A method for detecting an andes virus based on crispr technology

Abstract

The application provides a method for detecting Andes virus based on CRISPR technology. The method has the advantages of high specificity and high sensitivity, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection, specifically relating to a method for detecting Andean viruses based on CRISPR technology. Background Technology

[0002] Andes virus (ANDV) belongs to the order Bunyavirales, family Hantaviridae, and genus Orthohantavirus. It is an enveloped, negative-sense, single-stranded RNA virus with a genome composed of three segments: S, M, and L. It is the main pathogen of Hantavirus Pulmonary Syndrome (HPS, also known as Hantavirus Cardiopulmonary Syndrome HCPS) in South America (mainly distributed in Argentina and Chile). The natural host of this virus is rodents in the subfamily Cricetinae of South America, such as the long-tailed dwarf rat (Oligoryzomys longicaudatus). Humans are mainly infected through inhalation of aerosols contaminated with the saliva, urine, or feces of infected rodents, and can also be transmitted through the food chain, bites, and close contact. Andean virus (HPS) is currently the only known hantavirus with limited human-to-human transmission. Its transmission is most common among close contacts, caregivers, and in enclosed, crowded environments, and is believed to primarily occur during the symptomatic phase. This characteristic significantly distinguishes it from other hantaviruses and presents unique challenges to the control of outbreaks. HPS has a rapid onset, often progressing rapidly from an influenza-like prodromal phase to acute respiratory distress syndrome (ARDS) and circulatory shock within days. There are no specific antiviral drugs or approved vaccines, and the overall mortality rate is as high as 20% to 40%, reaching 50% in some strains or outbreak scenarios. Therefore, early diagnosis and timely intensive care support are crucial for improving prognosis. However, the early clinical manifestations of HPS are highly similar to those of common respiratory infections, making misdiagnosis very easy. Laboratory diagnosis relies on molecular detection of viral nucleic acid in acute-phase serum or whole blood and detection of specific IgM / IgG antibodies. Commonly used methods include real-time reverse transcription polymerase chain reaction (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and immunofluorescence antibody assay, with gene sequencing used for strain identification and transmission chain tracing. The aforementioned methods mostly require completion in central laboratories with biosafety facilities, and the cycle from sample delivery to result output often takes days, making it difficult to meet the needs of rapid on-site screening and immediate isolation decision-making in closed or mobile scenarios such as ports, cruise ships, and field operations. Therefore, developing a rapid, sensitive Andean virus detection technology that can be conducted on-site in resource-constrained or mobile environments is of significant practical importance for improving the early detection capability of emerging infectious diseases and supporting public health prevention and control in ports and enclosed spaces.

[0003] This invention provides a method for detecting Andean viruses, which is based on RPA-CRISPR technology and provides a detection method with high specificity and high sensitivity. Summary of the Invention

[0004] In view of this, the main objective of the present invention is to provide a method for detecting Andean viruses.

[0005] To achieve the above objectives, the technical solution of the present invention is implemented as follows:

[0006] On one hand, the present invention provides a method for detecting Andean virus, the method comprising the following steps:

[0007] S1. Amplify the sample to be tested to obtain the amplification product;

[0008] The test sample was amplified using an RPA amplification primer set, the sequences of which are shown in SEQ ID No. 8 and SEQ ID No. 12.

[0009] S2. The amplification product is contacted with Cas protein, sgRNA and a single-stranded nucleic acid detector to detect the detectable signal generated by the Cas protein cleaving the single-stranded nucleic acid detector, thereby detecting Andean virus. The sgRNA includes a region that binds to the Cas protein and a guide sequence for hybridization with the target nucleic acid. The target nucleic acid is a nucleic acid derived from Andean virus. The target region sequence of the sgRNA that hybridizes with the target nucleic acid is shown in SEQ ID No. 2.

[0010] In one embodiment, the method is an RPA-CRISPR detection method.

[0011] In one embodiment, the target nucleic acid is an Andean virus gene.

[0012] In one embodiment, the target nucleic acid is NC_003466.1.

