SNP molecular marker combination for identifying drought tolerance of haloxylon ammodendron and application thereof

Abstract

The application discloses a SNP molecular marker combination for identifying drought resistance of Haloxylon ammodendron and application thereof, and belongs to the technical field of molecular biology and plant breeding. The application first reports the SNP molecular marker combination related to the drought resistance of Haloxylon ammodendron, wherein the SNP molecular marker combination is composed of SNPs 1, 2 and 3 with nucleotide sequences shown in SEQ ID NO. 1-3 in sequence. The three SNP combinations can fully exert the synergistic complementary effect, and significantly improve the accuracy and reliability of identification. The application further provides a primer combination and a detection method for detecting the above SNP molecular marker combination, so that the drought resistance of Haloxylon ammodendron can be rapidly identified, and the SNP molecular marker combination is used for Haloxylon ammodendron germplasm resource evaluation, drought-resistant line screening and molecular assisted breeding, and has important application value for desertification control and sand prevention and control.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and plant breeding technology, and in particular to a combination of SNP molecular markers for identifying drought resistance in Haloxylon ammodendron and its application. Background Technology

[0002] Haloxylon ammodendron ( Haloxylon ammodendron Haloxylon ammodendron (Haloxylon) is a perennial shrub belonging to the genus Haloxylon in the family Amaranthaceae. Distributed in arid and semi-arid desert regions, it is a pioneer tree species for desertification control and sand prevention. Haloxylon ammodendron possesses extremely strong drought resistance, salt tolerance, and tolerance to poor soil conditions, enabling it to grow normally in extremely arid environments with annual precipitation less than 200 mm and evaporation exceeding 3000 mm. It has significant ecological value in maintaining the stability of desert ecosystems and preventing land degradation.

[0003] However, Haloxylon ammodendron is often subjected to varying degrees of drought stress during artificial afforestation and natural regeneration, resulting in low seedling survival rates and stunted growth, which severely restricts the effectiveness of Haloxylon ammodendron afforestation and desertification control. Therefore, screening and cultivating drought-resistant Haloxylon ammodendron varieties is of great significance for improving afforestation success rates and accelerating the process of desertification control.

[0004] Plant drought tolerance is a complex quantitative trait controlled by multiple genes, involving multiple physiological and biochemical pathways such as stomatal regulation, osmotic regulation, reactive oxygen species scavenging, protein homeostasis maintenance, and cytoskeleton remodeling. Traditional drought tolerance identification mainly relies on field phenotypic observation or drought stress treatment experiments, which are time-consuming, inefficient, and easily affected by environmental factors. Utilizing DNA molecular markers for drought tolerance identification and molecular-assisted breeding can shorten the breeding cycle and improve selection efficiency, making it an important tool in modern breeding.

[0005] With the development of high-throughput sequencing technology, although massive amounts of SNP data can be obtained, accurately screening functional markers truly linked to drought resistance traits from millions of variant sites remains a significant challenge. Existing conventional screening methods have obvious limitations: relying solely on differential transcriptome expression analysis (RNA-seq) often only identifies genes with varying expression levels, failing to directly pinpoint the genetic variant sites causing phenotypic differences, and is prone to including numerous environment-induced false-positive genes. While genome-wide association studies (GWAS) can locate sites, they require constructing large natural populations and conducting multi-year, multi-location phenotypic identification, resulting in long cycles, high costs, and limited detection capabilities for minor sites. Currently, there are no reports of using a dual strategy combining weighted co-expression network analysis (WGCNA) with population differentiation index (FST), and further cross-validating across multiple consecutive drought gradients, to develop drought-resistant SNP markers for Haloxylon ammodendron. Therefore, developing an efficient and accurate screening strategy to mine core drought-resistant key genes and their SNP markers from massive amounts of redundant data has significant scientific and application value.

