A fluorescence detection method and kit for carassius auratus herpes virus mediated mismatch cleavage

Abstract

The present application belongs to the technical field of aquatic animal pathogen molecular detection, and discloses a fluorescence detection method and kit for crucian herpesvirus based on enzyme-mediated mismatch cleavage. Nucleic acid is extracted from an isolated tissue or a water sample, and an asymmetric recombinase polymerase amplification system with a forward primer and a reverse primer in a concentration ratio of 1:10 is used to amplify a target single strand at 39 DEG C. Then, a fluorescent probe containing consecutive double-base mismatches and a mismatch endonuclease are added to make the probe form a mismatch heteroduplex with a crucian herpesvirus ORF66 target sequence and generate a fluorescent signal through enzyme cleavage. Whether the sample contains target nucleic acid is determined according to the fluorescent signal. The method is completed step by step in the same reaction tube, the detection time is not more than 60 min, the minimum detection limit is 100 copies / reaction, the non-specific signal caused by a close relative pathogenic nucleic acid can be reduced, and the method is suitable for rapid detection of crucian herpesvirus on site.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid detection technology for aquatic animal pathogens, specifically to a fluorescence detection method and kit for enzyme-mediated mismatch cleavage of crucian carp herpesvirus. Background Technology

[0002] Carassius auratus herpesvirus (CaHV) is a double-stranded DNA virus that can infect cyprinid fish such as crucian carp and goldfish. Infected fish may lack typical external symptoms in the early stages of infection or when the viral load is low, but the virus can be transmitted through water contact and fry transportation. When environmental conditions such as aquaculture water temperature, water quality, and stocking density change, infected fish may exhibit symptoms such as hemorrhage, gill damage, and internal organ lesions, adversely affecting the breeding and large-scale farming of crucian carp and goldfish fry. Therefore, rapid detection of CaHV nucleic acid in isolated tissues of farmed fish and aquaculture water samples is of great significance for aquatic pathogen monitoring.

[0003] Currently, methods for detecting CaHV mainly include virus isolation, immunological detection, polymerase chain reaction (PCR), and isothermal nucleic acid amplification. Virus isolation is time-consuming and requires sophisticated experimental conditions and skilled operators. Immunological detection methods, such as colloidal gold test strips, are convenient, but their sensitivity may be limited when the pathogen concentration in the sample is low. PCR and real-time quantitative PCR can detect viral nucleic acids, but they typically require nucleic acid extraction and purification and rely on amplification equipment with multi-stage temperature cycling capabilities and supporting experimental conditions, which limits their application in the field. Therefore, there is a need to further improve the convenience of rapid detection of CaHV nucleic acid in aquaculture.

[0004] Recombinase polymerase amplification (RPA) can amplify nucleic acids at relatively low and relatively constant temperatures, eliminating the need for repeated heating and cooling processes required by traditional PCR. It features shorter reaction times and lower equipment requirements. Current RPA detection typically employs a symmetrical amplification method with identical concentrations of forward and reverse primers, producing predominantly double-stranded DNA as the amplification product. When using nucleic acid probes for subsequent detection, the two complementary strands of the amplified product can easily recombine and may compete with the probe for hybridization, affecting the probe's binding efficiency to the target strand. This is especially problematic when the template nucleic acid content is low, potentially leading to insufficient detection signals. Furthermore, some gene regions of different fish herpesviruses share sequence similarities. Relying solely on amplification primers or ordinary probes for single-level recognition may result in non-specific amplification or non-target nucleic acid hybridization signals, affecting the accuracy of the detection results.

[0005] Samples such as crucian carp gills, liver, spleen, kidneys, whole blood, and sediment from aquaculture water may contain mucus, proteins, polysaccharides, humic acid, and other substances that can affect nucleic acid amplification. While nucleic acid purification using silica gel columns or magnetic beads can improve purity, it increases sample pretreatment steps and detection time. Some nucleic acid amplification endpoint detection methods also require transferring the amplification product to other reaction containers or adding colorimetric reagents after amplification, increasing operational complexity and the risk of amplification product contamination. Therefore, current technology still needs a CaHV fluorescence detection method that can adapt to in vitro fish tissue and aquaculture water samples, simplify nucleic acid pretreatment, complete amplification at a relatively low constant temperature, and improve the utilization rate of target single strands and the specificity of nucleic acid recognition. Summary of the Invention