[0013] In one embodiment, the RPA amplification primer set sequence is shown in any one of SEQ ID No. 5-12. Preferably, the RPA amplification primer set sequence is shown in SEQ ID No. 8 and SEQ ID No. 12.

[0014] In this invention, the region that binds to the CRISPR / CAS effector protein (Cas protein) is also called the backbone region. This region interacts with the Cas protein, thereby binding the Cas protein.

[0015] In one embodiment, the gRNA includes, from the 5' end to the 3' end, a region that binds to the Cas protein and a targeting region that hybridizes with the target nucleic acid.

[0016] In one embodiment, the target region sequence that hybridizes with the target nucleic acid comprises any of the sequences shown in SEQ ID No. 1-3; preferably, the target region sequence that hybridizes with the target nucleic acid is shown in SEQ ID No. 2.

[0017] In one embodiment, the region that binds to the Cas protein is shown in SEQ ID No. 4.

[0018] In one embodiment, the Cas protein is selected from type V Cas proteins, such as Cas12, Cas14 family proteins or mutants thereof.

[0019] In one embodiment, the Cas protein is Cas12b. Preferably, the Cas protein is wild-type Cas12b. Preferably, the Cas protein is a mutant Cas12b protein.

[0020] Preferably, the amino acid sequence of the Cas protein is shown in SEQ ID NO.13.

[0021] Preferably, the amino acid sequence of the Cas protein is modified by changing E to K at position 958, corresponding to the amino acid sequence shown in SEQ ID NO.13, compared to the amino acid sequence of the wild-type Cas protein.

[0022] Preferably, the amino acid sequence of the Cas protein has an E mutation at position 958 to K compared to SEQ ID NO.13.

[0023] Furthermore, the method also includes the step of obtaining the nucleic acid to be tested from the sample to be tested; preferably, the nucleic acid to be tested is obtained from the sample to be tested by an amplification method.

[0024] The amplification method described in this invention is selected from one or more of the following: PCR, sequencing-based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HDA), or nicking enzyme amplification reaction (NEAR), multiple displacement amplification (MDA), rolling circle amplification (RCA), ligase chain reaction (LCR), or derivative amplification method (RAM). Preferably, the amplification method is LAMP amplification.

[0025] In this invention, the sample may be derived from an animal.

[0026] In this invention, the detectable signal is achieved through the following methods: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition / dispersion, electrochemical detection, and semiconductor-based detection.

[0027] In some embodiments, the method of the present invention further includes the step of measuring a detectable signal generated by the Cas protein. The Cas protein, upon recognizing or hybridizing with the target nucleic acid, can activate the cleavage activity of any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector and generating a detectable signal.

[0028] In one embodiment, the detectable signal can also be achieved by setting different labeling molecules, such as a fluorescent group and a quenching group, at the 5' and 3' ends of the single-stranded nucleic acid detector, respectively. The fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; the quenching group is selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0029] In one embodiment, the single-stranded nucleic acid detector is 5'-FAM-TTTTTTT-BQ1-3'.

[0030] In one implementation, the two ends of the single-stranded nucleic acid detector are configured with tags that can be detected by colloidal gold.

[0031] In one embodiment, step S1 is an RPA amplification method.

[0032] Preferably, step S1 includes:

[0033] (1) Mix the sample and amplification buffer thoroughly;

[0034] (2) Take the mixture from (1) and add the nucleic acid template;

[0035] (3) Add upstream and downstream primers;

[0036] (4) Add magnesium acetate to the reaction tube.

[0037] Preferably, step S1 includes:

[0038] (1) Mix the sample thoroughly with 48 µL of amplification buffer;

[0039] (2) Take 12 µL of the mixture from (1) and place it on the cap of the eight-tube connector, and add 1.6 µL of nucleic acid template;

[0040] (3) Add 0.2µL of upstream primer and 0.2µL of downstream primer (primer concentration 100µM) respectively.

[0041] (4) Add 1.0 µL of magnesium acetate to the reaction tube.

