Primer of a molecular marker closely linked to wheat powdery mildew resistance gene PmDR155 and application thereof

Abstract

This invention relates to the field of bioengineering technology, specifically to a gene for wheat resistance to powdery mildew. PmDR155 Primers for tightly linked molecular markers and their applications. This molecular marker is... Henu2422 The upstream primer nucleotide sequence of this molecular marker is shown in SEQ ID NO:1; the downstream primer nucleotide sequence is shown in SEQ ID NO:2; molecular markers are used. Henu2422 The primers were used to amplify the wheat genomic DNA to be tested by PCR, and the corresponding amplification product band was 127 bp in size, which is the band corresponding to the wheat powdery mildew resistance gene. PmDR155 Tightly linked molecular markers. This invention provides a marker associated with wheat powdery mildew resistance genes. PmDR155 Closely linked molecular markers Henu2422 It can detect accurately and efficiently. PmDR155 Genetic mapping population; using this marker for PmDR155 Molecular marker-assisted selection can improve breeding efficiency.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to a gene for wheat resistance to powdery mildew. PmDR155 Primers for tightly linked molecular markers and their applications. Background Technology

[0002] High and stable wheat yields are of great significance to my country's food security. This is due to *Brucea balsamina* (a type of powdery mildew fungus). Blumeria graminis f. sp. Tritici , Bgt Powdery mildew, caused by pathogen infection, severely impacts wheat yield and quality. Breeding and promoting resistant varieties is the most economical, effective, and environmentally friendly measure to control this disease. However, in practice, resistance genes gradually lose their effectiveness as the pathogen evolves and new virulent races emerge. Therefore, continuously discovering new resistance genes and cloning them is of great significance for breeding durable resistant varieties.

[0003] Wild wheat germplasm resources contain abundant resistance genes, and systematically mining and utilizing their superior alleles is an important way to improve wheat disease resistance. Durum wheat (… Triticum durum Desf., as a close relative of common wheat, has rich genetic diversity and is an important gene donor for improving agronomic traits such as resistance to powdery mildew and rust in wheat.

[0004] The durum wheat variety Jing DR155 possesses excellent agronomic traits and has demonstrated high levels of powdery mildew resistance in multi-year, multi-location field evaluations, making it a superior powdery mildew-resistant germplasm resource. Seedling-stage resistance genetic analysis revealed that Jing DR155's resistance to the prevalent powdery mildew strain E09 is due to a pair of dominant genes located on chromosome 2BL. PmDR155 This gene is a newly discovered powdery mildew resistance gene / allele, and its closely linked molecular markers have not yet been reported. Therefore, development and... PmDR155 The identification of tightly linked molecular markers and their application in marker-assisted selection breeding of these genes is of great significance for breeding new wheat varieties resistant to powdery mildew and achieving effective control of powdery mildew. Summary of the Invention

[0005] The purpose of this invention is to provide a gene for resistance to powdery mildew in wheat. PmDR155 Primers for tightly linked molecular markers and their applications to utilize these markers to target wheat powdery mildew resistance genes. PmDR155 Gene localization and detection are performed. This marker is used for... PmDR155 Molecular marker-assisted selection can shorten the breeding cycle, improve breeding efficiency, and be better applied to wheat disease resistance breeding.

[0006] This invention is achieved through the following method: a gene associated with wheat powdery mildew resistance. PmDR155 Primers for tightly linked molecular markers and their applications, whereby the molecular marker is associated with... PmDR155 Closely linked INDEL tags Henu2422 ; The molecular marker Henu2422 The upstream primer is Henu2422-F, and its nucleotide sequence is as follows: 5'-ACAGCTCCCAACCAACTCTT-3', as shown in SEQ ID NO: 1; The molecular marker Henu2422 The downstream primer is Henu2422-R, and its nucleotide sequence is as follows: 5'-ATCGTGATGACGTTGCACAT-3', as shown in SEQ ID NO: 2; Using molecular markers Henu2422 The labeled primers were used to amplify the wheat genomic DNA to be tested by PCR, and the corresponding amplification product band was 127 bp in size, which is the band corresponding to the wheat powdery mildew resistance gene. PmDR155 Tightly linked molecular markers.

[0007] The appropriate PCR amplification system for this molecular marker is 10 μL, comprising: 1.0 μL of 50 ng / μL wheat genomic DNA, 4.0 μL of PCR MasterMix, 0.25 μL of 5 μM upstream primer, 0.25 μL of 5 μM downstream primer, and 4.5 μL of sterile deionized water.

[0008] The applicable PCR amplification program for this molecular marker is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 10 min; store at 4℃.

