A SNP molecular marker combination for identifying halophily of haloxylon ammodendron and application thereof

Abstract

The application discloses a SNP molecular marker combination for identifying Haloxylon ammodendron salt tolerance and application thereof, and belongs to the technical field of molecular biology and plant breeding. The SNP molecular marker combination for H. ammodendron salt tolerance is screened by WGCNA and FST double verification strategies, and includes SNP molecular markers SNP1 and SNP2, and the nucleotide sequences of the SNP molecular markers are shown as SEQ ID NO. 1-2. The application further provides primer combinations and detection methods for detecting the SNP molecular marker combination, so that the H. ammodendron salt tolerance can be rapidly identified, and the SNP molecular marker combination is used for H. ammodendron germplasm resource evaluation, salt-tolerant line screening and molecular assisted breeding. The application first reports the SNP molecular marker related to H. ammodendron salt tolerance, fills the blank in the field of H. ammodendron molecular marker assisted breeding, and has important application value for promoting desertification control and sand control.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and plant breeding technology, and in particular to a combination of SNP molecular markers for identifying the salt tolerance of Haloxylon ammodendron and its application. Background Technology

[0002] Haloxylon ammodendron, a perennial shrub belonging to the genus Haloxylon in the family Amaranthaceae, is widely distributed in arid and desert regions and is a pioneer tree species for desertification control and sand prevention. It possesses extremely strong salt tolerance and drought resistance, enabling it to grow normally in saline-alkali soils, thus playing a vital ecological role in improving saline-alkali land and preventing land degradation. Furthermore, Haloxylon ammodendron is an excellent host plant for the valuable traditional Chinese medicine Cistanche deserticola, playing an important role in ecological protection and economic development.

[0003] In areas with severe soil salinization, Haloxylon ammodendron is often subjected to salt stress during sowing and seedling stages, resulting in low seed germination rates and poor seedling survival rates, which seriously hinders the effectiveness of Haloxylon ammodendron afforestation and desertification control. Therefore, screening and cultivating Haloxylon ammodendron varieties with strong salt tolerance is of great significance for improving the success rate of afforestation and accelerating the process of desertification control.

[0004] Plant salt tolerance is a complex quantitative trait controlled by multiple genes. Traditional salt tolerance identification mainly relies on field phenotypic observation or salt stress treatment experiments, which are time-consuming, inefficient, and easily affected by environmental factors. Using DNA molecular markers for salt tolerance identification and molecular-assisted breeding can shorten the breeding cycle and improve selection efficiency, making it an important tool in modern breeding.

[0005] With the development of high-throughput sequencing technology, although massive amounts of SNP data can be obtained, accurately screening functional markers truly linked to salt tolerance traits from millions of variant sites remains a significant challenge. Existing conventional screening methods have obvious limitations: relying solely on differential transcriptome expression analysis (RNA-seq) often only identifies genes with varying expression levels, failing to directly pinpoint the genetic variant sites causing phenotypic differences, and is prone to including numerous environment-induced "false positive" genes; while genome-wide association studies (GWAS), although capable of locating sites, require constructing large natural populations and conducting multi-year, multi-location phenotypic identification, resulting in long cycles, high costs, and limited detection capabilities for minor sites. Currently, there are no reports of using a dual strategy combining weighted co-expression network analysis (WGCNA) and population differentiation index (FST) to develop salt tolerance SNP markers for Haloxylon ammodendron. Therefore, developing an efficient and accurate screening strategy to mine core salt tolerance genes and their SNP markers from massive amounts of redundant data has significant scientific and practical value.

[0006] It is particularly noteworthy that there is a certain technological inertia in the field of plant stress resistance gene discovery. Current technologies, when searching for salt-tolerant genes, typically focus on genes directly related to salt ion separation or osmotic pressure balance, such as ion transport proteins (e.g., the SOS and NHX families) or osmotic regulator synthases. However, chitinase, as a typical pathogenesis-related protein, has long been recognized by those skilled in the art as primarily responding to biotic stresses such as fungal and bacterial infections, and used for plant disease resistance. To date, there are few reports on chitinase gene variations directly influencing salt tolerance in plants (especially desert plants). Summary of the Invention

[0007] The purpose of this invention is to provide a combination of SNP molecular markers for identifying the salt tolerance of Haloxylon ammodendron and its application, so as to solve the problems existing in the prior art. The SNP molecular marker combination provided by this invention can be used for the evaluation of Haloxylon ammodendron germplasm resources, screening of salt-tolerant lines and molecular-assisted breeding, which has important application value for promoting desertification control and sand prevention.