[0042] In one embodiment, step S2 is a CRISPR detection method; preferably, the detection system in step S2 includes 10×CRISPR buffer, Cas protein, sgRNA, and a single-stranded nucleic acid detector; more preferably, the detection system in step S2 includes 1µL 1×CRISPR buffer, (2.5 µM) 0.4µL Cas protein, (100ng / µL) 0.2µL sgRNA, and (100µM) 0.1µL single-stranded nucleic acid detector; the CRISPR reaction parameters are 43℃ / 30min.

[0043] In one embodiment, the method exhibits high specificity and sensitivity. The detection limit of the method is 1 E1 copies / T.

[0044] On the other hand, the present invention also provides a system or composition for detecting Andean viruses, the system or composition comprising the above-described RPA amplification primer set, Cas protein, and sgRNA. Further, the system or composition also includes the above-described single-stranded nucleic acid detector.

[0045] On the other hand, the present invention also provides the application of the above-described system or composition in the detection of Andean viruses.

[0046] On the other hand, the present invention also provides the use of the above-described system or composition in the preparation of reagents or kits for detecting Andean viruses.

[0047] Beneficial effects of the invention:

[0048] This invention provides a method for detecting Andean viruses, which is an RPA-CRISPR detection method. It uses RPA amplification primers and sgRNA with high detection efficiency and has the advantages of high specificity and high sensitivity.

[0049] Sequence information

[0050] The sequence information involved in this invention is provided in Table 1 below:

[0051] Table 1

[0052]

[0053]

[0054]

[0055] The following figures and embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the invention will become apparent to those skilled in the art from the following detailed description of the figures and preferred embodiments. Attached Figure Description

[0056] Figure 1 The results of screening for Cas mutant proteins.

[0057] Figure 2 Screening for sgRNAs targeting NDV Figure 2 PTC is a positive amplification product containing plasmid, and NTC is water; A: Fluorescence growth rate at 6 min during the ANDV sgRNA screening phase; B: Fluorescence curves of different ANDV target sgRNAs.

[0058] Figure 3 For ANDV target RPA primer screening, Figure 3 NTC is water; A: Fluorescence growth rate of RPA primers after 30 min 1; B: Fluorescence curves of different RPA primers at high concentration 2; C: Fluorescence curves of different RPA primers at low concentration.

[0059] Figure 4 For ANDV sensitivity verification, Figure 4 NTC is water; A: Fluorescence growth rate at 30 min during the ANDV sensitivity verification phase; B: RPA-CRISPR fluorescence curves at different concentrations of the ANDV target.

[0060] Figure 5 To confirm ANDV sensitivity, Figure 5 NTC is water; A: Fluorescence growth rate at 30 min during the ANDV sensitivity confirmation phase; B: RPA-CRISPR fluorescence curve at high ANDV target concentration (5E1 copies / T); C: RPA-CRISPR fluorescence curve at low ANDV target concentration (1E1 copies / T).

[0061] Figure 6 For ANDV specificity verification, A: fluorescence growth rate at 30 min during the ANDV specificity verification phase; B: RPA-CRISPR fluorescence curve during the ANDV specificity verification phase.

[0062] Figure 7 This is a diagram showing the location of the primers on the target nucleic acid and their relative positions to the sgRNA. Detailed Implementation

[0063] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.

[0064] Example 1: Obtaining and validating the effects of the Cas mutant protein

[0065] To enhance the trans-cleavage activity of the AapCas12b protein, this embodiment mutated the wild-type Cas12b protein (amino acid sequence shown in SEQ ID No. 13) to obtain Cas12b mutant proteins E958K, E958R, and E958H. Compared with the amino acid sequence of the wild-type Cas12b protein, the amino acid at position 958 of the wild-type Cas12b protein amino acid sequence (SEQ ID No. 13) was mutated to K, R, and H, respectively.