[0006] To address the problems in existing CaHV nucleic acid detection processes, such as numerous sample pretreatment steps, high requirements for detection equipment, insufficient detection signals from low-content target nucleic acids, and the potential for non-specific signals from closely related pathogen nucleic acids, this invention provides an enzyme-mediated mismatch cleavage fluorescence detection method and kit for crucian carp herpesvirus. This method uses crude nucleic acid extracts from isolated crucian carp tissue, whole blood, or sediment samples from aquaculture water as templates. Under these conditions, an asymmetric recombinase polymerase amplification system with a final primer-to-reverse primer concentration ratio of 1:10 was used to increase the number of target single strands available for binding to the fluorescent probe. After amplification, a fluorescent probe containing consecutive double-base mismatches, a mismatch endonuclease, and a digestion buffer were added to the same reaction tube. This allowed the fluorescent probe to form a mismatched heteroduplex with the CaHV ORF66 target single strand, which was then subjected to enzymatic mismatch cleavage (EMC) to generate a fluorescent signal. This technique reduces nucleic acid purification and amplification product transfer steps, lowers operational complexity and the risk of amplification product contamination, and is beneficial for improving the detection signal of low-content target nucleic acids and reducing non-specific signals caused by closely related pathogen nucleic acids.

[0007] To achieve the above objectives, this application specifically proposes the following technical solution: an in vitro fluorescence detection method for detecting crucian carp herpesvirus nucleic acid in isolated samples, comprising the following steps: (1) After rapidly homogenizing the isolated crucian carp tissue, whole blood or sediment samples from aquaculture water, mix them with the nucleic acid crude extraction buffer, and after lysis and centrifugation, take the supernatant to obtain the nucleic acid crude extract; (2) Using the crude nucleic acid extract as a template, asymmetric recombinase polymerase amplification was performed using forward and reverse primers targeting the crucian carp herpesvirus ORF66 gene. The final concentration ratio of the forward primer to the reverse primer was 1:10, and the amplification temperature was [temperature missing]. The amplification time was 20 min; (3) Add a fluorescent probe and a mismatch endonuclease to the same reaction vessel containing the amplification product. The fluorescent probe is modified with a FAM fluorescent reporter group at its 5′ end and a BHQ1 quencher group at its 3′ end. The fluorescent probe contains two consecutive mismatched bases. The fluorescent probe hybridizes with the target single strand of the crucian carp herpesvirus ORF66 gene to form a heteroduplex containing consecutive double base mismatches. The mismatch endonuclease then cleaves the heteroduplex to generate a fluorescent signal. (4) A fluorescence detection device with an excitation wavelength of 495 nm and an emission wavelength of 520 nm is used to collect fluorescence signals, and the fluorescence signals are used to determine whether the isolated sample contains the target nucleic acid of crucian carp herpesvirus ORF66.

[0008] Preferably, the nucleotide sequence of the forward primer is as follows: 5′-ATGGACGAGTTTATGGACAGCGTCGCCAAG-3′; The nucleotide sequence of the reverse primer is as follows: 5′-GCAGTCCTGTCCGCGGCCAGTAATATAGCG-3′; The final concentration of the forward primer is 0.05–0.2 μmol / L, and the final concentration of the reverse primer is 10 times that of the final concentration of the forward primer.

[0009] Preferably, the nucleotide sequence of the fluorescent probe is as follows: 5′-AGACGCAAAGAATTATACGAGCT-3′; Specifically, starting from the 5′ end of the fluorescent probe, the 15th and 16th bases of the fluorescent probe are A and T, respectively, and the corresponding bases of the target sequence of crucian carp herpesvirus ORF66 are C and A, respectively, thus forming a continuous double base mismatch; the theoretical Tm value of the completely complementary sequence of the fluorescent probe is 50 °C, and it is purified by PAGE.

[0010] Preferably, the mismatch endonuclease is selected from at least one of T4 endonuclease VII, T7 endonuclease I, and CEL I nuclease; the fluorescent probe, mismatch endonuclease, and containing The enzyme digestion buffer was added to the asymmetric RPA product and incubated at 39 °C for 20 min, so that the fluorescent probe hybridization and EMC were carried out in the same reaction system.

[0011] Preferably, a crucian carp herpesvirus nucleic acid fluorescence detection kit includes: (1) Nucleic acid crude extraction buffer; (2) Asymmetric recombinase polymerase amplification premix, wherein the amplification premix contains recombinase, polymerase, accessory protein and buffer salt; (3) Forward primer and reverse primer, wherein the nucleotide sequence of the forward primer is: 5′-ATGGACGAGTTTATGGACAGCGTCGCCAAG-3′; The nucleotide sequence of the reverse primer is as follows: 5′-GCAGTCCTGTCCGCGGCCAGTAATATAGCG-3′; (4) A fluorescent probe, the nucleotide sequence of which is: 5′-AGACGCAAAGAATTATACGAGCT-3′; The fluorescent probe is modified with a FAM fluorescent reporter group at its 5′ end and a BHQ1 quencher group at its 3′ end, and the 15th and 16th bases form a continuous double-base mismatch relative to the target sequence of crucian carp herpesvirus ORF66. (5) Mismatched endonucleases and their digestion buffers; (6) Negative control and positive control containing the target sequence of crucian carp herpesvirus ORF66.

