261 7 days after drought simulated stress treatment; CG: Represent the proline (PRO) content, superoxide dismutase (SOD) activity, peroxidase (POD) activity, soluble sugar (SS) content, and malondialdehyde (MDA) content of the drought-resistant parent SZ2175 and the drought-sensitive parent SZ2261 7 days after drought simulated stress treatment, respectively.

[0018] Figure 2 This is the KASP typing diagram for SNP molecular markers SNP-66947160 and SNP-67170798. The horizontal axis shows a higher proportion of FAM fluorescence, indicating homozygous type 1 (blue); the vertical axis shows a higher proportion of HEX fluorescence, indicating homozygous type 2 (green); the middle region shows an equal proportion of both fluorescence types, indicating heterozygous type (red).

[0019] Figure 3 This is the location result of the qDR-D02 site in the segregating population.

[0020] Figure 4 This study analyzes the drought resistance of different varieties carrying the qDR-D02 locus. Detailed Implementation

[0021] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0022] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0024] 1. Segregating populations were constructed using the infiltrated line progeny of *Gossypium rayonum*, Suzi 2175 (SZ2175) and Suzi 2261 (SZ2261), which showed significant differences in drought stress. The drought-resistant parent SZ2175 had a mortality rate of 0 after 20 days of PEG drought simulation, while the drought-sensitive parent SZ2261 had a mortality rate of 93.3% after the same period. On day 7 after PEG drought stress treatment, growth was inhibited in both the resistant and sensitive parents. The cotyledons of the resistant parent SZ2175 showed slight wilting, while the cotyledons of the sensitive parent SZ2261 began to yellow and fall off, and the edges of the true leaves showed signs of drying. Simultaneously, the contents of proline (PRO), malondialdehyde (MDA), and soluble sugar (SS), as well as the activities of superoxide dismutase (SOD) and peroxidase (POD) were measured after drought stress on both parents. The results showed that, compared to the control group, the drought-resistant parent SZ2175, after drought treatment, exhibited 14.6, 6.4, and 1.4-fold increases in PRO, SS, and MDA contents, respectively, and 2.0 and 2.1-fold increases in POD and SOD activities, respectively. In contrast, the drought-sensitive parent SZ2261, after treatment, showed 1.5, 1.9, and 4.8-fold increases in PRO, SS, and MDA contents, respectively, and 1.2 and 0.8-fold increases in POD and SOD activities, respectively, compared to the control group. Figure 1 ).

[0025] 2. An F2 population was planted, producing 244 individual plants. Young leaves from these F2 plants were collected, and DNA was extracted using the CTAB method for later use. The 244 individual plants were then self-pollinated to produce 244 F2 cells. 2:3 strains.

[0026] 3. For 244 F 2:3 The strains were subjected to indoor PEG drought stress, and 244 F1 strains were also subjected to [further testing]. 2:3 The plant height, number of fruiting branches, number of bolls per plant, and weight of a single boll were investigated in the drought-stressed and control areas of the family.

[0027] (1) The indoor drought resistance assessment method is as follows: Weigh 50g of seedling substrate and fill it into a paper cup with holes at the bottom (upper diameter 7cm, lower diameter 5cm, height 5.8cm). Select parent lines and F1 seedlings. 2:3 Plump cotton seeds were soaked in water for 24 hours to promote germination before sowing, one seed per cup. Three replicates were used, with at least 15 seedlings per replicate for identification. Once the seedlings reached the two-leaf stage, they were irrigated with 50 mL of 25% PEG-6000 solution per cup to simulate drought stress, with water treatment serving as a control. Plant growth was assessed 20 days after treatment.

[0028] (2) The field drought resistance assessment method was as follows: Before sowing, the experimental area was divided into a drought stress area and a control area, with a 3m isolation zone in between. Both areas were planted using a single film with four rows per planting. Each F 2:3 Plant two rows of family lines, with 30 F plants per row. 2:3 Family pedigrees were planted in two rows each of resistant and susceptible parents. The pedigrees were randomly arranged with three replicates, and the plot size was 0.9 m². 2 The rows were 3m long, using a wide-narrow row planting pattern with a row spacing of 0.66m for the wide rows and 0.1m for the narrow rows, and a plant spacing of 0.11m. Two protective films were installed along the edge of the dry pond, and drip irrigation was used under the films. The control group was first watered on June 20th, and watered every 7-10 days. The drought-stressed group was not watered; when the soil moisture content reached 3%, it was subjected to continuous stress for 20 days before re-watering. During the boll-forming stage, the F1 generation in the drought-stressed area and the control area was compared. 2:3 Traits such as plant height, number of fruiting branches, and number of bolls per plant were investigated. Thirty bolls were harvested after the first boll opening, and the weight of each boll was measured. Based on the investigation of different traits, the relative stress rate was calculated using the following formula: Relative stress rate (%) = (control trait - stress trait) ÷ control trait × 100%.