[0066] 1. List of Materials

[0067] (1) Mutation construction (kit and enzyme)

[0068] Table 2

[0069]

[0070] (2) Primers and templates

[0071] Table 3

[0072]

[0073] The following are primers used for amino acid mutations:

[0074] E958K mutant:

[0075] E958K-F: GCGAGGGCAAATTCTTCGT (SEQ ID No. 14);

[0076] E958K-R: ACGAAGAATTTGCCCTCGC (SEQ ID No. 15);

[0077] E958R mutant:

[0078] E958R-F: CGAGGGCCGTTTCTTCG (SEQ ID No. 16);

[0079] E958R-R: CGAAGAAACGGCCTCG (SEQ ID No. 17);

[0080] E958H mutant:

[0081] E958H-F: CGAGGGCCACTTCTTCG (SEQ ID No. 18);

[0082] E958H-R: CGAAGAAGTGGCCCTCG (SEQ ID No. 19).

[0083] (3) Cloning and transformation

[0084] Table 4

[0085]

[0086] (4) Protein expression

[0087] Table 5

[0088]

[0089] (5) Protein purification

[0090] Table 6

[0091]

[0092] (6) Functional characterization

[0093] Table 7

[0094]

[0095] 2. Primer design (The designed primers are listed above for primers used for amino acid mutations)

[0096] (1) The 15 residues above and below the mutated amino acid are as follows: E(Glu) → K / R / H

[0097] Upstream 15 residues: GCPLADDLIPTGEG (SEQ ID No. 20)

[0098] Downstream 15 residues: FFVSPFSAEEGDFHQ (SEQ ID No. 21)

[0099] (2) Target codon (human E. coli preference)

[0100] Table 8

[0101]

[0102] The original codon for E958 in the wild-type ORF is GAA / GAG (Glu), which can be replaced.

[0103] 3. Experimental Procedure

[0104] (1) Mutation of wild-type Cas12b protein was performed using the Q5® Site-Directed Mutagenesis Kit.

[0105] Table 9

[0106]

[0107] Program: 98 ℃ 30 s → 25 cycles (98 ℃ 10 s; 60 ℃ 30 s, 72 ℃ 60 s) → 72 ℃ 2 min → 4 ℃ Save.

[0108] Run 2–5 μL of the product on a 0.8% agarose gel; a single band may be observed.

[0109] (2) KLD treatment (10 μL, template removal + loop closure)

[0110] Table 10

[0111]

[0112] Incubate at room temperature (25 °C) for 5 min, then immediately use for transformation (or store at -20 °C).

[0113] (3) Transformation

[0114] Take 5 μL of KLD mixture + 50 μL of chemicompetent cells (on ice for 30 min → heat shock at 42℃ for 30 s → on ice for 2 min → add 950 μL of SOC → shake at 37℃ for 1 h) → spread on a Cm (25 μg / mL) plate and incubate at 37℃ overnight.

[0115] (4) Colony screening and plasmid extraction

[0116] Select 3–5 single clones and perform colony PCR using vector-universal primers or mutation-specific primers; extract plasmids from positive clones. If a silencing restriction site introduced by the mutation / RFLP is used, rapid differentiation can be achieved.

[0117] (5) Protein expression

[0118] Inoculate 5 mL of resistant LB broth with a single clone and incubate overnight at 37 °C → 1:100 transfer to 200–500 mL of TB → incubate at 37 °C until OD. 600≈0.6–0.8 → Cool to 18 ℃ in an ice bath → Add IPTG to 0.2–0.5 mM, induce at 18 ℃ for 16–20 h → Harvest at 5000×g at 4 ℃, freeze at -80 ℃ or lyse immediately.

[0119] (6) Purification

[0120] Lysis buffer (4 °C): 50 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole, 5% glycerol, 1 mM TCEP, protease inhibitor. Sonication (ice bath, 3 s on, 7 s off, 10–15 min total) → 4 °C, 18000×g, 30 min. Collect supernatant → Ni-NTA affinity (20 mM imidazole washing, 250–300 mM imidazole elution) → TEV overnight at 4 °C. Remove label → Superdex 200 SEC (20 mM HEPES pH 7.5, 150 mM NaCl, 1 mM TCEP, 5% glycerol) to collect the main peak → 0.22 μM filtration → liquid nitrogen flash freezing -80 °C.