[0009] The electrophoretic separation procedure for the amplification products applicable to this molecular marker is as follows: electrophoresis is performed using an 8% non-denaturing polyacrylamide gel. The amplification product is mixed with 2.0 μL of 10× Loading Buffer, and 1.0 μL of the mixture is loaded onto the gel. Electrophoresis is performed at a constant voltage of 170 V for 1.5-2 h. The gel is then stained with silver nitrate and photographed.

[0010] The wheat powdery mildew resistance gene provided by this invention PmDR155 Primers for tightly linked molecular markers in wheat powdery mildew resistance genes PmDR155 Applications of gene mapping, map-based cloning, and molecular marker-assisted selection breeding.

[0011] The application described in this invention is to detect whether a wheat variety carries a gene for resistance to powdery mildew. PmDR155 The main steps include: (1) Extract genomic DNA from fresh leaves of the wheat sample to be tested; (2) Use of molecular markers Henu2422 The extracted wheat genomic DNA was amplified by PCR using primers to obtain the amplification product; (3) If a specific band of 127 bp can be amplified, it indicates that the powdery mildew resistance gene exists in the wheat being tested. PmDR155 Otherwise, the wheat sample tested does not contain the wheat powdery mildew resistance gene. PmDR155 .

[0012] The application described above, step (2) involves the molecular marker. Henu2422 The primers include an upstream primer Henu2422-F and a downstream primer Henu2422-R. The nucleotide sequence of the upstream primer Henu2422-F is shown in SEQ ID NO:1, namely: Henu2422-F: 5'-ACAGCTCCCAACCAACTCTT-3'; the nucleotide sequence of the downstream primer Henu2422-R is shown in SEQ ID NO:2, namely: Henu2422-R: 5'-ATCGTGATGACGTTGCACAT-3'.

[0013] The application of this molecular marker is based on a 10 μL PCR amplification system, which includes: 1.0 μL of 50 ng / μL wheat genomic DNA, 4.0 μL of PCR MasterMix, 0.25 μL of 5 μM upstream primer, 0.25 μL of 5 μM downstream primer, and 4.5 μL of sterile deionized water.

[0014] The applicable PCR amplification program for this marker is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 10 min; store at 4℃.

[0015] Detection of PCR amplification products: Electrophoresis was performed using an 8% non-denaturing polyacrylamide gel. The amplification product was mixed with 2.0 μL of 10× Loading Buffer, and 1.0 μL of this mixture was loaded onto the gel. Electrophoresis was carried out at a constant voltage of 170 V for 1.5–2 h. The gel was then stained with silver nitrate and photographed. The electrophoresis results were used for interpretation. If a specific band of 127 bp was amplified, it indicated the presence of a powdery mildew resistance gene in the tested wheat germplasm. PmDR155 Otherwise, the wheat germplasm tested does not contain the wheat powdery mildew resistance gene. PmDR155 .

[0016] The present invention, through genetic analysis of powdery mildew resistance at the seedling stage and molecular marker detection, shows that the resistance of emmer wheat Jing DR155 to the prevalent powdery mildew isolate E09 at the seedling stage is controlled by a single dominant gene, and this gene is designated as PmDR155 . 110 pairs of molecular markers evenly distributed across the whole genome were used to perform polymorphism detection on the resistant pool and susceptible pool composed of 10 homozygous resistant lines and 10 homozygous susceptible lines from emmer wheat Jing DR155, susceptible wheat Langdon (LDN) and the F 2:3 population, 24 pairs of markers showed consistent polymorphism in the resistant / susceptible parents and the resistant / susceptible pools, then these markers were used for genotyping 118 F 2:3 lines of Jing DR155×LDN, and the PmDR155 was initially located in the interval of 718.80-739.11 Mb (IWGSC RefSeq v2.0) on wheat chromosome 2BL. Further, based on the sequence of the Chinese Spring wheat reference genome in this interval, the primer5.0 software was used to design and screen to obtain INDEL markers closely linked to the gene PmDR155 Henu2422 . The molecular marker PmDR155 of the wheat powdery mildew resistance gene Henu2422 provided by the present invention has been tested by a genetic segregation population, co-segregates with the gene PmDR155 , which can detect the genetic mapping population of PmDR155 more accurately and efficiently, and is beneficial to the map-based cloning and localization of PmDR155 .

[0017] The present invention provides a molecular marker closely linked to the wheat powdery mildew resistance gene PmDR155 and an application thereof. When applied in powdery mildew resistant wheat breeding, it can not only greatly save costs and shorten the breeding cycle, but also is more accurate and efficient, and can be better applied to the work of powdery mildew resistant wheat breeding. Brief Description of the Drawings

[0018] Figure 1 shows partial amplification results of the marker Henu2422 in 118 F 2:3 lines derived from Jing DR155×LDN.