[0029] 4. According to F 2:3 To investigate mortality rates after PEG drought stress in the laboratory and related phenotypes after drought resistance in the field, 30 lines exhibiting extreme resistance and susceptibility to drought were selected. The DNA of their corresponding F2 individual plants was mixed to form a pool of extremely resistant and extremely susceptible DNA. This pool, along with the DNA of the parents Suzi 2175 and Suzi 2261, was used for genome resequencing. Using BSA-seq, three cotton drought resistance loci were detected at Chr. A09: 3,149,395-3,325,207 (0.18 Mbp), Chr. A09: 63,854,509-63,934,359 (0.08 Mbp), and Chr. D02: 65,690,036-68,304,287 (2.61 Mbp) (Table 1). Analysis of the resequencing results indicated that the drought resistance candidate locus at Chr. D02 originated from the introgression of *Gossypium Raymondii*. For each candidate region, 1, 1, and 5 pairs of molecular markers were developed for the genome resequencing data (Table 2).

[0030] 5. Using seven pairs of molecular markers, the genotypes of individual plants in the F2 segregating population generated from the cross between Suzi 2175 and Suzi 2261 were detected. Individual plants containing only the Chr.D02 drought-resistance candidate locus were screened. These plants were then used to construct a secondary F2 segregating population with the drought-susceptible parent Suzi 2261. Using five pairs of molecular markers developed on the Chr.D02 drought-resistance candidate locus, the genotypes of 637 individual plants in the F2 secondary segregating population were detected, and exchangeable plants were screened. After self-pollination, the exchanged plants were used to obtain the F2 generation. 2:3Strains. Drought stress was simulated indoors using a 25% PEG-6000 solution to identify exchanged single plants (F1). 2:3 Drought resistance of the strain. This is determined by combining the genotypes of F2 exchanged individual plants and the F2 exchanged individual plants. 2:3 Drought resistance of strains was assessed by locating the candidate drought resistance site of Chr.D02 between SNP molecular markers SNP-66947160 and SNP-67170798. Figure 2 The distance between markers was 218 kb, and this site was named qDR-D02. Figure 3 ).

[0031] Table 1. Information on drought resistance sites located by BSA-seq

[0032] Table 2 Primer sequence information

[0033] 6. Select F2 single plant DR086 carrying the homozygous qDR-D02 locus as the female parent and cross it with six approved cotton varieties, namely Suji Mian 211, Xinluzao 50, Xinluzao 57, Tahe No. 2, Lumianyan 37, and Zhongmian 113. Use the F1 generation as the female parent and the six approved cotton varieties as the male parent for backcrossing. Use the SNP molecular markers SNP-66947160 and SNP-67170798 linked to the qDR-D02 locus for genotyping in the backcross progeny. Select single plants carrying the qDR-D02 locus and backcross them again. Repeat the backcrossing for 4 generations and self-cross for 1 generation to obtain near-isogenic lines with different genetic backgrounds and carrying the homozygous qDR-D02 locus. Indoor PEG simulation of drought stress showed that when the genotypes of two SNP loci were the same as those of Suzi 2175 (AA / TT), the near-isogenic line exhibited better drought resistance; when these two SNP loci were the same as those of Suzi 2261 (GG / AA), the near-isogenic line exhibited poorer drought resistance. Figure 4 This indicates that the SNP markers (SNP-66947160 and SNP-67170798) within the qDR-D02 region are significantly effective in transforming the qDR-D02 drought-resistant sites.

