A molecular marker related to cadmium accumulation in rice grains, a primer combination and application thereof

Abstract

The application discloses a molecular marker related to cadmium accumulation in rice grains, a primer combination and application, and relates to the technical field of molecular breeding. OsNRAMP5 The 9bp insertion and deletion site existing in the coding region of the rice gene is located at the physical position Chr7:8,876,535 to 8,876,543 of the seventh chromosome of a rice reference genome IRGSP-1.0, and the reference sequence of the positive strand of the deletion is GCAGTAGAG; the KASP primer combination developed for the molecular marker comprises a mutant-specific forward primer, a wild type-specific forward primer and a common reverse primer, and can accurately distinguish the wild type homozygous genotype, the deletion type homozygous genotype and the heterozygous genotype. The cadmium content of the rice grains carrying the 9bp deletion allele is significantly reduced by about 97% compared with the wild type, and there is no significant difference in main agronomic characters and essential element content.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, and in particular relates to a molecular marker, primer combination and application related to cadmium accumulation in rice grains. Background Technology

[0002] Currently, research on low-cadmium molecular breeding of rice mainly focuses on OsNRAMP5 , OsHMA3 Key genes for cadmium transport. Among them, OsNRAMP5 (LOC_Os07g15370) is an important transmembrane transporter for the absorption of Cd and Mn by rice roots, and its loss of function can significantly reduce cadmium accumulation in grains.

[0003] Existing technologies mainly include the following categories: (1) Constructing based on gene editing technologies such as CRISPR / Cas9 OsNRAMP5 Knockout material. Existing research has involved editing... OsNRAMP5 Low cadmium accumulation can be achieved in promoter or coding regions. However, such technologies generally fall under the categories of transgenic or gene editing, and there are still certain limitations in terms of industrialization, variety approval, and market acceptance.

[0004] (2) Utilization OsNRAMP5 Complete knockout reduces Cd absorption. Although it can significantly reduce grain Cd content, due to... OsNRAMP5 It also participates in Mn absorption. Complete knockout of it can easily lead to insufficient Mn absorption, which in turn affects the normal growth of plants and the stability of yield.

[0005] (3) Utilization OsHMA3 Overexpression or tissue-specific expression regulates Cd transport. This type of technology can reduce Cd accumulation in grains, but it largely relies on genetic transformation systems, is complex to operate, and raises concerns about transgenic regulatory issues.

[0006] In addition, current low-cadmium breeding techniques have the following shortcomings: ① Most existing low-cadmium materials are derived from gene editing or transgenic technology, and there is a lack of new low-cadmium allele resources that can be obtained through traditional mutagenesis methods and directly used for non-transgenic breeding; ② Reported OsNRAMP5 Most materials with missing functions exhibit varying degrees of negative effects on agronomic traits, such as decreased plant height, reduced seed setting rate, or decreased yield. ③ The lack of high-throughput molecular markers that can rapidly and accurately identify low-cadmium functional variant sites is detrimental to large-scale molecular-assisted breeding; ④ The genetic background of some low-cadmium mutant materials is relatively narrow, mostly concentrated in japonica rice materials, and their application in male-sterile lines of indica rice in South China is relatively limited.

[0007] The main reasons for the above problems are: OsNRAMP5 It has both Cd and Mn cotransport functions, and traditional complete knockout strategies often disrupt normal Mn uptake; at the same time, existing research focuses more on "gene function loss" and there is insufficient research on "novel weak functional allelic variants that take into account both low cadmium and stable agronomic traits".

[0008] Therefore, it is crucial to develop a novel method derived from non-GMO mutagenesis that can significantly reduce Cd accumulation in grains, have minimal impact on agronomic traits, and be compatible with efficient molecular marker detection. OsNRAMP5 The absence of alleles is of great significance for the safe production and molecular breeding of low-cadmium rice. Summary of the Invention

[0009] To address the aforementioned technical problems, this invention proposes a molecular marker, primer combination, and application related to cadmium accumulation in rice grains.

[0010] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a molecular marker associated with cadmium accumulation in rice grains, wherein the molecular marker is a rice OsNRAMP5 A 9bp insertion / deletion (InDel) site exists in the gene coding region; the 9bp deletion site is located at the physical position Chr7:8,876,535 to 8,876,543 on chromosome 7 of the rice reference genome IRGSP-1.0; the positive strand reference sequence of the 9bp deletion is GCAGTAGAG.

[0011] Furthermore, the aforementioned OsNRAMP5 The MSU locus of the gene is LOC_Os07g15370, and the NCBI Gene ID is 4342859; the NCBI accession number of the rice reference genome IRGSP-1.0 is GCF_001433935.1, and the NCBI accession number of chromosome 7 sequence is NC_029262.1.