[0012] Preferably, the crude nucleic acid extraction buffer contains 3 mol / L potassium acetate, 10 mmol / L disodium ethylenediaminetetraacetate dihydrate, 0.5 mol / L sodium hydroxide, and 8.7 mmol / L tris(2-carboxyethyl)phosphonic acid hydrochloride; the mismatch endonuclease is T4 endonuclease VII; and the enzyme digestion buffer contains 50 mM Tris-HCl (pH 8.0), 10 mM... The negative control was pET-28a(+) plasmid, and the positive control was pET-28a(+)-CaHV-ORF66 plasmid containing the target sequence of crucian carp herpesvirus ORF66.

[0013] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention employs an asymmetric RPA amplification system with a final concentration ratio of forward primer to reverse primer of 1:10. This amplification reaction generates more target single strands that can be bound by fluorescent probes, reducing the impact of complementary strand rebinding on probe hybridization and improving the fluorescence detection signal of the target nucleic acid.

[0014] 2. This invention incorporates consecutive double-base mismatch sites in the fluorescent probe and utilizes a mismatch endonuclease to cleave the mismatched heteroduplex formed by the probe and the CaHV ORF66 target single strand, creating a multi-stage nucleic acid recognition process consisting of primer amplification, probe hybridization, and mismatch enzyme digestion. In the tested nucleic acid samples of type I carp herpesvirus, type II carp herpesvirus, type III carp herpesvirus, and grass carp hemorrhagic virus, no fluorescence signal exceeding the interpretation threshold was detected, which helps reduce non-specific detection signals caused by closely related pathogen nucleic acids.

[0015] 3. The asymmetric RPA amplification, fluorescent probe hybridization and EMC of the present invention can all be performed at 39 °C, without the need for repeated heating and cooling processes of traditional PCR. The reaction and result interpretation can be completed using a constant temperature fluorescence detection device, which helps to simplify the detection equipment and operation process.

[0016] 4. This invention uses a crude nucleic acid extraction buffer to treat isolated fish tissue, whole blood, or aquaculture water precipitates. After lysis and centrifugation, the supernatant can be used for subsequent amplification, reducing the need for purification steps such as silica gel column or magnetic bead purification. Under the detection conditions of this invention, the minimum detection level of the plasmid standard is 100 copies / reaction, which is beneficial for detecting low levels of CaHV target nucleic acid in isolated samples.

[0017] 5. The asymmetric RPA amplification, probe hybridization, and EMC of this invention can be completed stepwise in the same reaction tube without transferring the amplification products to other reaction containers, thus reducing the risk of amplification product transfer operations and the resulting contamination. The total time for sample extraction, amplification, enzyme digestion, and fluorescence interpretation can be controlled within 60 minutes, making it suitable for rapid detection of CaHV nucleic acid. Attached Figure Description

[0018] Figure 1 This is a schematic flowchart of a fluorescent detection method for crucian carp herpesvirus mediated by enzyme-mediated mismatch cleavage. Figure 2 Agarose gel electrophoresis results of RPA and asymmetric RPA amplification products of CaHV ORF66 target nucleic acid. Lane 1 is the DNA Marker; lanes 2 and 3 are symmetric RPA amplification products of primer set 1; lanes 4 and 5 are symmetric RPA amplification products of primer set 2; lanes 6 and 7 are symmetric RPA amplification products of primer set 3; lane 8 is the symmetric RPA negative control without primers; lane 9 is the symmetric RPA negative control without nucleic acid template; lanes 10 and 11 are the asymmetric RPA amplification products of primer set 1; lanes 12 and 13 are the asymmetric RPA amplification products of primer set 2; lanes 14 and 15 are the asymmetric RPA amplification products of primer set 3; lane 16 is the asymmetric RPA negative control without primers; lane 17 is the asymmetric RPA negative control without nucleic acid template. Figure 3 The results of PAGE gel electrophoresis of EMC products are shown. Lane 1 is the DNA marker; lane 2 is the RPA amplification product without mismatch endonuclease treatment; lane 3 is the symmetrical RPA amplification product treated with T7 endonuclease I; lane 4 is the asymmetric RPA amplification product treated with T7 endonuclease I; lane 5 is the symmetrical RPA amplification product treated with T4 endonuclease VII; and lane 6 is the asymmetric RPA amplification product treated with T4 endonuclease VII. Figure 4 The results show the specific fluorescence detection of CaHV ORF66 target nucleic acid. Among them, 1 is a positive control containing the CaHV ORF66 target sequence; 2 is a negative control using ultrapure water as a template; 3 is CaHV nucleic acid; 4 is type I carp herpesvirus nucleic acid; 5 is type II carp herpesvirus nucleic acid; 6 is type III carp herpesvirus nucleic acid; and 7 is grass carp hemorrhagic virus nucleic acid. Figure 5 The results show the detection limit of the CaHV ORF66 target nucleic acid. In this table, 1 is a positive control containing the CaHV ORF66 target sequence; 2 is a negative control using ultrapure water as a template; and 3–8 represent concentrations of [missing information - likely a specific concentration]. Copy / μL, Copy / μL, Copy / μL, Copy / μL, copy / μL and Plasmid standards in copies / μL; Figure 6 This is a schematic diagram of the appearance of a portable constant-temperature fluorescence detection device. Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrating the present invention and not for limiting the scope of protection of the present invention. Equivalent substitutions or conventional adjustments made by those skilled in the art based on the description herein without departing from the concept of the present invention are all reasonable modifications to the technical solution of the present invention.