[0121] (7) Quality control

[0122] SDS-PAGE (~128 kDa single master band, >90%), Nanodrop / BCA quantification, LC-MS for identification, SEC / DLS for oligomerization. Western blotting (anti-His) after enzyme digestion confirmed tag removal.

[0123] (8) Data analysis and judgment

[0124] Table 11

[0125]

[0126] Through the above-mentioned amino acid mutation, sequencing verification and protein purification, Cas12b mutant proteins E958K, E958R and E958H were obtained. Compared with the amino acid sequence of wild-type Cas12b protein, the amino acid sequence of mutant proteins E958K, E958R and E958H is mutated to K, R and H respectively at the 958th amino acid position of the amino acid sequence of wild-type Cas12b protein (SEQ ID No. 13).

[0127] To verify the effectiveness of the mutated Cas12b protein, the following methods were used to test the in vitro detection effect of the Cas12b mutant protein:

[0128] The target nucleic acid detected was a PCR amplified sequence derived from Staphylococcus aureus, and the target sequence is shown below:

[0129] GTCCTGAAGCAAGTGCATTTACGAAAAAAATGGTAGAAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAAGAACTGATAAATATGGACGTGGCTTAGCGTATATTTATGCTGATGGAAAAATGGTAAACGAAGCTTTAGTTCGTCAAGGCTTGGCTAAAGTTGCTTATGTTTATAAACCTAACAATACACATGAACAACTTTTAAGAAAAAGTGAAGCACAAGCG (SEQ ID No.22).

[0130] The designed sgRNA sequence is shown in the table below (SEQ ID No. 23):

[0131] Table 12

[0132]

[0133] The Cas enzyme, guided by sgRNA, binds to the amplification product, activating the trans-cleavage activity of the Cas protein. This trans-cleavage of the Reporter protein (which has a fluorescent group attached to one end and a quencher group attached to the other) results in fluorescence emission after Cas protein cleavage, thus providing the detection result. In the reaction system, the concentrations of Cas enzyme, target nucleic acid, sgRNA, and Reporter (fluorescent probe: FAM-TTTTTTT-BHQ1) were 0.2 μM, 0.1 μM, 0.25 μM, and 3.3 μM, respectively, and the reaction was carried out at 43 °C. FAM fluorescence signals were collected every minute. The detection efficiency of different Cas proteins was determined based on the changes in the fluorescence signal curve.

[0134] The screening results are as follows Figure 1 The results showed that the detection efficiency of the Cas12b mutant protein E958K was higher than that of the wild-type Cas12b protein, while the detection efficiency of the Cas12b mutant proteins E958R and E958H was lower than that of the wild-type Cas12b protein. These results indicate that the Cas12b mutant protein E958K has enhanced trans activity compared to the wild-type Cas12b protein. In this invention, the Cas12b mutant protein E958K is named AapCas12b-K.

[0135] The following Examples 2-4 use AapCas12b-K to detect Andean viruses.

[0136] Example 2: Target Design and sgRNA Design

[0137] This invention utilizes AapCas12b-K for the detection of Andean viruses. Targets were designed and developed for the target regions shown in Table 13.

[0138] Table 13 Information on the Detection Target Area

[0139]

[0140] 1. sgRNA design

[0141] Based on the host background genome to be avoided, bioinformatics algorithms are used to score sgRNA designs based on factors such as PAM position, GC%, internal dimer structure, fragment structural openness, base position preference, and specificity. The score can be understood as a success probability; generally, three candidate fragments with scores above 40 are retained. If the scores are generally below 40, the number of candidate fragments needs to be increased to improve the success probability. Sequences in the spacer that pose a risk of disrupting the backbone secondary structure are directly excluded from the candidate list to avoid risks to specificity and sensitivity.

[0142] Based on the above design principles, sgRNAs were designed for selected regions in this project for subsequent synthesis and validation. The spacer sequences of the designed sgRNAs were analyzed for coverage and specificity using NCBI primer-BLAST. The alignment results showed that the designed sgRNA spacer sequences achieved 100% coverage within the tested species, indicating good inclusiveness; the number of bases matching across species was <15 nt, indicating good specificity. To ensure specificity, the sgRNAs listed in Table 14 were selected for synthesis.

