KASP molecular marker primer set for identifying salt-tolerant gene ospi3 / 4k3 mutant of rice and application thereof

Abstract

This invention discloses the identification of salt tolerance genes in rice. OsPi3 / 4k3 This invention relates to a primer set for KASP molecular markers in mutant rice and its applications, belonging to the field of molecular marker-assisted breeding technology. The primer set includes wild-type-specific FAM marker forward primers, mutant-type-specific HEX marker forward primers, and universal reverse primers. This invention targets rice salt tolerance genes. OsPi3 / 4k3 Allele-specific KASP markers were precisely designed at the 5' UTR region single-base C deletion mutation site. By optimizing the PCR reaction system and amplification program, wild-type homozygous and wild-type KASP markers can be efficiently and accurately distinguished. ospi3 / 4k3 The marker identifies three genotypes: homozygous and heterozygous. It offers stable genotyping, high specificity, high throughput, and low cost, enabling rapid identification of rice mutants and large-scale genotyping of salt-tolerant rice breeding populations. This provides an efficient molecular tool for research on the molecular mechanisms of rice salt tolerance and for molecular breeding improvement.

Description

Technical Field

[0001] This invention belongs to the field of rice molecular biotechnology and molecular marker-assisted breeding technology, specifically involving the identification of rice OsPi3 / 4k3 KASP molecular marker primer set for gene mutants and its application. Background Technology

[0002] Rice ( Oryza sativa Rice (L.) is an important food crop, but severe soil salinization severely restricts rice production. Discovering salt-tolerant genes and developing functional molecular markers are of great value for molecular breeding of salt-tolerant rice.

[0003] Our research group used CRISPR / Cas9 to obtain rice OsPi3 / 4k3 5' UTR region deletion mutant ospi3 / 4k3 The mutant OsPi3 / 4k3 The gene expression is significantly downregulated and it participates in the rice salt stress response, making it an important genetic material for the study of rice salt tolerance mechanism and salt tolerance breeding.

[0004] Traditional genotyping methods primarily employ PCR-electrophoresis and sequencing, which are cumbersome, have low throughput, and are insufficient to meet the rapid genotyping needs of large-scale breeding populations. KASP (Competitive Allele-Specific PCR) technology is a high-throughput, low-cost SNP / InDel genotyping technique that can perform high-throughput sample testing in 96-well and 384-well plates, providing accurate results and making it suitable for large-scale genotyping screening of breeding populations. Currently, there is no specific... ospi3 / 4k3 KASP functional molecular markers have been publicly reported. Summary of the Invention

[0005] The technical problem to be solved by this invention is: to provide a method for identifying rice salt tolerance genes. OsPi3 / 4k3 KASP molecular marker primer set for mutants and its applications. This aims to achieve high-throughput and rapid differentiation of wild-type homozygous, mutant homozygous, and heterozygous genotypes, overcoming the shortcomings of traditional detection methods such as low throughput and cumbersome operation. It can be used for mutant material identification and marker-assisted breeding of salt-tolerant rice.

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution: The first aspect of this invention provides a method for identifying rice salt tolerance genes. OsPi3 / 4k3 The KASP molecular marker primer set for the mutant consists of a wild-type specific forward primer as shown in SEQ ID NO.4, a mutant-type specific forward primer as shown in SEQ ID NO.5, and a reverse common primer as shown in SEQ ID NO.6; The sequence SEQ ID NO.4 is: GAAGGTGACCAAGTTCATGCTAGGAGAAAAACCAAGCGAACCC; The sequence SEQ ID NO.5 is: GAAGGTCGGAGTCAACGGATTGAGGAGAAAAACCAAGCGAACCA; The sequence SEQ ID NO.6 is: TACTGCTCCCGCACCCGCTG.

[0007] Furthermore, the 5' end of SEQ ID NO.4 carries a FAM fluorescent adapter sequence, and the 5' end of SEQ ID NO.5 carries a HEX fluorescent adapter sequence.

[0008] The second aspect of this invention provides a method for identifying rice salt tolerance genes. OsPi3 / 4k3 The mutant detection kit contains the aforementioned KASP molecular marker primer set.

[0009] Furthermore, it also includes KASP PCR reaction mix and sterile water.

