A kit for detecting bovine dermatophilus and its application

Abstract

The application provides a kit for detecting bovine dermatophilus and application thereof, and relates to the technical field of biological detection. The kit for detecting bovine dermatophilus comprises crRNA, Cas12a protein, a reporter molecule and a primer pair. The nucleotide sequence of the crRNA is shown as SEQ ID NO:1. The primer pair comprises F2 and R2. The nucleotide sequence of F2 is shown as SEQ ID NO:2, and the nucleotide sequence of R2 is shown as SEQ ID NO:3. The kit is used for detecting bovine dermatophilus, and has high sensitivity, good specificity and convenience for on-site application.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a kit for detecting bovine nodular dermatitis virus and its application. Background Technology

[0002] Lumpy skin disease (LSD) is a highly contagious viral disease in cattle caused by bovine lumpyskin disease virus (LSDV), and is listed as a notifiable infectious disease by the World Organisation for Animal Health (OIE). In recent years, LSD has spread from Africa to several countries in Europe and Asia, causing significant economic losses to the livestock industry. LSDV shares up to 96% genomic homology with goatpoxvirus (GTPV) and sheep poxvirus (SPPV), both belonging to the same genus, and exhibits serological cross-protection. Clinically, attenuated GTPV or SPPV vaccines are commonly used to immunize cattle for LSD prevention; therefore, detection methods must possess high specificity to distinguish between vaccine strains and wild-type strains.

[0003] Currently, LSDV detection methods mainly include virus isolation, serological testing, and molecular biological detection. Virus isolation is time-consuming, serological methods cannot distinguish between viral genera, and while conventional PCR and qPCR are widely used in laboratories, they require large instruments and are not suitable for rapid on-site detection. Isothermal amplification techniques such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP) can achieve on-site detection, but they exhibit cross-reactivity with GTPV and SPPV, and their sensitivity needs improvement. Therefore, developing a portable, ultrasensitive, highly specific detection kit that can distinguish LSDV from vaccine strains (GTPV or SPPV attenuated vaccines) is of great significance. Summary of the Invention

[0004] The purpose of this invention is to provide a reagent kit for detecting bovine nodular dermatitis virus and its application, which has high sensitivity, good specificity and is easy to use in the field.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A kit for detecting bovine nodular dermatosis virus includes crRNA, Cas12a protein, a reporter molecule, and a primer pair; the nucleotide sequence of the crRNA is shown in SEQ ID NO: 1; the primer pair includes F2 and R2, the nucleotide sequence of F2 is shown in SEQ ID NO: 2, and the nucleotide sequence of R2 is shown in SEQ ID NO: 3.

[0006] In this invention, the nucleotide sequence of the reporter molecule is 5'-TTTTTTTTTTTT-3', with a carboxyfluorescein label at the 5' end and a BHQ1 label at the 3' end.

[0007] In this invention, the nucleotide sequence of the reporter molecule is 5'-NNNNNNNNNNNNN-3', with Digoxin labeled at the 5' end and Biotin labeled at the 3' end.

[0008] This invention also provides a method for detecting bovine nodular dermatitis virus using the kit for non-diagnostic purposes, comprising the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, PCR or RAA amplification was performed using F2 and R2 as primers to obtain the amplification product; (3) Add 4 μL of the amplification product obtained in step (2), 10 μL of 10×NEBuffer 2.1, 1 μL of crRNA, 0.5 μL of Cas12a protein, 1 μL of reporter molecule, and 1 μL of RNase inhibitor to a microplate, add nuclease-free water to a final volume of 100 μL, and incubate at 37°C; use nuclease-free water as a negative control. (4) Result determination: When the fluorescence signal intensity of the test sample is greater than or equal to 5 times the fluorescence signal intensity of the negative control, it is judged as positive; otherwise, it is judged as negative.

[0009] This invention also provides a method for detecting bovine nodular dermatitis virus using the kit for non-diagnostic purposes, comprising the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, PCR or RAA amplification was performed using F2 and R2 as primers to obtain the amplification product; (3) Mix 4 μL of the amplification product obtained in step (3) with 0.25 μL of Cas12a protein, 0.5 μL of crRNA and 0.5 μL of reporter molecule in a 96-well microplate and incubate at 37°C for 90 min. (4) Result determination.