[0019] In the figure: M: D2000; R: Jing DR155 (resistant parent); S: LDN (susceptible parent); RH, mixed pool of 15 homozygous resistant individuals in the F2 generation of Jing DR155×LDN; SH, mixed pool of 15 homozygous susceptible individuals in the F2 generation of Jing DR155×LDN; 1-24: F 2:3 ​Family pedigrees, where 1-6: homozygous resistant pedigrees, 19-24: homozygous susceptible pedigrees, and 7-18: segregating resistant and susceptible pedigrees; arrows indicate... PmDR155 Specific bands.

[0020] Figure 2 molecular markers Henu2422 Amplification results in 24 susceptible wheat materials.

[0021] In the diagram, M: D2000; R: Jing DR155 (disease-resistant parent); S: LDN (susceptible parent); 1-24: Luomai 21, Xinmai 296, Zhengyumai 9989, Chuanmai 42, Linhan 917, Xuzhou 21, Jinghong 5, Neimai 11, Jinchun 3, Zhongyou 9507, Jinmai 8, Changzhi 6406, Beijing 8, Yuandong 822, Lühan 328, Nongda 183, Nongda 139, Mingxian 169, Yangmai 158, Enmai 4, Jinmai 4, Dingxi 24, Huining 10, Guinong 10; the arrows indicate... PmDR155 Specific bands. Detailed Implementation

[0022] The following examples are provided to better understand and use the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials and reagents used in the examples are commercially available.

[0023] Example 1: Wheat powdery mildew resistance gene PmDR155 Molecular markers Henu2422 development 1. Materials The resistant parent is cultivated emmer wheat Jing DR155, and the susceptible parent is durum wheat LDN. Jing DR155 and LDN are crossed, and the resulting F1 generation is self-crossed to obtain the F2 population.

[0024] 2. Extraction of wheat genomic DNA Wheat genomic DNA was extracted using the CTAB method, and the procedure is as follows: (1) Take tender fresh leaves of wheat to be tested, freeze them quickly with liquid nitrogen, grind them into powder, and put them into 2 mL EP tubes; (2) Add 600-800 μL of CTAB extraction solution and incubate in a 65°C water bath for 1 h, inverting and mixing every ten minutes during the process; (3) Add an equal volume of chloroform and mix on a shaker for 30 min; (4) Centrifuge at 8000 rpm at room temperature for 10 min, take 400 μL of supernatant into a 1.5 mL EP tube, add 3 times the volume of pre-cooled 95% ethanol, mix well, and let settle at -20°C for 0.5 h; (5) Centrifuge at 12000 rpm for 10 min at room temperature, discard the supernatant, and add 800 μL of 75% ethanol to wash 3 times; (6) Air-dry the precipitate, and add 50 μL of 1×TE or ddH₂O for dissolution.

[0025] (7) Dilute the DNA stock solution to 50 ng / μL with sterile deionized water to prepare a working solution for later use.

[0026] 3. Identification of powdery mildew resistance at wheat seedling stage and genetic analysis of resistance The identification of powdery mildew resistance at the wheat seedling stage is completed in a greenhouse. The disease-resistant parent Jing DR155, the susceptible parent LDN, the F₁ hybrid, and the F₂ population are planted in 128-well plug trays (3.2×3.2×4.2 cm). At least 20 seeds are identified for each of the parents and F₁, and each F 2:3 family line is identified with at least 20 seeds. The susceptible control Tainong 18 is sown randomly and labeled for distinction. The greenhouse conditions are controlled at 18-20°C, with a relative humidity of 80% and a photoperiod of 14 h light / 10 h dark. At the one-leaf stage, the powdery mildew isolate E09 is inoculated by the brushing method. 10-17 days later, when the susceptible control Tainong 18 is fully diseased, the phenotypes are investigated. The reaction type is recorded according to the 0-4 grade standard. Disease resistance classification: grades 0-2 are resistant types, and grades 3-4 are susceptible types.

[0027] The survey results show that Jing DR155 shows high resistance to powdery mildew isolate E09, LDN shows high susceptibility, and all F₁ plants show disease resistance, indicating that Jing DR155 carries a dominant resistance gene; resistance identification is performed on the F₂ population of this combination, and the results show that its resistance-susceptibility segregation ratio is 94:24, and the chi-square test conforms to the 3:1 segregation ratio of a single dominant gene (χ 2 =1.37, P =0.24). Further identification of the F 2:3 family lines shows that the segregation ratio of homozygous resistant, segregating for resistance and susceptibility, and homozygous susceptible family lines is 33:61:24, and the chi-square test conforms to the 1:2:1 segregation ratio of a single dominant gene (χ 2 =1.51, P =0.47). In summary, the resistance of Jing DR155 to powdery mildew isolate E09 is controlled by a single dominant gene, and this powdery mildew resistance gene is named PmDR155 .