[0010] The third aspect of this invention provides a method for identifying rice salt tolerance genes. OsPi3 / 4k3 The method for mutants or wild-types, using the primer set or the kit, includes the following steps: (1) Extract genomic DNA from the rice sample to be tested; (2) Using genomic DNA as a template, PCR amplification reaction was performed using the primer set to obtain PCR products; (3) The PCR products were detected using a fluorescence detection platform, and the fluorescence signal of the amplified products was read. The genotype was determined based on the obtained fluorescence signal: If only FAM fluorescence signal is detected, the rice sample under test is wild-type and exhibits salt sensitivity under salt stress. If only HEX fluorescence signal is detected, the rice sample to be tested is OsPi3 / 4k3 The homozygous mutant exhibits salt tolerance under salt stress conditions; If both FAM and HEX fluorescence signals are detected simultaneously, the rice sample to be tested is OsPi3 / 4k3 The heterozygous mutant of the gene exhibits salt sensitivity under salt stress conditions; The mutant OsPi3 / 4k3 The gene gDNA sequence is SEQ ID NO.7, and the wild-type... OsPi3 / 4k3 The gene gDNA sequence is SEQ ID NO.1.

[0011] Furthermore, the PCR reaction program was as follows: pre-denaturation at 94℃ for 15 min; annealing at 94℃ for 20 s, gradient annealing at 61-55℃ for 60 s, 10 cycles, with the annealing temperature decreasing by 0.6℃ in each cycle; annealing at 94℃ for 20 s, gradient annealing at 55℃ for 60 s, 26-30 cycles.

[0012] The fourth aspect of this invention provides the KASP molecular marker primer set, the kit, or the identification method for identifying rice salt tolerance genes. OsPi3 / 4k3 mutants or rice salt tolerance genes OsPi3 / 4k3 Applications of molecular marker breeding.

[0013] Beneficial effects of this invention: 1. This invention addresses OsPi3 / 4k3 Developing KASP codominant molecular markers at the 5' UTR deletion mutation site in the gene can differentiate between wild-type and homozygous genes in a single step. 、 The genotypes are homozygous, heterozygous, and the typing results are stable and reliable.

[0014] 2. Based on the KASP high-throughput PCR platform, it can realize the large-scale sample detection of 96 / 384-well plates without the need for agarose gel electrophoresis, which greatly improves the detection efficiency, reduces labor costs, and is suitable for large-scale genotype screening of breeding segregating populations.

[0015] 3. The marker is a functional molecular marker that directly targets the mutation site. It does not cause genetic recombination or exchange that would separate the marker from the target site. It has high identification accuracy and can be used for early identification by leaf sampling during the seedling stage, thus accelerating the breeding process of salt-tolerant rice. Attached Figure Description

[0016] Figure 1 Wild-type rice and OsPi3 / 4k3 Genotype identification results of gene 5' UTR single base deletion mutant; Figure 2 Wild type and OsPi3 / 4k3 mutant rice seedling stage OsPi3 / 4k3 A comparison chart of relative gene expression levels; Figure 3 Wild type under normal conditions and 8‰ salt stress conditions OsPi3 / 4k3 Phenotypic comparison of mutant rice seedlings (A) and survival rate statistics (B).

[0017] Figure 4 Detection of wild-type and KASP markers OsPi3 / 4k3 Genotyping diagram of mutant progeny; where × represents no signal in the sample; blue dots represent OsPi3 / 4k3 Salt-tolerant homozygous mutant materials; red dots represent homozygous NIP wild-type salt-sensitive lines; green dots represent heterozygous types. Detailed Implementation