[0006] It is particularly noteworthy that there is a clear technological inertia in the field of plant drought resistance gene discovery. Current technologies, when searching for drought resistance genes, typically focus on classic gene families directly related to water sensing and osmotic balance, such as dehydration response element-binding proteins (DREB / CBF), late embryogenesis abundant proteins (LEA), dehydrin, aquaporin, abscisic acid (ABA) synthesis and signaling pathways (e.g., NCED, PYR / PYL / RCAR, SnRK2), and osmotic regulator synthases. Meanwhile, heat shock protein 60 (HSP60 / GroEL, K04077), as a mitochondrial molecular chaperone protein, has long been recognized by those skilled in the art as primarily responding to heat stress and participating in protein folding and mitochondrial protein homeostasis; and ABL-interacting protein-like 5 (ABIL5), as a constituent subunit of the WAVE / SCAR complex, is generally considered to be primarily involved in actin cytoskeleton remodeling and morphogenesis of epidermal cells, root hairs, etc. To date, there are few reports on SNP sites within the HSP60 family genes or the ABIL5 gene and its regulatory regions directly governing the long-term drought adaptation of desert plants. Therefore, in the absence of specific guidelines, it is difficult for those skilled in the art to foresee that the coding region of the HSP60 gene, the flanking regulatory region of the ABIL5 gene, and an SNP site within a gene whose function has not been identified could collectively serve as a key molecular marker combination for identifying plant drought tolerance. Summary of the Invention

[0007] The purpose of this invention is to provide a combination of SNP molecular markers for identifying the drought resistance of Haloxylon ammodendron and its application, so as to solve the problems existing in the prior art. The SNP molecular marker combination can be used for the evaluation of Haloxylon ammodendron germplasm resources, screening of drought-resistant varieties and molecular-assisted breeding, and has important application value for desertification control and sand prevention.

[0008] To achieve the above objectives, the present invention provides the following solution: This invention provides a combination of SNP molecular markers for identifying drought resistance in Haloxylon ammodendron, wherein the combination of SNP molecular markers consists of SNP1, SNP2 and SNP3; The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, and a C / T mutation exists at the 101st base. The nucleotide sequence of the SNP2 is shown in SEQ ID NO.2, and a C / G mutation exists at the 152nd base. The nucleotide sequence of the SNP3 is shown in SEQ ID NO.3, and an A / G mutation exists at the 152nd base.

[0009] The present invention also provides a primer combination for amplifying the SNP molecular marker combination, the primer combination consisting of primers for amplifying SNP1, primers for amplifying SNP2 and primers for amplifying SNP3; The primers for amplifying SNP1 are the forward primer with the nucleotide sequence shown in SEQ ID NO.4 and the reverse primer with the nucleotide sequence shown in SEQ ID NO.5; The primers for amplifying SNP2 are the forward primer with the nucleotide sequence shown in SEQ ID NO.6 and the reverse primer with the nucleotide sequence shown in SEQ ID NO.7; The primers for amplifying SNP3 are a forward primer with a nucleotide sequence as shown in SEQ ID NO.8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.9.

[0010] The present invention also provides the application of the primer combination described herein in the preparation of products for detecting the drought resistance of Haloxylon ammodendron.

[0011] The present invention also provides a detection kit for the SNP molecular marker combination, the detection kit comprising the primer combination.

[0012] This invention also provides the use of the primer combination or the detection kit described herein in any of the following: (1) To determine the drought resistance of Haloxylon ammodendron; (2) Screening drought-resistant Haloxylon ammodendron; (3) Molecular marker-assisted breeding of drought-resistant traits of Haloxylon ammodendron.

[0013] This invention also provides a method for identifying the drought resistance of Haloxylon ammodendron, comprising the following steps: Genomic DNA was extracted from the *Haloxylon ammodendron* plant to be tested; The genomic DNA was amplified by PCR using the primer combination described above to obtain the amplification product; The amplification products were subjected to genotyping to obtain the genotypes of SNP1, SNP2 and SNP3; If the genotypes of SNP1, SNP2, and SNP3 are CC, CC, and AA respectively, then the drought resistance of the tested Haloxylon ammodendron is high; otherwise, the drought resistance of the tested Haloxylon ammodendron is low.

[0014] The present invention also provides a method for screening drought-resistant Haloxylon ammodendron, comprising the following steps: Genomic DNA was extracted from the *Haloxylon ammodendron* plant to be tested; The genomic DNA was amplified by PCR using the primer combination described above to obtain the amplification product; The amplification products were subjected to genotyping to obtain the genotypes of SNP1, SNP2 and SNP3; The test Haloxylon ammodendron samples with genotypes CC, CC, and AA for SNP1, SNP2, and SNP3, respectively, were retained.

[0015] Optionally, the PCR amplification reaction system is: 12.5 μL of 2×PCR Master Mix, 1.0 μL of forward primer, 1.0 μL of reverse primer, 2.0 μL of genomic DNA, and 8.5 μL of ddH2O.