[0020] Unless otherwise specified, all reagents, materials, and instruments used in this invention are commercially available products in the art. Experimental procedures without specified conditions were performed according to the instructions provided by the respective reagent manufacturers or conventional methods in the art. All samples in the embodiments are in vitro samples, and the detection results are used to determine whether the samples contain the target nucleic acid of Carassius auratus herpesvirus (CaHV). Example 1: Preparation of crude nucleic acid extraction buffer and in vitro sample processing

[0021] The nucleic acid crude extraction buffer used in this embodiment contains 3 mol / L potassium acetate, 10 mmol / L ethylenediaminetetraacetic acid disodium dihydrate, 0.5 mol / L sodium hydroxide and 8.7 mmol / L tris(2-carboxyethyl)phosphonic acid hydrochloride (TCEP·HCl).

[0022] To prepare 1000 mL of crude nucleic acid extraction buffer, first add 700 mL of ultrapure water to a beaker, then add 294.42 g of potassium acetate and stir until completely dissolved; add 3.72 g of disodium ethylenediaminetetraacetate dihydrate and stir until dissolved; under continuous stirring, slowly add 20.00 g of sodium hydroxide in portions; after the solution cools to room temperature, add 2.50 g of tris(2-carboxyethyl)phosphonic acid hydrochloride; after all components are completely dissolved, transfer the solution to a volumetric flask, bring the volume to 1000 mL with ultrapure water, mix well, and store at room temperature away from light.

[0023] The in vitro sample is one of the following: in vitro tissue sample, whole blood sample, or sediment suspension from aquaculture water. The in vitro tissue sample is selected from at least one of the gill, liver, spleen, and kidney tissues of crucian carp, and is processed by grinding. The total mass of the in vitro tissue sample is 30 mg. The volume of the whole blood sample is 200 μL. The volume of the sediment suspension from aquaculture water is 500 μL. The in vitro sample is rapidly homogenized in a sterile, nuclease-free centrifuge tube, and an equal volume of crude nucleic acid extraction buffer is added. The mixture is vortexed for 30 s, briefly centrifuged for 10 s, and then allowed to stand at room temperature for 3 min. Subsequently, it is centrifuged at 12000 r / min for 1 min, and the supernatant is used as the crude nucleic acid extraction buffer. 5 μL of the crude nucleic acid extraction buffer is added to each asymmetric RPA amplification reaction. Example 2: CaHV-specific primer screening and asymmetric RPA amplification

[0024] The CaHV ORF66 gene was selected as the detection target. The ORF66 gene sequence was aligned using the NCBI BLAST program, and three sets of RPA candidate primers were designed from the conserved regions of the ORF66 gene. The nucleotide sequence of the CaHV ORF66 gene is shown in SEQ ID NO.1, specifically: ATGGACGAGTTTATGGACAGCGTCGCCAAGATGGTGACTAGTGAGAGACGCAAAGAATTCAACGAGCTGCGCAGATCCTTCCGGGGATCCAAGAGCGCCCAGACTCTAAATAACGCTATATTACTGGCCGCGGACAGGACTGCTAGTGTGATGGTAGAGCTGGAACGCGTCAGCGAAAAGCTCGAAGAATGCGAGACGGAAAAGGCCAGGGTCACCGCCGAGCTGGACAAAACCAGGCGAGAGTGCGTCACTCTCGAGGAGCGCGCAAAGCAATTAGAAGAGGACGTCAAGAGACTGGAGCGCGAAAATGCCGAGCAAGAGCCCCGCCGTGTGTTCTCTTCGGACAACGTCCAACAGTCGCAAGTTTTGGCTTTACAAGTTGCCGAGCTGACGCGTCGTCACGTCGAGACGGTGGAACGCGAGAGTCAACTCAGGGCCGAGTCCGAGTCTCTCGCCAATCAGGTGCGAGAACTGGAGTCGGAGCTCAGACGCAAAGACGTGGCCCACGCCAAGTCCGAGGAGACCCAGGCGGATAAACTCCGAGAGACTCTGAGGCTGTTGAACTCGGCCGGTAGCATGCGCCACATGGACTTTCTGCCGGTGGTCAGGGGTAGAAGCTACAAGGAGGTCACCCTGAACGGATACCTCCAGTACGTCCGAAACAACGAGCAACTCTACAGGGAAAAGTGCGGCACTTTTCTGACCCAGGGTATCGCCAACATCCTGTACGATAGACGCGTGTATGGGCGCCGTGGGTCTGTTACCCTCCGAGTGGGTGTCTCGGCATTTCGTGAAACCGCTCGTACCGTACGCCATGGTACATCATTACGAAGAGTTTCTGCACTACCGTATAGTCCTGTCCAACTGTACGGGTCTGTTTGCCCAGATGTTGACCGTGGTGCAGCTCAACGCTGTGGGTACTGAGAACCGTCGAAAAATCACCCTCACGGAATTCAGAAATCTCAGTAACATCAGTCAAGAACCAGTCAGG;