[0018] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0019] Explanation of the sequence list: SEQ ID NO.1: SEQ ID NO.2: SEQ ID NO.3: MSPNLESHIKSQVPALLLRRFFGGAGRRRVFVQTETGCVLGMDLDRSDNAHTVKRRLQLALNVPTGETSLTFGDRVLENDLSFIRPDSPLLLTRNSINRSCSTPCLCPVSKDFEHKDRSGLVEMLGCSISCARVKRLVDDVVTAIRSGVDPVPIGSGLGGSYYFRNISGDRVAIVKPTDEEPFAPNNPKGFVGRALGQPGLKKSVRVGETGFREVAAYLLDHDNFANVPPTALVKITHSIFHINCPVNGGSPAHDQKQQVSSKIASFQQFIAHDFDASDHGTSSFPVAAVHRIGILDIRIFNTDRHAGNVLVRKLDGGTGRFGCQTELFPIDHGLCLPENLEDPYFEWIHWAQSSIPFSEEELEYIKNLDPMRDVAMLRRELPIIREACLRVLVLCTIFLKEAAASGLCLAEIGEMMTREFRGLEEEPSKLEVVCMEARRKLAEWEPYSPVIEQGEDMDFQFSLDMLGEYNDVIRSPRFNGLGAKGNGFRNPLSKLVESIDEDNDDDDGRSESSKRSSERVHSGGLKFPSADKSSGSNGSVHALNRSADEQLPSSVYFVRLSDMNAEEWNIFLEKFQELLKEALQERAAAAGQRMKQRLGTSCKF SEQ ID NO.4: GAAGGTGACCAAGTTCATGCTAGGAGAAAAACCAAGCGAACCC SEQ ID NO.5: GAAGGTCGGAGTCAACGGATTGAGGAGAAAAACCAAGCGAACCA SEQ ID NO.6: TACTGCTCCCGCACCCGCTG SEQ ID NO.7: SEQ ID NO.8 (target sequence of sgRNA): GAAAAACCAAGCGAACCCAG Example 1 OsPi3 / 4k3 Creation and identification of 5' UTR site-directed deletion mutants 1. Target site design and editing vector construction The Ensembl Plants database (http: / / plants.ensembl.org / index.html) contained information on rice. OsPi3 / 4k3 The gene, with its nucleotide sequence in the NIP of japonica rice shown in SEQ ID NO.1 and its cDNA sequence shown in SEQ ID NO.2, encodes a protein containing 605 amino acids, the sequence of which is shown in SEQ ID NO.3. (The last sentence appears to be incomplete and possibly refers to rice.) OsPi3 / 4k3 Using the gene sequence (SEQ ID NO.1) as a reference, and with the A position of the start codon ATG as position 0, the 5' UTR region located at position 473 upstream of ATG (C base) was selected as the editing target site. A specific CRISPR / Cas9 editing sgRNA sequence was designed. The designed sgRNA sequence was ligated into a rice-specific CRISPR / Cas9 vector to construct the targeted editing sgRNA. OsPi3 / 4k3 The gene editing recombinant vector for the 5' UTR region of the gene, wherein the target sequence of the sgRNA is shown in SEQ ID NO.8.

[0020] 2. Rice genetic transformation and mutant acquisition Using the conventional wild-type rice variety Nipponbare as the genetic transformation recipient material, the recombinant editing vector was introduced into wild-type rice callus tissue through Agrobacterium-mediated transformation. After resistance screening, differentiation, and rooting culture, T0 generation transgenic rice plants were obtained.

[0021] 3. Mutant Genotype Identification Genomic DNA was extracted from leaves of T0 generation plants. Specific detection primers were designed targeting the upstream and downstream regions of the editing target site. PCR amplification was performed, and the amplified products were sequenced. Sequencing results showed that genomic DNA was successfully obtained. OsPi3 / 4k3 Mutant plants with a single base deletion at position 473 upstream of gene ATG, mutant type OsPi3 / 4k3 The nucleotide sequence of the gene is shown in SEQ ID NO.7. Positive mutant plants were self-pollinated to obtain T1 and T2 generation lines. Genetically stable homozygous lines were obtained through sequential sequencing screening. OsPi3 / 4k3 The 5' UTR deletion mutant line was used for subsequent functional verification experiments.

[0022] Genotyping results as follows Figure 1As shown, compared to the wild type, the mutant exhibits a precise single-base C deletion at the target site, with no redundant mutations at other sites or fragment insertions. The mutation site is precise and the genetic background is clean.

[0023] Example 2: Mutant Rice Seedling Stage OsPi3 / 4k3 Gene expression level detection To verify the 5' UTR single base deletion mutation pair OsPi3 / 4k3 The effects of gene expression levels were investigated by qRT-PCR quantitative detection of gene expression levels in wild-type rice and homozygous mutant rice seedlings.

[0024] 1. Material processing: Select wild-type rice varieties with uniform growth and OsPi3 / 4k3 Mutant rice seeds were disinfected and germinated before being cultured hydroponically. When the seedlings reached the two-leaf-one-heart stage, they were divided into a normal culture group and a salt stress treatment group (treated with 150 mmol / L NaCl solution). After 24 hours of treatment, root and leaf tissues of rice seedlings were collected and stored by quick-freezing in liquid nitrogen.

[0025] 2. RNA Extraction and Quantitative PCR Detection: Total RNA was extracted from each sample using the Trizol method, and cDNA was synthesized by reverse transcription. The rice OsActin gene was used as an internal reference gene to design... OsPi3 / 4k3 Gene-specific quantitative primers were used for qRT-PCR detection to determine the levels of [genes] in each group of samples. OsPi3 / 4k3 The relative expression level of genes.