[0012] Secondly, the present invention also provides a primer combination for detecting the above-mentioned molecular markers, the primer combination comprising: The mutant-specific forward primer has the nucleotide sequence shown in SEQ ID NO.3; Wild-type specific forward primer, the nucleotide sequence of which is shown in SEQ ID NO.4; And a common reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0013] Preferably, the mutant-specific forward primer has a HEX fluorescent tag attached to its 5′ end, and the wild-type-specific forward primer has a FAM fluorescent tag attached to its 5′ end.

[0014] Thirdly, the present invention also provides a kit for detecting cadmium accumulation-related genotypes in rice grains, the kit comprising the primer combination described above.

[0015] Fourthly, the present invention also provides a method for detecting rice using the above-mentioned primer combination. OsNRAMP5 The genotyping method includes the following steps: (1) Extract genomic DNA from the rice sample to be tested; (2) Using the extracted genomic DNA as a template, KASP-PCR amplification was performed using the above primer combination; (3) Detect the fluorescence signal of the amplification product and perform genotype clustering based on the intensity of the endpoint fluorescence signal; The genotypes include: homozygous genotypes carrying a 9bp deletion, wild-type homozygous genotypes not carrying a 9bp deletion, and heterozygous genotypes.

[0016] Fifthly, the present invention also provides the application of the above-mentioned molecular markers in screening low-cadmium-accumulating rice germplasm resources.

[0017] Sixthly, the present invention also provides the application of the above-mentioned molecular markers in molecular-assisted breeding of low-cadmium rice, for detecting whether the hybrid and backcross offspring carry the 9bp deletion allele, so as to screen rice plants with reduced grain cadmium content and excellent agronomic traits.

[0018] Compared with the prior art, the present invention has the following advantages and technical effects: (1) This invention is the first to pass 60 Co-γ ray mutagenesis yielded a strain derived from a non-transgenic pathway. OsNRAMP5 The novel 9bp deleted allele avoids the regulatory restrictions on the industrial application of gene editing and transgenic technologies, and has higher breeding application value.

[0019] (2) The invention obtained OsNRAMP5 Deleting the allele significantly reduces Cd accumulation in rice grains while having virtually no impact on the plant's main agronomic traits, overcoming existing limitations. OsNRAMP5 Completely removing materials can easily lead to deterioration of agronomic traits and a decrease in yield.

[0020] (3) The KASP molecular marker developed in this invention can accurately distinguish between wild-type, homozygous mutant and heterozygous genotype materials. It has high detection efficiency and good stability, and is suitable for large-scale molecular-assisted breeding.

[0021] (4) The low cadmium allele obtained in this invention comes from the high-quality indica rice maintainer line Wantai B, which has a good genetic breeding foundation and can be directly applied to the breeding of new low cadmium hybrid rice varieties.

[0022] (5) This invention realizes a complete technical system of "low cadmium accumulation - molecular detection - breeding utilization", which can significantly improve the breeding efficiency of low cadmium rice and has good industrial application prospects. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 Low cadmium mutant OsNRAMP5 Gene sequencing analysis; Figure 2 The results of KASP marker genotyping were validated. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] Unless otherwise specified, the term "parts" in this invention refers to parts by weight.

[0031] rice OsNRAMP5 MSU locus LOC_Os07g15370, NCBI Gene ID 4342859, reference mRNA sequence NM_001403041.1, protein sequence NP_001389970.1, genomic coordinates based on NC_089041.1 assembled from GCF_034140825.1.

[0032] Example 1 Using the indica rice maintainer line Wantai B as the mutagenesis material, seeds harvested in the early season of the current year, mature and plump, with a germination rate greater than 95%, were selected and used... 60 Co-γ ray irradiation mutagenesis was performed. Irradiation dose gradients of 200 Gy, 250 Gy, and 300 Gy were set, with each dose treatment involving at least 1 kg of seeds. The irradiated seeds were stored at room temperature for 7 days before sowing to obtain the M1 generation population.

[0033] M1 generation seeds were obtained by harvesting individual plants to produce M2 generation seeds. The M2 generation population was planted in cadmium-contaminated paddy fields and managed according to conventional rice cultivation practices for subsequent screening of low-cadmium mutants.

[0034] At maturity, the main agronomic traits of each individual plant were investigated, including plant height, panicle length, number of effective panicles, seed setting rate, and thousand-grain weight. Individual plants with obvious growth abnormalities or severely degraded agronomic traits were removed. Brown rice samples from each individual plant were harvested, and the Cd content of the brown rice was determined by atomic absorption spectrophotometry. Using the Wantai B wild-type as a control, individual plants with significantly lower Cd content in brown rice and basically normal agronomic traits were selected as candidate low-cadmium mutants. Subsequently, secondary screening was carried out in M3 and subsequent generations, and repeated identification was conducted in different years and different fields to obtain low-cadmium mutants that could be stably inherited.