[0025] The three sets of candidate primers are as follows: Primer set 1: The forward primer CaHV-ORF66-001-F1 has the nucleotide sequence shown in SEQ ID NO.2, specifically as follows: 5′-ATGGACGAGTTTATGGACAGCGTCGCCAAG-3′; The reverse primer CaHV-ORF66-140-R1 has the nucleotide sequence shown in SEQ ID NO.3, specifically as follows: 5′-GCAGTCCTGTCCGCGGCCAGTAATATAGCG-3′.

[0026] Primer set 2: The forward primer CaHV-ORF66-544-F2 has the nucleotide sequence shown in SEQ ID NO.4, specifically: 5′-AGAGACTCTGAGGCTGTTGAACTCGGCCGG-3′; The reverse primer CaHV-ORF66-675-R2 has the nucleotide sequence shown in SEQ ID NO.5, specifically as follows: 5′-AGTTGCTCGTTGTTTCGGACGTACTGGAGG-3′.

[0027] Primer set 3: The forward primer CaHV-ORF66-576-F3 has the nucleotide sequence shown in SEQ ID NO.6, specifically: 5′-ATGCGCCACATGGACTTTCTGCCGGTGGTC-3′; The reverse primer CaHV-ORF66-717-R3 has the nucleotide sequence shown in SEQ ID NO.7, specifically: 5′-GCGATACCCTGGGTCAGAAAAGTGCCGCAC-3′.

[0028] To screen primer sets suitable for amplifying the CaHV ORF66 target nucleic acid, independent RPA amplification was performed using primer sets 1, 2, and 3. Only one set of candidate primers was added to each reaction tube, and different primer sets were not mixed. Symmetric and asymmetric RPA reactions were set up for each set of candidate primers. Therefore, a total of 6 amplification reaction conditions were formed from the three sets of candidate primers, and each amplification reaction condition was set up in 2 parallel reactions.

[0029] In the symmetric RPA reaction, primer sets 1, 2, and 3 were amplified according to the same reaction system. 2.4 μL of the corresponding forward primer at a concentration of 20 μmol / L and 2.4 μL of the corresponding reverse primer at a concentration of 20 μmol / L were added to each reaction, so that the final concentrations of both the forward and reverse primers were 0.96 μmol / L, with a final concentration ratio of 1:1.

[0030] In the asymmetric RPA reaction, primer sets 1, 2, and 3 were amplified independently. For each reaction, 2.4 μL of the corresponding forward primer at a concentration of 2 μmol / L and 2.4 μL of the corresponding reverse primer at a concentration of 20 μmol / L were added, resulting in a final concentration of 0.096 μmol / L for the forward primer and 0.96 μmol / L for the reverse primer, with a final concentration ratio of 1:10.

[0031] For both the symmetric and asymmetric RPA reactions described above, 29.5 μL of primer-free reconstitution buffer and 5 μL of CaHV nucleic acid template were added, and the reaction mixture volume was brought to 47.5 μL using sterile water. Negative controls without primers and without nucleic acid template were set up for both the symmetric and asymmetric RPA reactions, respectively. For the absence of primers or nucleic acid template, an equal volume of sterile water was used as a substitute.

[0032] Each reaction mixture was transferred to a basic RPA reaction unit, mixed thoroughly, and then 2.5 μL of a 280 mmol / L magnesium acetate solution was added to make the total volume of each reaction 50 μL. The reaction tubes were placed in a thermostat and incubated. Incubate for 20 minutes.

[0033] After amplification, the symmetrical RPA products, asymmetric RPA products, and corresponding negative controls of each group were subjected to agarose gel electrophoresis to compare the amplification ability of the three candidate primers under the same amplification mode, and to compare the amplification of the same primer group under symmetrical RPA and asymmetric RPA conditions.