[0143] Table 14 sgRNA information used in this invention

[0144]

[0145] The underlined sequence represents the spacer region of the sgRNA. The target region sequences of ANDV-sgRNA-1, 2, and 3 are SEQ ID No. 1-3, and the backbone region sequence is SEQ ID No. 4, respectively; the sequences of ANDV-sgRNA-1, 2, and 3 are shown in SEQ ID No. 24-26, respectively.

[0146] 2. Validation of sgRNA screening performance

[0147] Based on the designed sgRNA location, PCR primers were designed within 100 bp upstream and downstream of the sgRNA (see Table 15). Primers were designed using commonly used PCR primer design software, with primer lengths controlled between 20-25 bp. If multiple sgRNA design sites exist within the same target fragment, the PCR amplification product (fragment length controlled within 500 bp) will contain all sgRNA binding sites, allowing all sgRNAs to be validated using the same template.

[0148] Table 15 Template amplification-specific primers (sequences are SEQ ID No. 5-6 respectively)

[0149]

[0150] PCR amplification was performed using plasmid / template DNA and corresponding primers to obtain high-concentration PCR products. Specific amplification systems are shown in Table 16, and the corresponding PCR reaction procedures are shown in Table 17.

[0151] Table 16 PCR System

[0152]

[0153] Table 17 PCR Procedure

[0154]

[0155] After PCR amplification, the amplification products were used for subsequent sgRNA performance verification.

[0156] Prepare the CRISPR system according to the system in Table 18.

[0157] Table 18 CRISPR System Configuration

[0158]

[0159] The Reporter is 5'-FAM-TTTTTTT-BQ1-3'.

[0160] Mix 1 μL of the PCR amplification product with the above CRISPR system, and incubate at 43℃ for 15 min in a qPCR instrument, collecting FAM fluorescence signals every minute. Based on the changes in the fluorescence signal curve, perform preliminary verification of sgRNA performance or specificity. The endpoint where the fluorescence value curves of the target amplification product and the negative control stop rising should be significantly different.

[0161] This invention uses the fluorescence intensity growth rate at different time points for data analysis of the detection results. The formula for calculating the fluorescence intensity growth rate is as follows:

[0162]

[0163] In this invention, Fluorescence Slope represents the fluorescence growth rate, Rn represents the fluorescence signal at minute n, and R1 represents the fluorescence signal of the negative control at minute 1.

[0164] Fluorescence intensity measurements were performed on the amplification products of the three sgRNAs targeting the ANDV and their corresponding templates using CRISPR reactions. The fluorescence curves and data analysis during the sgRNA optimization phase are shown in Figure 2. The results showed that the plateau times for sgRNA-1, sgRNA-2, and sgRNA-3 were 13 min, 7 min, and 9 min, respectively. The ANDV target ANDV-sgRNA-2 showed the best performance with a faster fluorescence growth rate and can be used for subsequent RPA primer screening.

[0165] Example 3: RPA Primer Design and Screening Validation

[0166] 1. RPA primer design

[0167] Within the target detection range, fragments of 30-35 bases in length were selected as candidate RPA primers. To ensure stability and specificity, the GC content of the RPA primers should be between 40% and 60%, and the RPA amplification fragments are typically 100-200 bp. Based on this primer design principle, this invention designed three upstream and three downstream primers for RPA primer screening and validation, and used NCBI primer-BLAST to verify amplification coverage and specificity.

[0168] Based on the above design principles, RPA primers as shown in Table 19 were designed for each plasmid / template in this invention for subsequent synthesis and verification experiments.

[0169] Table 19 RPA Primer List (Sequences are SEQ ID No. 7-12)

[0170]

[0171] 2. RPA-CRISPR reaction system configuration and experimental procedure

[0172] RPA primers were screened using ANDV-sgRNA-2, which had shown good performance in previous validation. The specific screening process, system, and workflow are as follows:

[0173] 1) Thoroughly mix the isothermal amplification lyophilized bulbs with 48 µL of amplification buffer;

[0174] 2) Take 12 µL of the liquid after dissolving the lyophilized bulbs and place it on the cap of the eight-tube strip, and add 1.6 µL of nucleic acid template;

[0175] 3) Take a new row of eight-tube strips and add 0.2µL of upstream primer and 0.2µL of downstream primer (primer concentration 100µM) to each.