[0034] In this invention, qDR-D02 can be labeled using two SNP markers, SNP-66947160 and SNP-67170798, with primer sequences for detecting the two sites shown in Table 2. SNP-66947160 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2, exhibiting a base polymorphism A / G. In the drought-resistant material Suzi 2175, the genotype is AA, and in the drought-susceptible material Suzi 2261, the genotype is GG. SNP-67170798 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4, exhibiting a base polymorphism T / A. In the drought-resistant material Suzi 2175, the genotype is TT, and in the drought-susceptible material Suzi 2261, the genotype is AA.

[0035] The sequences of SEQ ID NO.1 to NO.4 are as follows: SEQ ID NO.1:ATTGATTATTTTTGCTATCTCATAAAAAAATAACATTGGTCGTATATATT A GAGTAACTTGAAAAAATATATGACAAGTTCAAGTACCAAATCGAATAAAA; SEQ ID NO.2: ATTGATTATTTTTGCTATCTCATAAAAAAATAACATTGGTCGTATATATT G GAGTAACTTGAAAAAATATATGACAAGTTCAAGTACCAAATCGAATAAAA; SEQ ID NO.3: TGACGTTAGCCTTGGCATGCAATAATCGGATGCATGTTCAAATTGTAAGA A GGTAATGGGAGAAAAAAGATGAGGTTATTGTACTCTTCTTTGAATTTGTT; SEQ ID NO.4: TGACGTTAGCCTTGGCATGCAATAATCGGATGCATGTTCAAATTGTAAGA T GGTAATGGGAGAAAAAAGATGAGGTTATTGTACTCTTCTTTGAATTTGTT.

[0036] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker linked to the cotton drought resistance site qDR-D02, characterized in that, The drought-resistant locus qDR-D02 is located on the cotton D02 chromosome, and the molecular markers linked to the cotton drought-resistant locus qDR-D02 are SNP-66947160 and SNP-67170798. The nucleotide sequence of the molecular marker SNP-66947160 is shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleotide sequence of the molecular marker SNP-67170798 is shown in SEQ ID NO.3 or SEQ ID NO.

4.

2. The molecular marker according to claim 1, characterized in that, SNP-66947160 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.

2. This position exhibits a base polymorphism A / G, with the genotype AA in drought-resistant materials and GG in drought-susceptible materials. SNP-67170798 is located at position 51 of the nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.

4. This position exhibits a base polymorphism T / A, with the genotype TT in drought-resistant materials and AA in drought-susceptible materials.

3. A primer set for amplifying the molecular marker of claim 1, characterized in that, The primer set corresponding to the molecular marker SNP-66947160 includes: SNP-66947160-F1: GAAGGTGACCAAGTTCATGCTcagaaaatgggcaaactggttcttG; SNP-66947160-F2:GAAGGTCGGAGTCAACGGATTcagaaaatgggcaaactggttcttA; SNP-66947160-R: CAAAAAGTATCGATTTGCTCTTTAATC; The primer set corresponding to the molecular marker SNP-67170798 includes: SNP-67170798-F1: GAAGGTGACCAAGTTCATGCTggatgcatgttcaaattgtaagaA; SNP-67170798-F2:GAAGGTCGGAGTCAACGGATTggatgcatgttcaaattgtaagaT; SNP-67170798-R: CAATAACCTCATCTTTTTTCCC.

4. A reagent, kit, or gene chip containing the molecular marker primer set of claim 3.

5. The application of the molecular marker of claim 1 or the reagent, kit, or gene chip of claim 4, characterized in that, The application includes at least one of the following: (1) Application in molecular marker-assisted breeding for drought resistance in cotton; (2) Application in the improvement of drought-resistant cotton germplasm resources; (3) Application in the identification or screening of drought resistance traits in cotton.

6. A method for using molecular marker-assisted transfer of drought resistance traits in cotton according to claim 1, characterized in that, Genomic DNA was extracted from the cotton materials to be tested. KASP molecular markers were designed using the PARMS SNP genotyping principle. The genotypes of SNP-66947160 and SNP-67170798 loci were detected using the primer set of the molecular markers described in claim 3. Among them, the offspring of the transgenic materials with SNP-66947160 being AA and SNP-67170798 being TT showed significantly higher drought resistance than individuals with SNP-66947160 being GG and SNP-67170798 being AA.

7. The method according to claim 6, characterized in that, It also includes screening to obtain cotton plants, seeds, or their offspring carrying homozygous qDR-D02 drought-resistant loci.

Images