[0028] 4. PmDR155 Molecular marker mapping of According to the phenotypic identification results, 10 homozygous disease-resistant families and 10 homozygous disease-susceptible families were selected respectively to construct a disease-resistant pool and a disease-susceptible pool. 110 pairs of molecular markers evenly distributed across the whole genome were used to detect polymorphisms in cultivated emmer wheat Jing DR155, durum wheat LDN, and the disease-resistant and disease-susceptible pools. 24 pairs of markers showed consistent polymorphisms in the resistant / susceptible parents and the resistant / susceptible pools. These markers were then used for genotyping 118 F2 populations derived from Jing DR155 × LDN, and PmDR155 was mapped to the interval of 718.80-739.11 Mb (IWGSC RefSeq v2.0) on wheat chromosome 2BL.

[0029] 5. Development of molecular markers tightly linked to PmDR155 Based on the sequence information of the Chinese Spring wheat reference genome within this candidate interval of 718.80-739.11 Mb, Primer 5.0 software was used to design INDEL markers, which were applied to the F 2:3 families for genotyping, and INDEL markers tightly linked to the gene PmDR155 were obtained Henu2422 , which were co-segregated with the gene PmDR155 .

[0030] The primers for molecular marker Henu2422 include one forward primer and one reverse primer: The nucleotide sequence of forward primer Henu2422-F: 5'- ACAGCTCCCAACCAACTCTT -3'; The nucleotide sequence of reverse primer Henu2422-R: 5'- ATCGTGATGACGTTGCACAT -3'.

[0031] The applicable PCR amplification system for this marker is 10 μL, comprising: 1.0 μL of 50 ng / μL wheat genomic DNA, 4.0 μL of PCR MasterMix, 0.25 μL of 5 μM forward primer, 0.25 μL of 5 μM reverse primer, and 4.5 μL of sterile deionized water.

[0032] The applicable PCR amplification procedure for this marker is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 40 s, 35 cycles; final extension at 72°C for 10 min; storage at 4°C.

[0033] ​The electrophoretic separation procedure for the amplified products is as follows: Electrophoresis is performed using an 8% non-denaturing polyacrylamide gel. The amplified product is mixed with 2.0 μL of 10× Loading Buffer, and 1.0 μL of this mixture is loaded onto the gel. Electrophoresis is carried out at a constant voltage of 170 V for 1.5–2 h. After silver nitrate staining, the sample is photographed. If a specific band of 127 bp is amplified, it indicates the presence of a powdery mildew resistance gene in the tested wheat germplasm. PmDR155 Otherwise, the wheat germplasm tested does not contain the wheat powdery mildew resistance gene. PmDR155 .

[0034] Molecular marker detection results are shown below Figure 1 .in Figure 1 For marking Henu2422 In 118 Beijing DR155×LDN derived F 2:3 Partial amplification results within the family. In the figure, M: D2000; R: JingDR155 (resistant parent); S: LDN (susceptible parent); RH: a pool of 15 homozygous resistant individuals from the F2 generation of JingDR155×LDN; SH: a pool of 15 homozygous susceptible individuals from the F2 generation of JingDR155×LDN; 1-24: F2 generation of JingDR155×LDN. 2:3 Family pedigrees, where 1-6: homozygous resistant pedigrees, 19-24: homozygous susceptible pedigrees, and 7-18: segregating resistant and susceptible pedigrees; arrows indicate... PmDR155 Specific bands. Amplification results show the markers. Henu2422 The primer combination amplified a specific band of 127 bp in the resistant parent DR155 and the resistant family, while the band size amplified in the susceptible parent LDN and the susceptible family was 134 bp, meaning that the target band was not amplified.

[0035] wheat powdery mildew resistance gene PmDR155 Derived from the wheat material *Erinum jing* DR155, this gene has not yet been reported in terms of localization, map-based cloning, or molecular breeding, nor has it been reported to contain closely linked molecular markers, thus demonstrating significant innovation. The molecular markers provided by this invention... Henu2422 Conducting genetic mapping tests on large populations is helpful for gene sequencing. PmDR155 Location and map cloning. (The rest of the text appears to be incomplete and requires further context.) PmDR155 After being introduced into major wheat varieties susceptible to powdery mildew, the molecular markers developed in this invention were used. Henu2422 It can efficiently and accurately detect large breeding populations, greatly improving the transfer of disease-resistant genes. PmDR155 The efficiency and accuracy of this are crucial for gene sequencing. PmDR155 The efficient transfer and breeding of these organisms is of great significance.