[0176] 4) Add 1.0µL of magnesium acetate to the reaction tube. For multiple reactions, it is recommended to add magnesium acetate to the inside of the reaction tube in step 3, and slowly put on the eight-tube cap in step 2 to prevent the liquid in the cap from falling out. Do not mix for now.

[0177] 5) Prepare the CRISPR system to a volume of 10 µL. Add the following components: 0.4 µL of AapCas12b-K (2.5 µM), 0.2 µL of sgRNA (100 ng / µL), 1 µL of 10×AaCas12b Buffer, 0.1 µL of Reporter (12b-FAM) (100 µM), and bring the total volume to 10 µL with RNase-free ddH2O. Add the prepared CRISPR system to the caps of the new eight-tube tubing.

[0178] 6) Place the capped eight-tube bundle from step 4 on a centrifuge and centrifuge briefly to throw all components to the bottom of the tube. Vortex for 10 seconds to mix thoroughly.

[0179] 7) Discard the cap of the eight-tube in step 6, and slightly replace it with the cap of the eight-tube containing the CRISPR system from step 5 to prevent the CRISPR system from falling into the tube. Do not centrifuge, and then immediately place the reaction tube in a constant temperature device and incubate at 43°C for 30 minutes.

[0180] 8) After the RPA process is completed, briefly centrifuge to mix the RPA system with the CRISPR system, vortex for 10 seconds to mix thoroughly, and then place in an instrument capable of fluorescence reading, incubate at 43°C for 30 minutes, and read the fluorescence every 1 minute.

[0181] 3. RPA primer screening

[0182] Different combinations of RPA primers were screened by diluting plasmid samples to 1E4 copies / T and 1E3 copies / T, and a two-step RPA-CRISPR reaction was performed. The fluorescence curves and fluorescence growth rate trends of different primer sets in this procedure are shown in [the table below]. Figure 3 .

[0183] The ANDV target primer screening results showed that ANDV-RPA-F2 / R3 had strong fluorescence signals under both high concentration (1E4 copies / T) and low concentration (1E3 copies / T) conditions. Therefore, ANDV-RPA-F2 / R3 was selected for subsequent performance verification experiments.

[0184] Note 1: Considering the significant differences in primer reaction efficiency within 30 minutes, and that primers with higher reaction efficiency have reached the plateau phase, the fluorescence signal at 30 minutes was used to calculate the fluorescence growth rate.

[0185] Note 2: Formula for calculating plasmid copy number in this invention:

[0186]

[0187] In the above formula, N plasmid The calculated plasmid copy number concentration is expressed in copies / μL. N A denoted as Avogadro's constant, 6.02E+23; C represents the plasmid concentration after measurement, in ng / μL. N i 2710 is the number of base insertions in the plasmid, 660 is the fragment length of the puc57 vector, and 2710 is the average molecular weight of the base pairs.

[0188] This invention calculates the copy number concentration of plasmid at a specified concentration according to the above formula, and then dilutes it to a specific concentration for different verifications.

[0189] Example 4: Construction and Validation of the Testing System

[0190] 1. Sensitivity Verification

[0191] The plasmid template was serially diluted, with gradient settings including 1E4, 1E3, 1E2, 1E1, and 1E0 copies / T. The target sensitivity was validated using the primer (ANDV-RPA-F2 / R3) and sgRNA (ANDV-sgRNA-2) combinations selected above, along with the same RPA and CRISPR system. Each gradient was replicated three times for validation.

[0192] The amplification curve and fluorescence growth rate of ANDV target sensitivity verification in this invention are shown in Figure 4. The verification results show that the sensitivity of the two-step RPA-CRISPR detection system for ANDV target developed in this invention can reach 1E1 copies / T. The sensitivity will be confirmed at this concentration in the future.