[0034] The results are as follows Figure 2 As shown, all three sets of candidate primers were able to amplify the corresponding bands under both symmetric and asymmetric RPA conditions. Negative controls without primers or nucleic acid templates did not show the corresponding target amplification bands. Primer set 1 produced relatively clear amplification bands under both symmetric and asymmetric RPA conditions, and no obvious non-specific amplification bands were observed under the conditions of this embodiment. Based on a comprehensive comparison of the amplification results of the three candidate primer sets, primer set 1 was selected for subsequent asymmetric RPA amplification of the CaHV ORF66 target nucleic acid, fluorescent probe hybridization, and mismatch endonuclease digestion experiments. Example 3: Hybridization of dinucleotide mismatch fluorescent probes and screening of mismatched endonucleases

[0035] Based on the ORF66 amplification region corresponding to primer set 1, a double-base mismatch fluorescent probe CaHV-ORF66-36-Probe1 was designed, the nucleotide sequence of which is shown in SEQ ID NO.8, specifically: 5′-AGACGCAAAGAATTATACGAGCT-3′.

[0036] The fluorescent probe is modified with a FAM fluorescent reporter group at its 5′ end and a BHQ1 quencher group at its 3′ end. The theoretical Tm value of the probe's perfectly complementary sequence is [value missing]. The sample was purified using PAGE. The nucleotide sequence corresponding to the fluorescent probe in the ORF66 target sequence is as follows: 5′-AGACGCAAAGAATTCAACGAGCT-3′.

[0037] Starting from the 5′ end of the fluorescent probe, the 15th and 16th bases of the fluorescent probe are A and T, respectively, and the corresponding bases of the ORF66 target sequence are C and A, respectively. Therefore, after the fluorescent probe hybridizes with the ORF66 target single strand, a heteroduplex with consecutive double-base mismatches is formed at the above positions.

[0038] After asymmetric RPA amplification, add 1 μL of a 2 μmol / L dibase mismatch fluorescent probe, 2 μL of a 10 U / μL mismatch endonuclease, and 6 μL of 10×EMC digestion buffer to the same reaction tube containing the amplification products. The EMC digestion buffer contains Tris-HCl. NaCl and dithiothreitol, pH 8.0. The reactants were mixed thoroughly and then... Incubate for 20 min to allow probe hybridization and EMC to proceed in the same reaction system.

[0039] Enzyme digestion was performed using T7 endonuclease I and T4 endonuclease VII, respectively, with symmetrical and asymmetric RPA products used as digestion substrates. After the reaction, the digestion products were observed by PAGE gel electrophoresis. The results showed that under the conditions of this example, both T7 endonuclease I and T4 endonuclease VII could cleave the formed mismatched heteroduplexes. The digestion bands corresponding to the combination of asymmetric RPA product and T4 endonuclease VII were clearer. (See attached figure). Figure 3 Therefore, T4 endonuclease VII was used as the mismatch endonuclease for subsequent fluorescence detection.

[0040] During the enzymatic digestion reaction, the mismatched endonuclease cleaves the mismatched heteroduplex formed by the fluorescent probe and the ORF66 target single strand, causing the FAM fluorescent reporter group to separate from the BHQ1 quencher group, thereby generating a detectable fluorescent signal. The fluorescence signal of the reaction system was collected using a fluorescence detection device with an excitation wavelength of 495 nm and an emission wavelength of 520 nm. Example 4: Specificity Experiment

[0041] To evaluate the specificity of the method of the present invention within the range of tested pathogens, concentrations of [missing information] were selected. CaHV nucleic acid (copies / μL), type I carp herpesvirus nucleic acid, type II carp herpesvirus nucleic acid, type III carp herpesvirus nucleic acid, and grass carp hemorrhagic virus nucleic acid were used as test samples. A plasmid containing the CaHV ORF66 target sequence was used as a positive control, and ultrapure water was used as a negative control. All samples were amplified, probe hybridized, mismatched enzyme digested, and fluorescence detected according to the methods described in Examples 2 and 3.

[0042] Under the conditions of the fluorescence detector and parameters used in this embodiment, a fluorescence intensity of 50,000 is used as the interpretation threshold. When the fluorescence intensity is greater than 50,000, it is determined that the CaHV ORF66 target nucleic acid is detected in the sample to be tested, and the detector displays a red light; when the fluorescence intensity is not greater than 50,000, it is determined that the CaHV ORF66 target nucleic acid is not detected in the sample to be tested, and the detector displays a green light.