[0036] 6. Molecular marker-assisted selection Using the molecular markers provided by this invention Henu2422 Molecular marker-assisted selection (MAS) was performed on 24 wheat materials susceptible to powdery mildew. The results are shown below. Figure 2 molecular markers Henu2422 Amplification results in 24 susceptible wheat materials. In the figure, M: D2000; R: Jing DR155 (resistant parent); S: LDN (susceptible parent); 1-24: Luomai 21, Xinmai 296, Zhengyumai 9989, Chuanmai 42, Linhan 917, Xuzhou 21, Jinghong 5, Neimai 11, Jinchun 3, Zhongyou 9507, Jinmai 8, Changzhi 6406, Beijing 8, Yuandong 822, Lühan 328, Nongda 183, Nongda 139, Mingxian 169, Yangmai 158, Enmai 4, Jinmai 4, Dingxi 24, Huining 10, Guinong 10; arrows indicate... PmDR155 Specific bands. Amplification results show the markers. Henu2422 No specific band of 127 bp was amplified in the above-mentioned infected materials.

[0037] The above embodiments are optimized implementations of the present invention and are used only to illustrate the present invention, not to limit it. Modifications or equivalent substitutions made by those skilled in the art without departing from the spirit and principles of the embodiments of the present invention are all within the scope of protection claimed by the present invention.

Claims

1. A gene associated with wheat powdery mildew resistance PmDR155 Primers with tightly linked molecular markers, characterized in that, The molecular marker is Henu2422 The primers comprise an upstream primer Henu2422-F and a downstream primer Henu2422-R. The nucleotide sequence of the upstream primer Henu2422-F is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer Henu2422-R is shown in SEQ ID NO:

2. PCR amplification of the wheat genomic DNA to be tested using these primers yielded an amplification product band of 127 bp, which is the band corresponding to the wheat powdery mildew resistance gene. PmDR155 Closely linked molecular markers Henu2422 .

2. The wheat powdery mildew resistance gene as described in claim 1 PmDR155 Primers with tightly linked molecular markers, characterized in that, The applicable PCR amplification system is 10 μL, which includes: 1.0 μL of 50 ng / μL wheat genomic DNA, 4.0 μL of PCR MasterMix, 0.25 μL of 5 μM upstream primer, 0.25 μL of 5 μM downstream primer, and 4.5 μL of sterile deionized water.

3. The wheat powdery mildew resistance gene as described in claim 1 PmDR155 Primers with tightly linked molecular markers, characterized in that, The applicable PCR amplification program is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 10 min; store at 4℃.

4. The primer combination according to any one of claims 1-3 in the wheat powdery mildew resistance gene PmDR155 Its application in gene mapping, map-based cloning, and molecular marker-assisted breeding for wheat resistance to powdery mildew.

5. The application according to claim 4, characterized in that, Testing whether the wheat variety to be tested carries the wheat powdery mildew resistance gene PmDR155 It mainly includes the following steps: (1) Extract genomic DNA from the wheat sample to be tested; (2) Use of molecular markers Henu2422 The primer combination was used to amplify the extracted wheat genomic DNA by PCR to obtain the amplification product; (3) Perform electrophoresis on the amplified products and judge based on the electrophoresis results. If the wheat DNA can amplify a specific band of 127 bp, it indicates that the wheat to be tested contains a powdery mildew resistance gene. PmDR155 Otherwise, the wheat sample tested does not contain the wheat powdery mildew resistance gene. PmDR155 .

6. The application according to claim 5, characterized in that, The molecular marker described in step (2) Henu2422 The primer combination includes an upstream primer Henu2422-F and a downstream primer Henu2422-R. The nucleotide sequence of the upstream primer Henu2422-F is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer Henu2422-R is shown in SEQ ID NO:

2.

7. The application according to claim 5, characterized in that, The PCR amplification system is the 10 μL system defined in claim 2, comprising: 1.0 μL of 50 ng / μL wheat genomic DNA, 4.0 μL of PCR MasterMix, 0.25 μL of 5 μM upstream primer, 0.25 μL of 5 μM downstream primer, and 4.5 μL of sterile deionized water.

8. The application according to claim 5, characterized in that, The PCR amplification program is the amplification program defined in claim 3: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.

Images