[0010] In this invention, after the reaction in step (3) is completed, 10 μL of the reaction solution is added to the sample pad of the lateral flow test strip and the test strip is chromatographically analyzed at room temperature. If a fluorescent band appears on both the detection line and the control line, it is judged as positive; if only the control line shows a fluorescent band, it is judged as negative; if the control line has no band, it is judged as invalid.

[0011] In this invention, if the reaction solution after the reaction in step (3) is irradiated with an ultraviolet lamp and shows green fluorescence, then it is positive.

[0012] The beneficial effects of this invention are as follows: (1) The CRISPR-Cas12a system was applied to LSDV detection for the first time. The crRNA was used to specifically identify the LSDVORF013 region, which has multiple deletion mutations in goat poxvirus and sheep poxvirus. Therefore, it can effectively distinguish LSDV from GTPV and SPPV vaccine strains and avoid cross-reaction.

[0013] (2) Combined with pre-amplification technology (PCR or RAA), the detection sensitivity reaches 1 copy / reaction, which is much higher than existing methods and is suitable for early infection detection.

[0014] (3) Provides three signal reading methods (fluorescence reading, ultraviolet visual inspection, and lateral flow test strip), which can be flexibly selected according to the application scenario to realize high-throughput detection in the laboratory or rapid screening on site.

[0015] (4) The entire testing process can be completed within 5 hours, with low cost (US$1.7-9.6 per test) and good prospects for promotion and application. Attached Figure Description

[0016] Figure 1 This is a schematic diagram illustrating the construction principle of the kit of the present invention. Figure A shows the sequence alignment of LSDV, GTPV, and SPPV in the ORF013, 096, and 109 regions, highlighting the mutation sites; Figure B is a schematic diagram of the detection process, including DNA extraction, pre-amplification, CRISPR trans-cutting, and signal reading.

[0017] Figure 2 This is the result of crRNA screening.

[0018] Figure 3 This is the specificity evaluation result of the bovine nodular dermatitis virus (BND) detection kit. Figure A shows the normalized photoluminescence signal after PCR or RAA target amplification; the horizontal axis represents the amplification method (PCR / RAA), and the vertical axis represents the normalized photoluminescence signal (au). Figures B, C, and D show the detection results of common susceptible bovine viruses (10T) using an ELISA reader, UV lamp, and lateral flow test strip, respectively. 9 Specificity at copy / sample, x-axis: virus type; y-axis: fluorescence intensity (au) or colorimetric intensity. Using LSDV-containing PCR products (10... 9 Copy / sample), nuclease-free water as positive (P) or negative (N) control.

[0019] Figure 4This section evaluates the sensitivity of the kit. Figures A, D, and G show the detection limits for serial dilutions of positive recombinant plasmids without amplification; Figures B, E, and H show the detection limits after RAA amplification; Figures C, F, and I show the detection limits after PCR amplification. In Figures A, B, and C, the x-axis represents plasmid concentration (copies / μL), and the y-axis represents fluorescence intensity (au). Figures D, E, and F show the results of UV visual detection, with the plasmid concentration (copies / μL) marked below. Figures G, H, and I show the color development of the lateral flow detection line, with the plasmid concentration (copies / μL) marked below. * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001 (n=3), **** indicates p < 0.0001, and NS indicates no significant difference.

[0020] Figure 5 For clinical sample testing. Figure A compares the results of the bovine nodular dermatitis virus (BND) detection kit (microplate assay, abbreviated as CRISPR), qPCR1, and qPCR2. The horizontal axis represents the sample number; the vertical axis represents the detection method, and colors indicate the results. Figures B, C, and D show the results obtained using an ELISA reader, UV lamp, and lateral flow test strip, respectively. In Figure A, blue represents negative and red represents positive. The results were obtained using PCR products containing LSDV (10... 9 A copy / sample or nuclease-free water was used as a positive (P) or negative (N) control. In Figure B, the horizontal axis represents time (min), and the vertical axis represents fluorescence intensity (au). Figure C shows the UV visual detection results, with numbers indicating sample numbers; Figure D shows the color intensity of the lateral flow detection line, with numbers indicating sample numbers. Detailed Implementation

[0021] The present invention will be further described below with reference to embodiments, but the scope of protection of the present invention is not limited thereto.