[0008] To achieve the above objectives, the present invention provides the following solution: This invention provides a combination of SNP molecular markers for identifying the salt tolerance of Haloxylon ammodendron, consisting of SNP1 and SNP2; The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, and there is an A>G mutation at position 252 of the nucleotide sequence shown in SEQ ID NO.1, with a genotype of AA, AG or GG. The nucleotide sequence of the SNP2 is shown in SEQ ID NO.2, and there is a C>T mutation at position 112 of the nucleotide sequence shown in SEQ ID NO.2, with a genotype of CC, CT or TT.

[0009] The present invention also provides a primer combination for amplifying the above-mentioned SNP molecular marker combination, including SNP1-F with nucleotide sequence as shown in SEQ ID NO.3, SNP1-R with nucleotide sequence as shown in SEQ ID NO.4, SNP2-F with nucleotide sequence as shown in SEQ ID NO.5, and SNP2-R with nucleotide sequence as shown in SEQ ID NO.6.

[0010] The present invention also provides an application of the above-mentioned primer combination in the preparation of a product for detecting the salt tolerance of Haloxylon ammodendron.

[0011] The present invention also provides a product for identifying the salt tolerance of Haloxylon ammodendron, comprising the primer combination described above.

[0012] The present invention also provides the application of the above-mentioned primer combination or the above-mentioned product in identifying the salt tolerance of Haloxylon ammodendron.

[0013] The present invention also provides a method for identifying the salt tolerance of Haloxylon ammodendron, comprising the following steps: Genomic DNA was extracted from the *Haloxylon ammodendron* plant to be tested; The genomic DNA was amplified by PCR using the primer combination described above to obtain the amplification product; The amplification products are detected to determine the genotypes of SNP1 and SNP2. If the genotype of SNP1 is AA and the genotype of SNP2 is CC, then the tested Haloxylon ammodendron is identified as having high salt tolerance. If the genotype of SNP1 is GG and the genotype of SNP2 is TT, then the tested Haloxylon ammodendron has low salt tolerance.

[0014] Furthermore, the method for detecting the amplified product is Sanger sequencing.

[0015] The present invention also provides an application of the above-mentioned primer combination or the above-mentioned product in the salt tolerance breeding of Haloxylon ammodendron.

[0016] This invention also provides a method for breeding salt-tolerant Haloxylon ammodendron, comprising the following steps: Genomic DNA was extracted from the *Haloxylon ammodendron* plant to be tested; The genomic DNA was amplified by PCR using the primer combination described above to obtain the amplification product; The amplification products are detected to determine the genotypes of SNP1 and SNP2. If the genotype of SNP1 is AA and the genotype of SNP2 is CC, then the tested Haloxylon ammodendron will be retained for breeding.

[0017] Furthermore, the method for detecting the amplified product is Sanger sequencing.