[0016] Optionally, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58-60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

[0017] Optionally, the method for genotyping the amplified products includes Sanger sequencing.

[0018] The present invention discloses the following technical effects: This invention reports for the first time a combination of SNP molecular markers related to drought tolerance in Haloxylon ammodendron: consisting of SNP1, SNP2, and SNP3, whose nucleotide sequences are shown sequentially as in SEQ ID NO. 1-3, filling a gap in marker-assisted breeding for drought tolerance in Haloxylon ammodendron. This invention uses a dual validation strategy of WGCNA and multi-gradient FST to screen SNP markers, which show a strong correlation with drought tolerance. The average FSTs of SNP1 and SNP2 are as high as 0.928 and 0.859, respectively (showing perfect genotypic segregation between the control group and the extreme drought group). SNP3 has an average FST of 0.843 and is located in a flanking regulatory region of the gene, possessing the dual advantages of high genetic differentiation and a clearly defined functional location. The three SNP markers provided by this invention are located on three different chromosomes (Hic_asm_2, Hic_asm_6, and Hic_asm_3), and can be inherited independently. They can be used alone or in combination to accurately identify drought tolerance in Haloxylon ammodendron. Furthermore, the combined use of the three can fully leverage synergistic and complementary effects, significantly improving the accuracy and reliability of identification. This invention also provides primer combinations and detection methods for detecting the above-mentioned SNP molecular marker combinations, which can realize the rapid identification of drought resistance of Haloxylon ammodendron. Furthermore, the above-mentioned SNP molecular marker combinations can be used for Haloxylon ammodendron germplasm resource evaluation, drought-resistant strain screening and molecular-assisted breeding, which has important application value for desertification control and sand prevention. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The following figures illustrate the screening results of drought-resistant SNP molecular markers in Haloxylon ammodendron: A: Distribution density map of 2,533,278 high-quality SNP loci on the 9 chromosomes of the Haloxylon ammodendron genome, with color intensity indicating the number of SNPs within a 1Mb window; B: Correlation heatmap between module characteristic genes (ME) obtained from WGCNA module analysis of differentially expressed genes and soil moisture content, with values ​​in the heatmap cells representing Pearson correlation coefficients and their significance P-values; C: Manhattan plot of population differentiation index FST analysis for the control group (L0) and the mild drought group (L1+L5); D: Manhattan plot of population differentiation index FST analysis for the control group (L0) and the moderate drought group (L10); E: Manhattan plot of population differentiation index FST analysis for the control group (L0) and the extreme drought group (L40); F: UpSet intersection analysis of WGCNA drought-resistant module candidate genes and FST highly differentiated candidate genes from the three drought gradients (mild, moderate, and extreme), showing the core joint candidate gene set screened by the dual validation strategy; Figure 2 The following plots illustrate the association between SNP marker genotypes and drought tolerance, and the TPM expression trend of candidate genes: A: Bar chart showing the distribution frequency of SNP1 genotype in the control group (L0) and the extreme drought group (L40); B: Bar chart showing the distribution frequency of SNP2 genotype in the control group (L0) and the extreme drought group (L40); C: Bar chart showing the distribution frequency of SNP3 genotype in the control group (L0) and the extreme drought group (L40); D: TPM expression trend of SS10301 and SS18243 genes in the five consecutive drought treatment groups (L0, L1, L5, L10, L40) (Mean±SE); E: TPM expression trend of SS30517 gene in the five consecutive drought treatment groups (L0, L1, L5, L10, L40) (Mean±SE). Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] Example 1: Haloxylon ammodendron material cultivation and drought stress treatment Haloxylon ammodendron seeds were collected from Wuwei City, Gansu Province (37°9′N, 102°6′E). After surface disinfection, they were sown in sandy loam soil and cultivated in a local nursery under standardized cultivation conditions for two initial flood irrigations until healthy seedlings reached 4 months of age. They were then transferred to a rainproof greenhouse for drought stress treatment.