[0043] The results showed that the fluorescence intensity of the positive control and CaHV nucleic acid sample was greater than 50,000; the fluorescence intensity of the negative control and the tested carp herpesvirus type I, carp herpesvirus type II, carp herpesvirus type III and grass carp hemorrhagic virus nucleic acid samples did not exceed 50,000. (See attached results). Figure 4 This demonstrates that the method of the present invention can recognize the CaHV ORF66 target nucleic acid within the range of pathogen nucleic acids tested in this embodiment. Example 5: Detection Limit Experiment

[0044] The pET-28a(+)-CaHV-ORF66 plasmid containing the CaHV ORF66 target sequence was serially diluted 10-fold to obtain concentrations of [missing information]. Copy / μL, Copy / μL, Copy / μL, Copy / μL, copy / μL and Plasmid standards at concentrations of 1 μL were used as templates, and detection was performed according to the methods described in Examples 2 and 3. Positive and negative controls were also included.

[0045] The results showed that the positive control and the concentration were Copy / μL, Copy / μL, copy / μL and The fluorescence intensity corresponding to plasmid standards at concentrations of copies / μL was greater than 50,000; the concentration was... copy / μL and The fluorescence intensity of plasmid standards and negative controls at copies / μL did not exceed 50,000. See the results below. Figure 5 With 1 μL of plasmid standard added to each reaction, the lowest detection level of the method of the present invention in this embodiment is 100 copies / reaction. Example 6: Conformity test of ex vivo pathological samples

[0046] Thirty ex vivo pathological samples suspected of containing CaHV were collected and tested using the method of this invention, the qPCR reference method, and the conventional RPA method. Samples were numbered during testing, and different personnel performed the tests without knowing the results of other methods. The method of this invention was used as the EMC detection method, and its results compared with the qPCR reference method and the conventional RPA method are shown in Table 1.

[0047] Table 1. Results of the compliance experiment , The compliance rate is calculated using the following formula: Compliance rate = 100% × (number of samples that were determined to have detected the target nucleic acid by both methods + number of samples that were determined not to have detected the target nucleic acid by both methods) / total number of samples.

[0048] According to Table 1, the concordance rate between the method of the present invention and the qPCR reference method was 90.00%, and the concordance rate with the conventional RPA method was 93.33%. These results indicate that, in the 30 ex vivo pathological samples tested in this embodiment, the method of the present invention has a high concordance rate with the two comparative methods. Example 7: CaHV Nucleic Acid Fluorescence Detection Kit

[0049] This embodiment provides an enzyme-mediated mismatch cleavage fluorescent detection kit for crucian carp herpesvirus, including a crude nucleic acid extraction buffer, primer-free RPA amplification premixed reagent, forward primer CaHV-ORF66-001-F1, reverse primer CaHV-ORF66-140-R1, double-base mismatch fluorescent probe CaHV-ORF66-36-Probe1, T4 endonuclease VII, EMC digestion buffer, negative control plasmid, and positive control plasmid.

[0050] The crude nucleic acid extraction buffer contains 3 mol / L potassium acetate, 10 mmol / L EDTA-1 sodium disodium dihydrate, 0.5 mol / L sodium hydroxide, and 8.7 mmol / L tris(2-carboxyethyl)phosphonic acid hydrochloride; the concentration of the forward primer stock solution is 2 μmol / L, and the concentration of the reverse primer stock solution is 20 μmol / L; the concentration of the double-base mismatch fluorescent probe stock solution is 2 μmol / L; the concentration of the T4 endonuclease VII stock solution is 10 U / μL; the enzyme digestion buffer contains 50 mM Tris-HCl (pH 8.0), 10 mM... The negative control plasmid was pET-28a(+) plasmid, and the positive control plasmid was pET-28a(+)-CaHV-ORF66 plasmid.

[0051] When using the kit, the crude nucleic acid extract was obtained according to the method described in Example 1, asymmetric RPA amplification was performed according to the reaction system and conditions described in Example 2, fluorescent probe hybridization and EMC were performed according to the reaction system and conditions described in Example 3, and finally, a fluorescence detection device with an excitation wavelength of 495 nm and an emission wavelength of 520 nm was used to collect fluorescence signals to determine whether the in vitro sample contained the CaHV ORF66 target nucleic acid.

[0052] The specific reagent dosages and reaction parameters in the above embodiments are used to illustrate the implementation of the present invention. Within the scope of this specification, those skilled in the art can routinely adjust the reaction system according to the sample type, reagent activity, and actual conditions of the detection device.