[0018] The present invention discloses the following technical effects: This invention employs a dual validation strategy of WGCNA and FST to screen and obtain SNP molecular marker combinations strongly associated with the salt tolerance of Haloxylon ammodendron, including SNP1 and SNP2, whose nucleotide sequences are shown in SEQ ID NO. 1-2, respectively. This invention also provides primer combinations and detection methods for detecting the above SNP molecular marker combinations, enabling rapid identification of Haloxylon ammodendron salt tolerance. These SNP molecular marker combinations can then be used for Haloxylon ammodendron germplasm resource evaluation, salt-tolerant strain screening, and molecular-assisted breeding. This invention is the first to report SNP molecular markers related to the salt tolerance of Haloxylon ammodendron, filling a gap in the field of molecular marker-assisted breeding of Haloxylon ammodendron and possessing significant application value for promoting desertification control and sand prevention. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a distribution density map of the 6,800,000 high-quality SNP loci obtained in Example 2 on the 9 chromosomes of the Haloxylon ammodendron genome; where the color intensity represents the number of SNPs within a 1 Mb window; Figure 2 The following figures show the screening results of SNP molecular markers for salt tolerance in Haloxylon ammodendron; where A is a correlation heatmap of 19,399 genes analyzed by the WGCNA module in Example 3; B is a Manhattan plot of population differentiation index FST analysis between the control group and the low-salt group in Example 3; C is a Manhattan plot of population differentiation index FST analysis between the control group and the medium-salt group in Example 3; D is a Manhattan plot of population differentiation index FST analysis between the control group and the high-salt group in Example 3; E is an intersection analysis diagram of WGCNA candidate genes and FST candidate genes, showing the two key genes SS00072 and SS32525 screened by the dual validation strategy. Figure 3 The graphs show the association between SNP marker genotypes and salt tolerance, and the TPM trend of candidate genes. Specifically, A is a bar chart showing the distribution frequency of the SNP1 (Hic_asm_0:1,151,163) genotype in the control group (0 mmol / L mixed salt) and the high-salt group (300-500 mmol / L mixed salt), with *** indicating highly significant differences (P<0.001); B is a bar chart showing the distribution frequency of the SNP2 (Hic_asm_7:9,546,042) genotype in the control group (0 mmol / L mixed salt) and the high-salt group (300-500 mmol / L mixed salt), with *** indicating highly significant differences (P<0.001); C is a graph showing the TPM expression trend of the SS00072 gene under six salt concentrations (0-500 mmol / L); and D is a graph showing the TPM expression trend of the SS32525 gene under six salt concentrations (0-500 mmol / L). Trend of TPM expression level under treatment with mmol / L. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] Example 1: Haloxylon ammodendron material cultivation and salt stress treatment Haloxylon ammodendron seeds were collected from Wuwei City, Gansu Province (37°9′ N, 102°6′ E), and after surface disinfection, they were sown in nutrient soil and cultured until the seedling stage for salt stress treatment.

[0027] Referring to the salt composition ratio in natural saline-alkali soil, mixed salt solutions were prepared. Based on the molar ratio, the salts were grouped into six concentration gradients: NaCl:Na₂SO₄:NaHCO₃:Na₂CO₃ = 1:18:18:1. These solutions had total concentrations of 0 mmol / L, 100 mmol / L, 200 mmol / L, 300 mmol / L, 400 mmol / L, and 500 mmol / L. The 0 mmol / L mixed salt solution (i.e., water) treatment served as the control group, the 100 mmol / L salt solution treatment as the low-salt group, the 200 mmol / L salt solution treatment as the medium-salt group, and the 300-500 mmol / L salt solution treatment as the high-salt group.

[0028] Fifty-four uniformly grown 4-month-old Haloxylon ammodendron seedlings were selected and randomly divided into 18 groups, with 3 biological replicates in each group. A continuous salt stress gradient was constructed by irrigating with mixed salt solutions of different concentrations. Samples were collected at three time points (7, 21, and 30 days), resulting in a total of 54 samples (6 concentrations × 3 time points × 3 replicates). Shoot tip tissues of the Haloxylon ammodendron seedlings were collected, immediately flash-frozen in liquid nitrogen, and stored at -80℃ for later use.

[0029] The electrical conductivity (EC) and pH of the soil were measured to ensure stability under salt treatment.

[0030] Example 2: Transcriptome Sequencing and Data Analysis Total RNA was extracted from the shoot tip tissue sample preserved in Example 1 using a modified CTAB method. RNA concentration and purity were measured using a NanoDrop spectrophotometer, and RNA integrity was measured using an Agilent 2100 bioanalyzer to ensure that the RNA quality met sequencing requirements.

[0031] cDNA libraries were constructed using the NEBNext Ultra RNA Library Prep Kit, and sequenced after passing quality checks. Paired-end sequencing was performed using the Illumina NovaSeq 6000 platform, with approximately 6 Gb of sequencing data per sample and a Q30 base ratio greater than 95%, indicating excellent sequencing quality.

[0032] Low-quality reads were filtered and adapter sequences were removed using FASTP software. Clean reads were then aligned to the *Haloxylon ammodendron* reference genome using HISAT2 software, with an alignment rate of 80.51%-85.51%. Transcript assembly and gene expression quantification were performed using StringTie software, identifying a total of 41,647 genes. SNP calling was performed using GATK software, followed by rigorous quality filtering, yielding 6,800,000 high-quality SNP loci. Figure 1 The data showed that 99% of the SNP sites had a missing rate of less than 10%, indicating excellent data quality.

[0033] All raw transcriptome sequencing data have been submitted to the National Gene Bank Life Big Data Center (CNGB), accession number CRA025663, and are publicly available.