[0027] Twenty-five uniformly grown 4-month-old Haloxylon ammodendron seedlings were randomly divided into 5 groups (L0, L1, L5, L10, and L40), with 5 biological replicates in each group. A continuous drought stress gradient was constructed by extending the water withdrawal period. Samples were taken on day 0 (L0, control), day 1 (L1), day 5 (L5), day 10 (L10), and day 40 (L40) after water withdrawal. The sampling site was the tender stem segment at the top of the seedling. After collection, the samples were immediately flash-frozen in liquid nitrogen and transferred to -80℃ for storage. The sample numbering rule was: the letter L plus the number of drought days plus the biological replicate number, such as L51 indicating the first biological replicate of the drought treatment on day 5.

[0028] Soil moisture content in each treatment group was simultaneously measured using a calibrated HM-WSY soil moisture meter (Shandong Hengmei, China) at each sampling point. The measurement depth was 10-15 cm, and three measuring points were randomly selected in each treatment area. After the instrument stabilized for 30 seconds, the values ​​were read and averaged. The results showed that the soil moisture content ranged from 6.0% to 7.6% in L0 (control), 5.6% to 6.5% in L1, 4.5% to 5.8% in L5, 4.2% to 5.4% in L10, and 3.3% to 4.4% in L40. The moisture content decreased significantly with the extension of drought days, indicating that the drought stress gradient was successfully constructed and the drought intensity could be quantified.

[0029] Example 2: Transcriptome sequencing and SNP variant detection Total RNA was extracted from the young apical stem segments preserved in Example 1 using a modified CTAB method. RNA concentration and purity were measured using a NanoDrop spectrophotometer, and RNA integrity was checked using an Agilent 2100 bioanalyzer to ensure RNA quality met sequencing requirements.

[0030] cDNA libraries were constructed using the NEBNext Ultra RNALibrary Prep Kit by Shanghai Majorbio Biotechnology Co., Ltd. (Beijing). After passing quality testing, the libraries were sequenced. Paired-end sequencing was performed using the Illumina sequencing platform, yielding 3.93 × 10⁻⁶ Clean Reads per sample. 7 -5.52×10 7 The sequence (Clean Data 5.89-8.38 Gb) showed a Q20 ≥ 98.50%, a Q30 95.20%-95.79%, and a GC content of 42.16%-42.60%, indicating excellent sequencing quality.

[0031] Low-quality reads were filtered and adapter sequences were removed using FastP v0.18.0 software. Clean reads were then aligned to the Haloxylon ammodendron reference genome using HISAT2 software, with a total alignment rate of 90.45%–92.08% and a unique alignment rate of 82.92%–85.32%. Transcript assembly and gene expression quantification were performed using featureCounts and StringTie software, outputting counts, FPKM, and TPM expression matrices.

[0032] Variation detection was performed using GATK software: First, HaplotypeCaller was used to generate gVCF files for each sample. Then, a joint database of 25 gVCFs was constructed using GenomicsDBImport. Finally, GenotypeGVCFs were used for population joint genotyping to obtain the original variant set. SNP loci were extracted using SelectVariants, and low-quality variants were removed using the following hard filtering criteria: QD < 2.0, FS > 60.0, MQ < 40.0, MQRankSum < -12.5, ReadPosRankSum < -8.0 or SOR > 3.0. After rigorous quality filtering, a total of 2,533,278 high-quality SNP loci were obtained. Figure 1 The SNP sites cover nine main chromosomes (Hic_asm_0 to Hic_asm_8) of the Haloxylon ammodendron genome, with a uniform density distribution and excellent data quality.

[0033] Example 3: Candidate gene screening and SNP marker identification Differential expression analysis was performed on 25 transcriptome samples, and a total of 6,176 differentially expressed genes that showed significant changes in expression across successive drought gradients were identified. These genes were then used for subsequent weighted gene co-expression network analysis (WGCNA).

[0034] The WGCNA R package was used to construct a network for the 6,176 differentially expressed genes. A soft threshold β=16 was selected based on pickSoftThreshold calculation to satisfy the scale-free network topology. The blockwiseModules function (minModuleSize=50, mergeCutHeight=0.25, TOMType="unsigned") was used to construct a co-expression network and identify co-expression modules. Using soil moisture content measured in Example 1 as trait data, the Pearson correlation coefficients and significance p-values ​​between the characteristic genes (MEs) of each module and soil moisture content were calculated. Figure 1 (B) The co-expression module that is significantly related to soil moisture content was selected as the key module for drought resistance, and a total of 4,648 candidate genes were extracted from it.