[0026] 3. Test Results: Results are as follows Figure 2 As shown, under normal culture conditions, the mutant rice seedling stage OsPi3 / 4k3 Gene expression levels were significantly lower in wild-type rice than in wild-type rice; under salt stress conditions, wild-type rice... OsPi3 / 4k3 Gene expression was significantly upregulated, while the mutant showed only a slight increase in expression. OsPi3 / 4k3 Gene expression levels were significantly downregulated. This demonstrates... OsPi3 / 4k3 A deletion mutation at position -473 C in the 5'UTR region of the gene can effectively inhibit the transcriptional expression of this gene during the rice seedling stage, and the inhibition effect is more significant under salt stress.

[0027] Example 3: Identification of salt tolerance phenotype in mutant rice seedlings To verify OsPi3 / 4k3 The regulatory effect of gene downregulation on salt tolerance in rice seedlings was investigated, and the seedling salt stress resistance phenotypes of wild-type and mutant rice were identified.

[0028] 1. Experimental treatment: Wild-type rice and homozygous mutant rice seedlings (two-leaf-one-heart stage) with uniform growth were divided into a control group (normal water culture) and a salt stress group (150 mmol / L NaCl hydroponic treatment). Each group had 3 biological replicates, with 30 seedlings in each replicate. The seedlings were cultured continuously for 7 days. The plant phenotypes were observed and relevant salt tolerance indicators were counted.

[0029] 2. Phenotypic observation results: such as Figure 3 As shown, under normal culture conditions, there were no significant differences in plant height, root growth, and leaf condition between wild-type and mutant rice seedlings, indicating that this 5' UTR single-base mutation does not affect the normal growth and development of rice. After salt stress treatment, wild-type rice seedlings showed obvious salt damage phenotypes such as yellowing and wilting of leaves, browning of roots, and growth retardation; while... OsPi3 / 4k3 The mutant rice seedlings had bright green leaves and robust root systems, and showed significantly less damage from salt stress than the wild type. Figure 3 (A in the middle).

[0030] 3. Statistical analysis of salt tolerance index: The index was statistically analyzed 7 days after salt stress treatment. The results are as follows: Figure 3 As shown: Under salt stress, the survival rate of rice seedlings in the mutant was more than 20% higher than that in the wild type, the biomass accumulation in both the aboveground and underground parts of the plant was significantly higher than that in the wild type, and the leaf wilting rate was significantly lower than that in the wild type. Figure 3 (B in the middle).

[0031] The above results confirm that: OsPi3 / 4k3 The gene is a negative regulator of salt tolerance in rice seedlings. Downregulating its expression through a 5' UTR single-base deletion mutation can significantly enhance the salt stress tolerance of rice seedlings without negatively affecting the normal growth agronomic traits of rice.

[0032] Example 4 OsPi3 / 4k3 Development of KASP molecular markers for mutants Primers were designed based on conserved sequences upstream and downstream of the mutation site, using Primer5 and KASP specific primer design principles: (1) The wild-type specific primer (SEQ ID NO.4) precisely matches the C base retained by the wild type at the 3' end, and adds a FAM fluorescent tag sequence at the 5' end; (2) The mutant-specific primer (SEQ ID NO.5) precisely matches the mutant sequence after the deletion of C bases at the 3' end, and adds a HEX fluorescent tag sequence at the 5' end; (3) The reverse universal primer (SEQ ID NO.6) is selected from a highly conserved region downstream of the mutation site to ensure that both alleles can be stably amplified.

[0033] The initial screening primers were tested for secondary structure, primer dimers, hairpin structures, and Tm value consistency. Unstable primers were eliminated, and the optimal three-primer combination was finally determined. Wild-type specific forward primer FAM: SEQ ID NO.4, mutant-type specific forward primer HEX: SEQ ID NO.5, universal reverse primer: SEQ ID NO.6. The three primer powders were diluted with sterile ultrapure water to prepare a 10 μmol / L stock solution, and then mixed with the FAM primers:HEX primers:reverse primers in a volume ratio of 2:2:5 to obtain the KASP primer working solution.