[0034] Example 3: Candidate gene screening and SNP marker identification Differentially expressed genes under different salt concentrations were analyzed using DESeq2 software. The results showed that day 21 was the critical time point for salt stress response, with a total of 4,533 differentially expressed genes identified, significantly more than on days 7 and 30. Therefore, data from day 21 were selected for subsequent analysis.

[0035] Weighted co-expression network analysis (WGCNA) was performed on 19,399 expressed genes, identifying 17 co-expression modules. Module-trait association analysis identified three modules significantly associated with salt stress (ME4, ME6, and ME9), from which 2,981 candidate genes were extracted. Figure 2 (A)

[0036] The control group and the low-salt group were compared using VCFtools software. Figure 2 Group B), Group C ( Figure 2 (Medium C), High Salt Group ( Figure 2 The population differentiation index FST between the middle and lower reaches of the gene (D) was used to screen highly differentiated SNP sites within a 5 kb range upstream and downstream of the gene as candidate markers.

[0037] The intersection of WGCNA candidate genes and FST candidate genes yielded two key genes, SS00072 and SS32525. Figure 2 (E). It is worth noting that this embodiment demonstrates the necessity and efficiency of the dual screening strategy. Although WGCNA analysis alone screened 2,981 candidate genes related to the salt tolerance module, the scope was still too large to be directly used for molecular breeding; although FST analysis alone found a large number of differentiation sites, it lacked functional expression support. Only through the dual filtering strategy designed in this invention can the candidate range be drastically narrowed from 6.8 million SNPs in the whole genome to only 2 key SNP sites (a screening ratio of approximately one in three million). This strategy effectively eliminates a large number of non-linked random variations and non-functional expression differences, ensuring that the finally obtained SNP1 and SNP2 are the key functional sites that truly regulate the salt tolerance of Haloxylon ammodendron.

[0038] The SNP1 site is associated with the gene SS00072, located at positions 1, 151, and 163 on chromosome Hic_asm_0, with base variations from A to G, and is located 816 bp downstream of the SS00072 gene, with an average FST of 0.764. The SNP1 site was developed into a molecular marker, SNP1, whose nucleotide sequence is shown in SEQ ID NO.1, with a length of 391 bp. The R at position 252 indicates polymorphism, which is either A or G, and the genotype is AA, AG, or GG.

[0039] SEQ ID NO.1: TCCCTAAATCGGACAATACTGAAATCGATACCTAGGATTATTGCTTGCAATCAATTACTTACAGTAATACTGACTGCTGAAAATGCACCATTGTAGTTTCCCAATTTATAAGCAACCATCAATGATCAGTAATCAGCAGATCAATTCAGCTACTATTTGCACAATTATCATGTTGTACATTTGTATATCATATATT GCAGATACAATGCTGGGACTTTCAGAGTAAGCTCAAGTGTGAAGTTATGTTTGGGRCTATCAGGAAAGAAAATACTGAAATTTGTGCATAATGATCATTTCTTATTCTGTATAGGGCTCTTAATTTCATATAGATGTAACCAATTTTTAGATATATTAGTGTGCTAAAGCAACAATGTCGTCGGATTATCAAGTC.

[0040] SNP2 is associated with the gene SS32525, located at position 9,546,042 on chromosome Hic_asm_7, with a base variation of C to T, situated 2,400 bp upstream of the SS32525 gene, and an average FST of 0.619. SNP2 was developed into a molecular marker, SNP2, with its nucleotide sequence shown in SEQ ID NO.2, a length of 211 bp. The Y at position 112 indicates polymorphism, which can be C or T, and the genotype is CC, CT, or TT.

[0041] SEQ ID NO.2: ATCTGGAGCTTTTGTGCTCGAATATGACTATAGAAAACCACTACTTGCGGGATTGGTGATGGTTGTTTGTGGGACTGTTGGCAGTGGTGGTTCGTGGGGTGGCGGTGGAGGYTGGTGAGGTGGTTGTTTTGGGCTGTAATCCATGGTGTTGGTGGGTGATAGACTGTTGTAATTGGACTATGGTTATTGTCAACGGTGAGATTCATGTTTG.