Claims

1. A fluorescent detection method for crucian carp herpesvirus mediated by enzyme-mediated mismatch cleavage, characterized in that, Includes the following steps: (1) Mix the isolated crucian carp tissue sample, whole blood sample or sediment suspension from aquaculture water with the nucleic acid crude extraction buffer, and after lysis and centrifugation, take the supernatant to obtain the nucleic acid crude extract; (2) Using the crude nucleic acid extract as a template, asymmetric recombinase polymerase amplification was performed using forward and reverse primers targeting the crucian carp herpesvirus ORF66 gene. The final concentration ratio of the forward primer to the reverse primer was 1:10, the amplification temperature was 39 °C, and the amplification time was 20 min. (3) Add fluorescent probe, mismatched endonuclease and [other ingredients] to the same reaction vessel containing the amplification product. The fluorescent probe is prepared with an enzyme digestion buffer. Its 5′ end is modified with a FAM fluorescent reporter group, and its 3′ end is modified with a BHQ1 quencher group. The fluorescent probe contains two consecutive mismatched bases. The fluorescent probe hybridizes with the target single strand of the crucian carp herpesvirus ORF66 gene to form a heteroduplex containing consecutive double-base mismatches. The mismatched endonuclease then cleaves the heteroduplex via enzymatic mismatch cleavage, separating the FAM fluorescent reporter group from the BHQ1 quencher group and generating a fluorescent signal. (4) A fluorescence detection device with an excitation wavelength of 495 nm and an emission wavelength of 520 nm is used to collect fluorescence signals, and the presence of crucian carp herpesvirus ORF66 gene in the isolated sample is determined based on the fluorescence signals.

2. The in vitro fluorescence detection method according to claim 1, characterized in that, The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, specifically: 5′-ATGGACGAGTTTATGGACAGCGTCGCCAAG-3′; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3, specifically: 5′-GCAGTCCTGTCCGCGGCCAGTAATATAGCG-3′; The final concentration of the forward primer is 0.05–0.2 μmol / L, and the final concentration of the reverse primer is 10 times that of the final concentration of the forward primer.

3. The in vitro fluorescence detection method according to claim 1, characterized in that, The nucleotide sequence of the fluorescent probe is shown in SEQ ID NO.8, specifically: 5′-AGACGCAAAGAATTATACGAGCT-3′; Specifically, starting from the 5′ end of the fluorescent probe, the 15th and 16th bases of the fluorescent probe are A and T, respectively, and the corresponding bases of the target sequence of crucian carp herpesvirus ORF66 are C and A, respectively, thus forming a continuous double base mismatch; the theoretical Tm value of the completely complementary sequence of the fluorescent probe is 50 °C, and it is purified by PAGE.

4. The in vitro fluorescence detection method according to any one of claims 1-3, characterized in that, The mismatch endonuclease is selected from at least one of T4 endonuclease VII, T7 endonuclease I, and CEL I nuclease; the fluorescent probe, mismatch endonuclease, and containing The enzyme digestion buffer was simultaneously added to the asymmetric recombinase polymerase amplification product, and incubated at 39 °C for 20 min, so that the fluorescent probe hybridization and mismatch site digestion were carried out in the same reaction system.

5. A fluorescent detection kit for crucian carp herpesvirus mediated by enzyme-mediated mismatch cleavage, characterized in that, include: (1) Nucleic acid crude extraction buffer; (2) Asymmetric recombinase polymerase amplification premix, wherein the amplification premix contains recombinase, polymerase, accessory protein and buffer salt; (3) A forward primer and a reverse primer, wherein the forward primer and the reverse primer are configured such that the final concentration ratio of the two primers is 1:10 in the asymmetric recombinase polymerase amplification reaction; the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, specifically: 5′-ATGGACGAGTTTATGGACAGCGTCGCCAAG-3′; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3, specifically: 5′-GCAGTCCTGTCCGCGGCCAGTAATATAGCG-3′; (4) A fluorescent probe, the nucleotide sequence of which is shown in SEQ ID NO.8, specifically: 5′-AGACGCAAAGAATTATACGAGCT-3′; The fluorescent probe is modified with a FAM fluorescent reporter group at its 5′ end and a BHQ1 quencher group at its 3′ end, and the 15th and 16th bases form a continuous double-base mismatch relative to the target sequence of crucian carp herpesvirus ORF66. (5) Mismatched endonucleases and their digestion buffers; (6) Negative control and positive control containing the target sequence of crucian carp herpesvirus ORF66.

6. The crucian carp herpesvirus nucleic acid fluorescence detection kit according to claim 5, characterized in that, The crude nucleic acid extraction buffer contains 3 mol / L potassium acetate, 10 mmol / L disodium ethylenediaminetetraacetate dihydrate, 0.5 mol / L sodium hydroxide, and 8.7 mmol / L tris(2-carboxyethyl)phosphonic acid hydrochloride; the mismatch endonuclease is T4 endonuclease VII; the enzyme digestion buffer contains 50 mM Tris-HCl (pH 8.0), 10 mM... The negative control was pET-28a(+) plasmid, and the positive control was pET-28a(+)-CaHV-ORF66 plasmid containing the target sequence of crucian carp herpesvirus ORF66.

Images