[0035] The control group (L0) and the mild drought group (L1+L5) were calculated using the `--weir-fst-pop` parameter in the VCFtools software. Figure 1 (C), control group (L0) and moderate drought group (L10) Figure 1 (Middle D), control group (L0) and extreme drought group (L40) Figure 1The population differentiation index FST between the middle and lower gradients (E) was used. With FST>0.5 as the high differentiation threshold, high differentiation SNP sites were screened for each gradient, and neighboring genes within a 5kb range upstream and downstream of the gene were further selected as FST candidate genes for that gradient, resulting in 3,542 candidate genes for the L1+L5 gradient, 3,719 candidate genes for the L10 gradient, and 6,478 candidate genes for the L40 gradient.

[0036] The four-fold intersection of the WGCNA candidate gene and the FST candidate genes of the three drought gradients mentioned above is taken. Figure 1 In this study, 141 joint candidate genes were obtained that not only respond to drought at the expression regulation level but also exhibit significant differentiation at the population genetic level. It is worth noting that this embodiment fully demonstrates the necessity and efficiency of the dual screening strategy. While WGCNA analysis alone screened 4,648 candidate genes related to drought tolerance, the scope was too large to be directly used for molecular breeding. While single-gradient FST analysis could locate a large number of differentiation sites, it lacked functional expression support and was easily affected by random noise from a single gradient. Only by using the "WGCNA + multi-gradient FST" dual filtering strategy designed in this invention, which significantly narrowed the candidate range from 2,533,278 SNP sites across the entire genome to a small number of SNPs within the 141 joint candidate genes, and then performing downstream fine screening, could a large number of non-linked random variations and non-functional expression differences be effectively eliminated, ensuring that the core SNPs obtained are truly key functional sites regulating drought tolerance in Haloxylon ammodendron.

[0037] SNPs within 5kb of the 141 joint candidate genes and their upstream and downstream regions were subjected to cross-gradient stability verification and comprehensive scoring. First, the FST values ​​of the same SNP under the three drought gradients were combined and statistically analyzed, retaining stable differentiated SNPs that appeared in all three gradients with an average FST > 0.6 and a minimum FST > 0.5. Then, for each gene, only the representative SNP with the highest FST was retained. Subsequently, SNPs were categorized and scored according to their functional location (Gene_Body 100 points, Promoter 90 points, Downstream 80 points, Far_Upstream 60 points, Far_Downstream 50 points), and a comprehensive score was calculated (FST stability 50% + functional location 30% + gradient occurrence frequency 20%). Finally, redundancy was removed by chromosome, retaining only the SNP with the highest comprehensive score for each chromosome, forming a candidate top locus set. Further genotype-phenotype verification, excluding loci with incomplete genotype segregation in the extreme drought group, ultimately identified three core SNP molecular markers: SNP1, SNP2, and SNP3.

[0038] SNP1 originates from the SS10301 gene, located at positions 4,251,735 of chromosome Hic_asm_2, with a base variation of C to T. It is situated within the intronic region of the SS10301 gene and has an average FST of 0.928. The SNP1 site was developed into a molecular marker, SNP1, with its nucleotide sequence shown in SEQ ID NO.1. It is 300 bp in length, with the Y at position 101 representing C / T, and the genotype being CC, CT, or TT.

[0039] SEQ ID NO.1: AATGGGCAAAGCAGCTTCAATTTTGGGGGCAGTTCTTTATAGTCCAGACATGGCCATACATGGGGGCATTTTGTTGTTTATCTCGACCAAAGATGGTAATYAGGAAGAACCTTTATAATTGAATGATTTTTAGTTTTTACTATCTCAAGA ATATCATAATGGGTTAGGGCAGTTTTCTTCATAAGATTGGCATAATAGAGCATGAGTTGGTCTTTTAATCTTTTCAAATCTACGAACAAACAATATAGACCGAGTTCTTAGGTTTATTGTTCACATAATCACGTCTTCCACTCAAAC.

[0040] SNP2 originates from the SS30517 gene, located at positions 49,932,696 on chromosome Hic_asm_6, with a base variation from C to G. It lies within the coding region of the SS30517 gene exon (exon 2 / CDS region), with an average FST of 0.859. The SNP2 site was developed into a molecular marker, SNP2, with its nucleotide sequence shown in SEQ ID NO.2. It is 201 bp in length, with the S at position 152 representing C / G, and the genotypes being CC, CG, or GG.