[0034] Genomic DNA was extracted from the rice samples to be tested; using the genomic DNA as a template, PCR amplification was performed using the primer set to obtain PCR products; the PCR products were detected using a fluorescence detection platform, and the fluorescence signals of the amplified products were read. The genotype was determined based on the obtained fluorescence signals. Theoretically, if only FAM fluorescence signal is detected, the rice sample is wild-type and exhibits salt sensitivity under salt stress; if only HEX fluorescence signal is detected, the rice sample is... OsPi3 / 4k3 The homozygous mutant of the gene exhibits salt tolerance under salt stress; if both FAM and HEX fluorescence signals are detected simultaneously, the rice sample to be tested is... OsPi3 / 4k3 The heterozygous mutant exhibits salt sensitivity under salt stress.

[0035] The results show that ( Figure 4 The test results were completely in line with expectations. OsPi3 / 4k3 Pure wild-type materials ( Nip / Nip ), OsPi3 / 4k3 Heterozygous mutant materials ( Nip / ospi3 / 4k3 )and OsPi3 / 4k3 homozygous mutant materials ( ospi3 / 4k3 / ospi3 / 4k3 The corresponding fluorescence signals were detected in the samples.

[0036] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for identifying salt tolerance genes in rice OsPi3 / 4k3 The KASP molecular marker primer set of the mutant is characterized by, The primer set consists of a wild-type specific forward primer as shown in SEQ ID NO.4, a mutant-type specific forward primer as shown in SEQ ID NO.5, and a reverse common primer as shown in SEQ ID NO.6; The sequence SEQ ID NO.4 is: GAAGGTGACCAAGTTCATGCTAGGAGAAAAACCAAGCGAACCC; The sequence SEQ ID NO.5 is: GAAGGTCGGAGTCAACGGATTGAGGAGAAAAACCAAGCGAACCA; The sequence SEQ ID NO.6 is: TACTGCTCCCGCACCCGCTG.

2. A method for identifying rice salt tolerance genes OsPi3 / 4k3 The mutant detection kit is characterized by, It includes the KASP molecular marker primer set as described in claim 1.

3. The detection kit according to claim 2, characterized in that, It also includes KASP PCR reaction mix and sterile water.

4. A method for identifying salt tolerance genes in japonica rice OsPi3 / 4k3 The method for mutants or wild-types is characterized by, Using the primer set of claim 1 or the kit of any one of claims 2-3, the steps include: (1) Extract genomic DNA from the rice sample to be tested; (2) Using genomic DNA as a template, a PCR amplification reaction is performed using the primer set described in claim 1 to obtain PCR products; (3) The PCR products were detected using a fluorescence detection platform, and the fluorescence signal of the amplified products was read. The genotype was determined based on the obtained fluorescence signal: If only FAM fluorescence signal is detected, the rice sample under test is wild-type and exhibits salt sensitivity under salt stress. If only HEX fluorescence signal is detected, the rice sample to be tested is OsPi3 / 4k3 The homozygous mutant exhibits salt tolerance under salt stress conditions; If both FAM and HEX fluorescence signals are detected simultaneously, the rice sample to be tested is OsPi3 / 4k3 The heterozygous mutant of the gene exhibits salt sensitivity under salt stress conditions; The mutant OsPi3 / 4k3 The gene gDNA sequence is SEQ ID NO.7, and the wild-type... OsPi3 / 4k3 The gene gDNA sequence is SEQ ID NO.

1.

5. The method according to claim 4, characterized in that, The PCR amplification reaction program was as follows: pre-denaturation at 94℃ for 15 min; annealing at 94℃ for 20 s, gradient annealing at 61-55℃ for 60 s, for 10 cycles, with the annealing temperature decreasing by 0.6℃ in each cycle; annealing at 94℃ for 20 s, gradient annealing at 55℃ for 60 s, for 26-30 cycles.

6. The KASP molecular marker primer set of claim 1, the kit of claim 2, or the method of any one of claims 4-5 for identifying rice salt tolerance genes. OsPi3 / 4k3 mutants or rice salt tolerance genes OsPi3 / 4k3 Applications of molecular marker breeding; If only FAM fluorescence signal is detected in the PCR product of the rice sample to be tested, the sample is wild-type and exhibits salt sensitivity under salt stress; if only HEX fluorescence signal is detected, the sample is... OsPi3 / 4k3 The homozygous mutant of the gene exhibits salt tolerance under salt stress; if both FAM and HEX fluorescence signals are detected simultaneously, the rice sample to be tested is... OsPi3 / 4k3 The heterozygous mutant exhibits salt sensitivity under salt stress; the mutant OsPi3 / 4k3 The gene gDNA sequence is SEQ ID NO.7, and the wild-type... OsPi3 / 4k3 The gene gDNA sequence is SEQ ID NO.1.

Images