[0042] The two SNPs, with quality scores of 1733.27 and 1080.98 respectively, both passed the filter and were identified as the core molecular markers of this invention. Functional annotation results showed that SS00072 and SS32525 are both genes encoding chitinase. This identification result was unexpected and has important biological significance, as chitinase is generally considered to be involved only in plant disease resistance responses. However, this embodiment, through a rigorous dual-screening strategy, confirmed that specific allelic variations (A and C alleles) of these two chitinase genes are significantly positively correlated with the high salt tolerance phenotype of Haloxylon ammodendron (FST as high as 0.764 and 0.619, respectively). This means that this invention has discovered a unique salt tolerance regulatory mechanism in Haloxylon ammodendron that differs from traditional ion transport pathways. This discovery, which unexpectedly extends the function of "disease resistance genes" to "salt tolerance identification," breaks the existing understanding of chitinase function and confirms that the SNP markers have unexpected technical effects in identifying the salt tolerance of Haloxylon ammodendron.

[0043] Further analysis of the expression patterns of the two candidate genes, SS00072 gene ( Figure 3 (C) and SS32525 gene ( Figure 3 The expression of both genes (D) under different salt concentrations showed changes in response to salt stress, confirming that the two genes are involved in the regulation of salt tolerance in Haloxylon ammodendron.

[0044] Example 4: Validation of the association between SNP markers and salt tolerance Genotype information of SNP1 and SNP2 was extracted from the VCF file obtained in Example 2, and the genotype distribution of all 54 samples was statistically analyzed.

[0045] The genotype distribution of SNP1 (Hic_asm_0:1,151,163) is as follows: AA (reference homozygous) 46 samples, accounting for 85.2%; GG (variant homozygous) 8 samples, accounting for 14.8%; AG (heterozygous) 0 samples, accounting for 0%.

[0046] The genotype distribution of SNP2 (Hic_asm_7:9,546,042) is as follows: CC (reference homozygous) 42 samples, accounting for 77.8%; CT (heterozygous) 5 samples, accounting for 9.3%; TT (variant homozygous) 7 samples, accounting for 13.0%.

[0047] To further verify the association between genotype and salt tolerance phenotype, the control group (0 mmol / L mixed salt, 9 samples) and the high-salt group (300-500 mmol / L mixed salt, 27 samples) with the most significant phenotypic differences were selected from the above 54 samples for comparative analysis.

[0048] The results showed that the AA genotype of SNP1 was significantly enriched in the high-salt group (26 / 27, 96.3%), while it accounted for only 22.2% (2 / 9) in the control group; conversely, the GG genotype accounted for 77.8% (7 / 9) in the control group and only 3.7% (1 / 27) in the high-salt group (see...). Figure 3 (A)

[0049] The CC genotype of SNP2 was significantly enriched in the high-salt group (25 / 27, 92.6%), but completely undetectable in the control group (0%); conversely, the TT genotype accounted for 66.7% (6 / 9) in the control group, but was completely absent in the high-salt group. Furthermore, the five heterozygous (CT) genotypes of SNP2 detected in both groups were mainly distributed in the control group (3, 33.3%) and the high-salt group (2, 7.4%) (see...). Figure 3 (B)

[0050] Chi-square test analysis was used to analyze the association between genotype and salinity environment. The results showed that the SNP1 genotype and the SNP2 genotype were both highly significantly associated with salinity environment (P<0.001). Further comparative analysis of the identification power of the two markers revealed (see...) Figure 3 China A and Figure 3 The two methods (SNP1 and SNP2) exhibit significant complementary advantages: While using SNP1 (AA genotype) alone achieves a detection rate (sensitivity) as high as 96.3% in the high-salt group, a false positive rate of 22.2% still exists in the non-stress control group, easily leading to misselection. Similarly, using SNP2 (CC genotype) alone, although the false positive rate in the control group is 0% (extremely high specificity), its detection rate in the high-salt group (92.6%) is slightly lower than that of SNP1. However, when employing the combined strategy described in this invention (i.e., simultaneously detecting SNP1 and SNP2 and identifying the AA+CC genotype combination), the high specificity of SNP2 successfully eliminates the false positive rate in the control group to 0%, while maintaining a high capture rate of 92.6% for salt-tolerant plants.

[0051] The results showed that the SNP combination had a significant synergistic complementary effect and could identify the salt tolerance of Haloxylon ammodendron more accurately and reliably than a single site, and could be used as an effective molecular marker combination.