[0041] SEQ ID NO.2: AATTTTTGGAGTGTTGATGGATATGGAGGGTTGACTCATGAAGTGAAATGGGTTGGAAAACAAATTCTAACCATGATTACAACTTGTCATCAAGATAAGAAATACATTGGTAATCTACTTGGATGTCTAAATATCGATCCGGATACTTCGASAGTCACATTTACCCAGTTCAGTCAAGAAAACTATTGTGAGTTTGCATGA.

[0042] SNP3 originates from the SS18243 gene, located at positions 66,593,863 on chromosome Hic_asm_3. The base variation is A to G, and it lies in the flanking regulatory region of the SS18243 gene (approximately 238 bp from the transcription start term of the negative-strand gene). The average FST is 0.843. The SNP3 site was developed into a molecular marker, SNP3, with its nucleotide sequence shown in SEQ ID NO.3. It is 291 bp in length, with the R at position 152 indicating A / G, and the genotype being AA, AG, or GG.

[0043] SEQ ID NO.3: TCCTGGATTTTCGAATTGAGAGAGATGCAAATTTCAAGGACTCAAAAATTTTGAAAAATTGGATCTGCATCCAAATACTCTACCGTTAAGTTAGCAACCTAAATTGTTTCATTATGGATTCCTATACAAAGTTTTGGTAGGTGTG TTTCCRGGTATTCCTTTATCATTTCGTCCAACAAGTGGAGTTCCGCCAAAGGGATCTATCCACCCTAGGAACTTGAAAGAGTTTTAAATAGAGAAAGAACCAGTGATTAAACCAGAGCGATTATAAGCTCAATCTTTGATGCATC.

[0044] The three SNP loci, located on three different chromosomes, are independently inheritable and all passed the filter, thus being identified as the core molecular markers of this invention. Functional annotation of the three candidate genes was performed using eggNOG-mapper. The results showed that SS10301 belongs to the molecular chaperone HSP60 (60kDa chaperonin / GroEL) family (KEGG orthology number K04077), primarily involved in protein folding and protein homeostasis maintenance; SS18243 encodes ABL-interacting protein-like 5 (ABIL5, isoform X1), a constituent subunit of the WAVE / SCAR complex, involved in the assembly and remodeling of the actin cytoskeleton; SS30517 is a gene whose function has not yet been identified. This identification result was unexpected and has significant biological implications. The HSP60 family has traditionally been considered primarily to respond to heat stress and participate in mitochondrial protein homeostasis, while ABIL5 is mainly thought to be involved in cell morphogenesis; neither has been reported as a dominant drought-resistance gene. However, in this embodiment, specific allelic variations (C, C, and A alleles) of these two "non-classical" drought-resistance pathway genes and one gene with unidentified function showed a highly significant positive correlation (FST values ​​as high as 0.928, 0.859, and 0.843) with the high drought-resistance phenotype of *Haloxylon ammodendron*. This means that the present invention has discovered a unique drought-resistance regulatory mechanism in *Haloxylon ammodendron*, distinct from the traditional classical pathways such as DREB / CBF, LEA, and ABA signaling—namely, the synergistic regulation of three complementary pathways: "maintaining molecular chaperone protein homeostasis + cytoskeleton remodeling + unidentified functional sites." This unexpected extension of the function of "molecular chaperone / cytoskeleton genes" to "identification of long-term drought adaptability in desert plants" breaks the existing understanding of the function of this type of gene and confirms that the SNP markers have a non-obvious technical effect in identifying drought resistance in *Haloxylon ammodendron*.

[0045] Further analysis of the expression patterns of the three candidate genes, SS10301 and SS18243 ( Figure 2 (middle D) and SS30517 gene ( Figure 2 The expression of the three genes (E) in the five consecutive drought treatment groups (L0, L1, L5, L10, and L40) showed a trend of expression change in response to drought stress, confirming that all three genes are involved in the regulation of drought tolerance in Haloxylon ammodendron.

[0046] Example 4: Validation of the association between SNP markers and drought resistance Genotype information for SNP1, SNP2, and SNP3 was extracted from the passed_snps.vcf.gz file obtained in Example 2. The genotype distribution of 25 samples in the L0 (control), L1 (1-day drought), L5 (5-day drought), L10 (10-day drought), and L40 (40-day extreme drought) groups was statistically analyzed using the bcftools query command.