[0035] Genomic DNA was extracted from leaves of the low-cadmium mutant and wild-type Wantai B, which had been genetically verified to be stable. OsNRAMP5 The gene is located on chromosome 7 of the IRGSP-1.0 reference genome (NCBI accession number NC_029262.1). Primers were designed to amplify this gene: OsNRAMP5 -F: 5′-TAGGACAGGAGGGTGTGGCTTGAGAGTTC-3′, SEQ ID NO.1; OsNRAMP5-R: 5′-ATGCATATTATCAATTTCCGAG-3′, SEQ ID NO. 2.

[0036] PCR amplification conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 60 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min. The amplified products were purified and subjected to bidirectional Sanger sequencing.

[0037] Low cadmium mutants were subjected to OsNRAMP5 Gene sequencing analysis, results as follows Figure 1 As shown in the figure, 694F-1-E02 is a 9bp deletion mutant, and 694F-3-G02 is a homologous wild-type Wantai B. Sequence alignment analysis indicates that the low-cadmium mutant... OsNRAMP5 A 9bp deletion variant was found within the gene region. This deletion site is located at positions 8,876,535-8,876,543 on chromosome 7 (NC_029262.1) of IRGSP-1.0; its positive strand reference sequence is GCAGTAGAG, and the corresponding gene direction (reverse complementation) deletion sequence is CTCTACTGC. This 9bp deletion stably co-segregates with the low cadmium accumulation phenotype, indicating that this variant is a functional variation leading to the low cadmium trait.

[0038] Example 2 KASP molecular markers were designed for the 9bp deletion site in Example 1, including a wild-type specific forward primer (SEQ ID NO.3), a mutant specific forward primer (SEQ ID NO.4), and a common reverse primer (SEQ ID NO.5).

[0039] SEQ ID NO.3, FAM-WT: GAAGGTGACCAAGTTCATGCTCATCACCGGCACCAGCAC; SEQ ID NO.4, HEX-Del: GAAGGTCGGAGTCAACGGATTCATCACCGGCACCAGCAT; SEQ ID NO. 5, Pub: ATACCCCGTATTTTTGGAGGC.

[0040] The KASP detection reaction system consisted of 10 μL: 2 μL DNA template (20 ng / μL), 5 μL KASP Master Mix, 0.14 μL primer mixture, and ddH2O to a final volume of 10 μL. The amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, followed by gradient annealing at 61-55℃ for 60 s, for a total of 10 cycles; and 94℃ denaturation for 20 s, followed by annealing at 55℃ for 60 s, for a total of 26 cycles. Fluorescence signals were read using a fluorescence microplate reader, and genotype clustering was performed based on the endpoint fluorescence signal intensity.

[0041] Using a 9bp deletion mutant as the donor parent, a cross was performed with the rice male-sterile line Wantai A, followed by backcrossing to obtain the Wantai A× mutant F1. Genotyping of the wild-type Wantai B, the 9bp deletion mutant, the Wantai A× mutant backcross F1, and different rice varieties was conducted using the aforementioned KASP markers to verify their ability to accurately distinguish between wild-type homozygous, deletion homozygous, and heterozygous genotypes. KASP genotyping was performed using a fluorescent PCR detection platform. The KASP detection results were compared with Sanger sequencing results to calculate the consistency and reproducibility.

[0042] The KASP marker gene typing verification results are shown in Table 1 and... Figure 2 As shown, Figure 2 In the diagram, green sample points represent homozygous mutants, red sample points represent heterozygous mutants, blue sample points represent homozygous wild types, and black sample points are contaminated and cannot be determined.

[0043] Table 1. Results of KASP marker gene typing validation

[0044] (Note: FAM is the wild-type homozygous genotype, HEX is the deletion homozygous genotype, and FAM / HEX is the heterozygous genotype.) From Table 1 and Figure 2 It can be seen that the developed KASP marker can accurately distinguish between wild-type homozygous genotype, deletion homozygous genotype and heterozygous genotype; Figure 2 The gray sample points represent areas where no data was processed, indicating meaningless background values. The detection results are consistent with the sequencing results. Figure 1 The accuracy rate reaches 100%, and the repeatability is good, making it suitable for molecular-assisted breeding of low-cadmium rice.

[0045] Example 3 To verify the breeding application effect of the 9bp deletion allele, the 9bp deletion mutant was used as the donor parent and crossed with the rice male-sterile line Wantai A and backcrossed to obtain Wantai A× mutant backcross generation 1; the KASP marker in Example 2 was used to detect the genotype of the hybrid offspring and screen offspring materials carrying the 9bp deletion allele and with excellent agronomic traits.