[0052] Example 5: SNP detection primer design and detection method Primers were designed using Primer3 software based on the sequences of SNP molecular markers SNP1 and SNP2, resulting in the following primer pairs: SNP1 detection primer pair: Forward primer SNP1-F: 5'-TCCCTAAATCGGACAATACTGAAATCGA-3', SEQ ID NO.3; Reverse primer SNP1-R: 5'-GACTTGATAATCCGACGACATTGTTG-3', SEQ ID NO.4; SNP2 detection primer pair: Forward primer SNP2-F: 5'-ATCTGGAGCTTTTGTGCTCGAATATG-3', SEQ ID NO.5; Reverse primer SNP2-R: 5'-CAAACATGAATCTCACCGTTGACAATAACC-3', SEQ ID NO.6.

[0053] The PCR amplification reaction system (25 μL) consisted of: 12.5 μL of 2×PCR Master Mix, 1.0 μL of forward primer, 1.0 μL of reverse primer, 2.0 μL of genomic DNA, and 8.5 μL of ddH2O.

[0054] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

[0055] The SNP markers of this invention can be used for genotyping using Sanger sequencing. Genomic DNA is extracted from the *Haloxylon ammodendron* sample to be tested, and PCR amplification is performed using primers shown in SEQ ID NO.3-SEQ ID NO.6. The amplified products are purified and sequenced, and the genotype is determined by comparing the sequencing peak diagram. Homozygous genotypes show a single base peak at the SNP site in the sequencing peak diagram, while heterozygous genotypes show overlapping double peaks.

[0056] The interpretation criteria are as follows: Haloxylon ammodendron plants with the genotype AA for SNP1 molecular markers have stronger salt tolerance than those with the genotype GG; Haloxylon ammodendron plants with the genotype CC for SNP2 molecular markers have stronger salt tolerance than those with the genotype TT; and Haloxylon ammodendron plants with the genotype combination of AA and CC have the strongest salt tolerance.

[0057] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A combination of SNP molecular markers for identifying the salt tolerance of Haloxylon ammodendron, characterized in that, It consists of SNP1 and SNP2; The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, and there is an A > G mutation at position 252 of the nucleotide sequence shown in SEQ ID NO.1, with a genotype of AA, AG or GG. The nucleotide sequence of the SNP2 is shown in SEQ ID NO.2, and there is a C > T mutation at position 112 of the nucleotide sequence shown in SEQ ID NO.2, with a genotype of CC, CT or TT.

2. A primer combination for amplifying the SNP molecular marker combination of claim 1, characterized in that, This includes SNP1-F with nucleotide sequences as shown in SEQ ID NO.3, SNP1-R with nucleotide sequences as shown in SEQ ID NO.4, SNP2-F with nucleotide sequences as shown in SEQ ID NO.5, and SNP2-R with nucleotide sequences as shown in SEQ ID NO.

6.

3. The application of the primer combination according to claim 2 in the preparation of a product for detecting the salt tolerance of Haloxylon ammodendron.

4. A product for identifying the salt tolerance of Haloxylon ammodendron, characterized in that, Includes the primer combination described in claim 2.

5. The use of the primer combination of claim 2 or the product of claim 4 in identifying the salt tolerance of Haloxylon ammodendron.

6. A method for identifying the salt tolerance of Haloxylon ammodendron, characterized in that, Includes the following steps: Genomic DNA was extracted from the *Haloxylon ammodendron* plant to be tested; The genomic DNA was amplified by PCR using the primer combination described in claim 2 to obtain the amplification product. The amplification products are detected to determine the genotypes of SNP1 and SNP2 as described in claim 1; If the genotype of SNP1 is AA and the genotype of SNP2 is CC, then the tested Haloxylon ammodendron is identified as having high salt tolerance. If the genotype of SNP1 is GG and the genotype of SNP2 is TT, then the tested Haloxylon ammodendron has low salt tolerance.

7. The method as described in claim 6, characterized in that, The method for detecting the amplified product is Sanger sequencing.

8. The application of the primer combination of claim 2 or the product of claim 4 in the salt tolerance breeding of Haloxylon ammodendron.

9. A method for breeding salt-tolerant Haloxylon ammodendron, characterized in that, Includes the following steps: Genomic DNA was extracted from the *Haloxylon ammodendron* plant to be tested; The genomic DNA was amplified by PCR using the primer combination described in claim 2 to obtain the amplification product. The amplification products are detected to determine the genotypes of SNP1 and SNP2 as described in claim 1; If the genotype of SNP1 is AA and the genotype of SNP2 is CC, then the tested Haloxylon ammodendron will be retained for breeding.

10. The breeding method as described in claim 9, characterized in that, The method for detecting the amplified product is Sanger sequencing.

Images