[0047] To visually verify the association between genotype and drought tolerance phenotype, a comparative analysis was conducted between the control group (L0, 5 samples), where the phenotypic differences were most significant, and the extreme drought group (L40, 5 samples). The results showed that the T / T genotype (drought-sensitive) of SNP1 accounted for 100% (5 / 5) in the control group L0, but decreased to 0% in the extreme drought group L40; conversely, the C / C genotype (drought-tolerant) accounted for 0% in the control group, but enriched to 100% (5 / 5) in the extreme drought group, achieving perfect genotype segregation. Figure 2 (A). The G / G genotype (drought-sensitive) of SNP2 accounted for 100% (5 / 5) in the control group L0, but decreased to 0% in the extreme drought group L40; the C / C genotype (drought-resistant) accounted for 0% in the control group, but enriched to 100% (5 / 5) in the extreme drought group, thus achieving perfect genotype segregation. Figure 2 In the control group L0, the G / G genotype of SNP3 accounted for 80% (4 / 5), with one heterozygous A / G genotype (20%), and no homozygous A / A genotype was detected; while in the extreme drought group L40, the A / A genotype (drought-resistant) accounted for 100% (5 / 5), and no G / G genotype was detected, showing a highly significant genotype bias. Figure 2 (C)

[0048] Chi-square test analysis was used to analyze the association between genotype and drought treatment. The results showed that the genotypes of SNP1, SNP2, and SNP3 were all highly significantly associated with drought treatment (P<0.001). Further comparative analysis of the identification power of the three markers revealed (see...) Figure 2 China A- Figure 2In the case of SNP1, SNP2, and SNP3, there is a clear synergistic and complementary advantage: SNP1 and SNP2, as intra-coding sequence variations (introns / exons), exhibit 100% perfect genotypic segregation between the control and extreme drought groups, with both identification sensitivity and specificity reaching 100%, making them the "gold standard" loci for identifying extreme drought-resistant individuals. SNP3, located in the flanking regulatory region of the gene, may participate in drought resistance regulation by affecting the transcriptional level of the SS18243 gene. One heterozygous individual (AG, 20%) was still detected in the control group, but 100% homozygous A / A individuals were detected in the extreme drought group, possessing the dual advantages of clear functional location and high segregation. When the combined strategy described in this invention is adopted (i.e., simultaneously detecting SNP1, SNP2, and SNP3, and identifying the CC+CC+AA genotype combination), the complementary information of genomic variations (SNP1, SNP2) and regulatory region variations (SNP3) can be combined to achieve 100% efficient capture of drought-resistant plants while maintaining a false positive rate of 0% in the control group. The results showed that the SNP combination had a significant synergistic complementary effect and could identify drought resistance of Haloxylon ammodendron more comprehensively and reliably than a single site, and could serve as an effective molecular marker combination.

[0049] Example 5: SNP detection primer design and detection method Approximately 200 bp sequences upstream and downstream of SNP1, SNP2, and SNP3 sites were extracted from the Haloxylon ammodendron genome reference sequence. Primers were designed using Primer3 software, resulting in the following three pairs of specific primers: SNP1 detection primer pair: Forward primer: 5'-AATGGGCAAAGCAGCTTCAATTTTG-3', SEQ ID NO.4; Reverse primer: 5'-GTTTGAGTGGAAGACGTGATTATGTGAACA-3', SEQ ID NO.5.

[0050] SNP2 detection primer pair: Forward primer: 5'-AATTTTTGGAGTGTTGATGGATATGGAGG-3', SEQ ID NO.6; Reverse primer: 5'-TCATGCAAACTCACAATAGTTTTCTTGACTG-3', SEQ ID NO.7.

[0051] SNP3 detection primer pair: Forward primer: 5'-TCCTGGATTTTCGAATTGAGAGAGATG-3', SEQ ID NO.8; Reverse primer: 5'-GATGCATCAAAGATTGAGCTTATAATCGC-3', SEQ ID NO.9.

[0052] The PCR amplification reaction system (25 μL) consisted of: 12.5 μL of 2×PCR Master Mix, 1.0 μL of forward primer, 1.0 μL of reverse primer, 2.0 μL of genomic DNA, and 8.5 μL of ddH2O.