[0046] It should be noted that Table 2 only compares the wild-type Wantai B and the Wantai B-9bp deletion mutant, and is used to evaluate the essential element content of the donor mutant, and does not involve the hybrid offspring; Table 3, in addition to the two parent materials, also includes the first generation of backcrossing of the Wantai A× mutant obtained from the above hybridization backcross experiment, and is used to evaluate the agronomic traits of the backcross offspring.

[0047] Table 2 shows a comparison of the essential element content of grains between the wild-type Wantai B and the Wantai B-9bp deletion mutant.

[0048] Table 2 Comparison of essential element content in grains of different materials (mg / kg)

[0049] The results showed that the Cd content in the grains of the Wantai B-9bp deletion mutant (0.018±0.008 mg / kg) was significantly lower than that of the wild-type Wantai B (1.087±0.244 mg / kg). P <0.05); its Mn, Fe, and Zn contents were not significantly different from those of the wild type ( P >0.05). The above results indicate that while the 9bp deletion mutant significantly reduced the Cd content in the grains, it did not significantly affect the accumulation of essential elements such as Mn, Fe, and Zn.

[0050] Table 3 shows the comparison of agronomic traits of different materials, n=5, one-way ANOVA and Tukey HSD, α=0.05; the number of grains in the main panicle was tested using t-test.

[0051] Table 3 Comparison of agronomic traits of different materials

[0052] The results showed that there were no significant differences between the Wantai B-9bp deletion mutant and the wild-type Wantai B in terms of plant height, number of grains in the main panicle, and number of effective panicles. P >0.05, indicating that the 9bp deletion did not significantly affect the main agronomic traits. The Wantai A× mutant, after one generation of backcrossing, remained a sterile line, with plant height significantly lower than the wild type and the 9bp deletion mutant. P <0.001); there was no significant difference in the number of effective spikes among the three groups ( P >0.05). The number of grains per ear in the first backcross generation was not determined (marked as " / " in the table).

[0053] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker associated with cadmium accumulation in rice grains, characterized in that: The molecular marker is rice. OsNRAMP5 A 9bp insertion / deletion site exists in the gene coding region; the 9bp deletion site is located at the physical position Chr7:8,876,535 to 8,876,543 on chromosome 7 of the rice reference genome IRGSP-1.0; the positive strand reference sequence of the 9bp deletion is GCAGTAGAG.

2. The molecular marker associated with cadmium accumulation in rice grains according to claim 1, characterized in that: The OsNRAMP5 The MSU locus of the gene is LOC_Os07g15370, and the NCBI Gene ID is 4342859; the NCBI accession number of the rice reference genome IRGSP-1.0 is GCF_001433935.1, and the NCBI accession number of chromosome 7 sequence is NC_029262.

1.

3. A primer combination for detecting the molecular markers associated with cadmium accumulation in rice grains as described in claim 1 or 2, characterized in that, The primer combination includes: a mutant-specific forward primer, the nucleotide sequence of which is shown in SEQ ID NO.3; Wild-type specific forward primer, the nucleotide sequence of which is shown in SEQ ID NO.4; And a common reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.

5.

4. The primer combination for detecting molecular markers associated with cadmium accumulation in rice grains according to claim 3, characterized in that, The mutant-specific forward primer has a HEX fluorescent tag attached to its 5′ end, and the wild-type-specific forward primer has a FAM fluorescent tag attached to its 5′ end.

5. A kit comprising the primer combination of claim 3 or 4 for detecting molecular markers associated with cadmium accumulation in rice grains.

6. A primer combination for detecting molecular markers associated with cadmium accumulation in rice grains, as described in claim 3 or 4. OsNRAMP5 The genotyping method is characterized by, Includes the following steps: (1) Extract genomic DNA from the rice sample to be tested; (2) Using the extracted genomic DNA as a template, KASP-PCR amplification was performed using the above primer combination; (3) Detect the fluorescence signal of the amplification product and perform genotype clustering based on the intensity of the endpoint fluorescence signal; The genotypes include: homozygous genotypes carrying a 9bp deletion, wild-type homozygous genotypes not carrying a 9bp deletion, and heterozygous genotypes.

7. The application of the molecular markers as described in claim 1 or 2 in screening low cadmium-accumulating rice germplasm resources.

8. The application of the molecular marker as described in claim 1 or 2 in molecular-assisted breeding of low-cadmium rice, characterized in that: This method is used to detect whether hybrid and backcross offspring carry a 9bp deletion allele, in order to screen rice plants with reduced cadmium content and excellent agronomic traits.

Images