[0193] Based on the ANDV target sensitivity validation, this project continued with 10 experimental replicates near the target detection limit to confirm the target sensitivity. The project selected ANDV target concentration groups of 1E1 and 5E1 copies / T for sensitivity confirmation. The amplification curves and fluorescence signal growth rates for ANDV target detection limit validation are shown in Figure 5.

[0194] The sensitivity verification and confirmation results of the two-step RPA-CRISPR detection system for the ANDV target show that the target exhibits good stability in the limit of detection and in 10 replicates near the limit of detection. Therefore, the limit of detection for the RS target in this project is 5E1 copies / T, and the detection sensitivity is more competitive than that of commonly used methods at present.

[0195] 2. Specificity verification

[0196] To ensure the specificity of ANDV target detection, this project used viral nucleic acids from coronaviruses (SARS-CoV-2), influenza A virus (H1N1), monkeypox virus, and hantaviruses (HTNV, SEOV) for specificity validation. Each sample was tested in triplicate, and the specificity validation results are shown in Figure 6. The results show that only ANDV nucleic acid samples exhibited specific fluorescence growth, indicating that the ANDV-based detection method developed in this project has good specificity.

[0197] In this project, a two-step isothermal amplification detection method based on RPA and CRISPR was developed for the ANDV target. This method eliminates the dependence on complex instrumentation platforms required by traditional molecular biology methods, greatly simplifying the detection platform. Through system establishment and validation, the overall detection time for the target was reduced to 50 minutes, with further potential for reduction in the future. The project also validated the sensitivity and specificity of the target detection technology. ANDV-sgRNA-2, combined with ANDV-RPA-F2 / R3, was found to be effective for detecting the ANDV target sgRNA, with a detection limit of 5E1 copies / T and good specificity.

[0198] In this invention, the positional relationship between sgRNA, primers, and target nucleic acids is shown in [the following text is missing]. Figure 7 .

[0199] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A method for detecting Andean viruses based on CRISPR technology, wherein the method is for non-disease diagnosis and treatment purposes, characterized in that, The method includes the following steps: S1. Amplify the sample to be tested to obtain the amplification product; The test sample was amplified using an RPA amplification primer set, the sequences of which are shown in SEQ ID No. 8 and SEQ ID No.

12. S2. The amplification product is contacted with Cas protein, sgRNA and single-stranded nucleic acid detector, and the detectable signal generated by the Cas protein cleaving the single-stranded nucleic acid detector is detected, thereby detecting Andean virus. The sgRNA includes a region that binds to Cas protein and a target region that hybridizes with the target nucleic acid, wherein the target nucleic acid is a nucleic acid derived from Andean virus. Compared with SEQ ID NO.13, the amino acid sequence of the Cas protein has a mutation at position 958, where E is changed to K; The sequence of the sgRNA is shown in any one of SEQ ID No. 24, SEQ ID No. 25 or SEQ ID No.

26.

2. The method according to claim 1, characterized in that, The detectable signal can be achieved through any of the following methods: vision-based detection, gold nanoparticle-based detection, fluorescence signal, electrochemical detection, or semiconductor-based detection.

3. The method according to claim 1, characterized in that, Step S1 is the RPA amplification method.

4. The method according to claim 3, characterized in that, Step S1 includes: (1) Mix the sample and amplification buffer thoroughly; (2) Take the mixture from (1) and add the nucleic acid template; (3) Add upstream and downstream primers; (4) Add magnesium acetate to the reaction tube.

5. The method according to claim 1, characterized in that, Step S2 is a CRISPR detection method, and the detection system in step S2 includes CRISPR buffer, Cas12b protein, sgRNA and single-stranded nucleic acid detector.

6. A system or composition for detecting Andean viruses, said system or composition comprising the RPA amplification primer set of claim 1, the Cas protein, the sgRNA of claim 1, and a single-stranded nucleic acid detector.

7. Use of the system or composition of claim 6 in the preparation of reagents or kits for detecting Andean viruses.

8. The use according to claim 7, wherein the use is for purposes other than disease diagnosis and treatment, characterized in that, The test samples were derived from animals.

Images