[0053] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58-60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

[0054] The SNP markers of this invention can be used for genotyping using Sanger sequencing. Genomic DNA is extracted from the *Haloxylon ammodendron* sample to be tested, and PCR amplification is performed using the aforementioned SNP1 detection primer pair-SNP3 detection primer pair. After purification, the amplified products are sequenced, and the genotype is determined by comparing the sequencing peak diagram. Homozygous genotypes show a single base peak at the SNP site in the sequencing peak diagram, while heterozygous genotypes show overlapping double peaks. The SNP markers of this invention can also be detected using KASP genotyping, HRM high-resolution melting curve analysis, or dCAPS restriction enzyme digestion.

[0055] Judgment criteria: Haloxylon ammodendron varieties with SNP1 base type C are more drought-resistant than varieties with base type T; Haloxylon ammodendron varieties with SNP2 base type C are more drought-resistant than varieties with base type G; Haloxylon ammodendron varieties with SNP3 base type A are more drought-resistant than varieties with base type G; and Haloxylon ammodendron varieties with the CC+CC+AA genotype combination have the strongest drought resistance.

[0056] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A combination of SNP molecular markers for identifying drought resistance in Haloxylon ammodendron, characterized in that, The SNP molecular marker combination consists of SNP1, SNP2, and SNP3; The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, and a C / T mutation exists at the 101st base. The nucleotide sequence of SNP2 is shown in SEQ ID NO.2, and a C / G mutation exists at base position 152. The nucleotide sequence of SNP3 is shown in SEQ ID NO.3, and there is an A / G mutation at the 152nd base.

2. A primer combination for amplifying the SNP molecular marker combination of claim 1, characterized in that, The primer combination consists of primers for amplifying SNP1, primers for amplifying SNP2, and primers for amplifying SNP3. The primers for amplifying SNP1 are the forward primer with the nucleotide sequence shown in SEQ ID NO.4 and the reverse primer with the nucleotide sequence shown in SEQ ID NO.5; The primers for amplifying SNP2 are the forward primer with the nucleotide sequence shown in SEQ ID NO.6 and the reverse primer with the nucleotide sequence shown in SEQ ID NO.7; The primers for amplifying SNP3 are a forward primer with a nucleotide sequence as shown in SEQ ID NO.8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

9.

3. The application of the primer combination as described in claim 2 in the preparation of products for detecting the drought resistance of Haloxylon ammodendron.

4. A detection kit for the SNP molecular marker combination as described in claim 1, characterized in that, The detection kit comprises the primer combination as described in claim 2.

5. The use of the primer combination of claim 2 or the detection kit of claim 4 in any of the following: (1) To determine the drought resistance of Haloxylon ammodendron; (2) Screening drought-resistant Haloxylon ammodendron; (3) Molecular marker-assisted breeding of drought-resistant traits of Haloxylon ammodendron.

6. A method for identifying the drought resistance of Haloxylon ammodendron, characterized in that, Includes the following steps: Genomic DNA was extracted from the *Haloxylon ammodendron* plant to be tested; The genomic DNA was amplified by PCR using the primer combination described in claim 2 to obtain the amplification product. Genotyping of the amplification products yields the genotypes of SNP1, SNP2, and SNP3 as described in claim 1. If the genotypes of SNP1, SNP2, and SNP3 are CC, CC, and AA respectively, then the drought resistance of the tested Haloxylon ammodendron is high; otherwise, the drought resistance of the tested Haloxylon ammodendron is low.

7. A method for screening drought-resistant Haloxylon ammodendron, characterized in that, Includes the following steps: Genomic DNA was extracted from the *Haloxylon ammodendron* plant to be tested; The genomic DNA was amplified by PCR using the primer combination described in claim 2 to obtain the amplification product. Genotyping of the amplification products yields the genotypes of SNP1, SNP2, and SNP3 as described in claim 1. The test Haloxylon ammodendron samples with genotypes CC, CC, and AA for SNP1, SNP2, and SNP3, respectively, were retained.

8. The method as described in claim 6 or 7, characterized in that, The PCR amplification reaction system consisted of: 12.5 μL of 2×PCRMaster Mix, 1.0 μL of forward primer, 1.0 μL of reverse primer, 2.0 μL of genomic DNA, and 8.5 μL of ddH2O.

9. The method as described in claim 6 or 7, characterized in that, The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58-60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

10. The method as described in claim 6 or 7, characterized in that, Methods for genotyping the amplified products include Sanger sequencing.

Images