[0022] Example 1: Bovine nodular dermatitis virus detection kit and its usage method 1. Materials and Reagents The EZNA™ Viral DNA Kit (D3892-02) was purchased from Omega Bio-tek; the Recombinase-Assisted Amplification (RAA) Kit (#WLN8203KIT) was purchased from AMP-Future Biotech; 2×TSINGKE Master Mix (TSE002) was purchased from Beijing Qingke Biotechnology; EnGen™ LbCas12a (#M0653T) and NEBuffer™ 2.1 (#B7202S) were purchased from NewEngland Biolabs; and PerfectStart® II Probe qPCR SuperMix (AQ711-01) was purchased from Beijing TransGen Biotechnology. crRNA, reporter molecules, primers, and probes were all synthesized by Beijing Qingke Biotechnology.

[0023] The LSDV genome (NC_003027.1) was provided by the National Research Center for Exotic Animal Diseases, Qingdao Animal Health and Epidemiology Center; the genomic DNA or cDNA of GTPV, SPPV, bovine herpesvirus type 1 (BHV-1), pseudorabies virus (PRV), foot-and-mouth disease virus (FMDV), peste des petits ruminants virus (PPRV), and bovine viral diarrhea virus (BVDV) were provided by the China Veterinary Microbiology Culture Collection Center.

[0024] 2. crRNA Design and Screening The complete genome sequences of bovine nodular dermatitis virus (LSDV), goat poxvirus (GTPV), and sheep poxvirus (SPPV) are publicly available in the NCBI GenBank database. Representative reference strains for each virus were selected for multiple sequence alignment. The specific accession numbers are as follows: LSDV reference strain accession number: NC_003027.1; GTPV reference strain accession number: NC_004003.1; SPPV reference strain accession number: NC_004002.1. Bioinformatics software was used to perform comparative analysis of the complete genome sequences of the above three viruses, and specific regions of difference between strains were screened. Specific results are shown in [link to results]. Figure 1 Corresponding crRNAs were designed from the ORF013, ORF096, and ORF109 regions: 013-crRNA, 096-crRNA, and 109-crRNA (with multiple specific deletion mutations in the ORF013 region). These three crRNAs were synthesized by Beijing Qingke Biotechnology.

[0025] The sequence of 013-crRNA (SEQ ID NO: 1) is as follows: 5'-UAAUUUCUACUAAGUGUAGAUUAAGAGUGAUGAAGGAGUAUA-3'.

[0026] The sequence of 096-crRNA is as follows: 5'-uugauugguauccucuauauu-3'; The sequence of 109-crRNA is as follows: 5'-uuaucaagaucaagaucaagc-3'.

[0027] The specificity of each crRNA in activating the trans-cleavage activity of Cas12a was tested. PCR amplification was performed using viral genomic DNA as templates. The amplification products were mixed with Cas12a protein, crRNA, and a reporter molecule, and the reaction was carried out at 37°C before fluorescence signal detection. The results showed that only 013-crRNA could activate cleavage in the presence of LSDV, while it did not respond to GTPV and SPPV. Figure 2 Therefore, 013-crRNA was selected as the crRNA used in this invention (SEQ ID NO: 1).

[0028] 3. Primer design Two pairs of upstream primers (F1, F2) and two pairs of downstream primers (R1, R2) were designed for the LSDV ORF013 region. The amplification efficiency (F1 / R1, F1 / R2, F2 / R1, F2 / R2) was tested by combining the primers. Using LSDV genomic DNA as a template, RAA amplification was performed using different primer combinations, and the brightness of the amplified product bands was compared by agarose gel electrophoresis.

[0029] F1 sequence: 5'-ATGGAAAAAGTAACGACATTTATTTTC-3'; The sequence of R1 is: 5'-TTATATTTCATTTTTGTAAAGTGTTTT-3'; F2 sequence:: 5'-GGTTTAAAGACAGGGAAAAAATAAAC-3' (SEQ ID NO: 2); R2 sequence: 5'-GATTACACCGTGTATCCGTAGTTATGG-3' (SEQ ID NO: 3).

[0030] The optimal primer pair was determined to be F2 and R2.

[0031] 4. Bovine nodular dermatitis virus detection kit (microplate detection) and its usage method See the diagram illustrating how to use the kit. Figure 1 .

[0032] (1) Bovine nodular dermatitis virus detection kit (microplate detection) The Bovine Nodular Dermatitis Virus Detection Kit (microplate detection) includes: crRNA, Cas12a protein, reporter molecule 1, and primer pairs.

[0033] crRNA: crRNA can guide the Cas12a protein to specifically recognize the target nucleic acid fragment of bovine nodular dermatitis virus (LSDV) at a concentration of 12.5 nM. The crRNA sequence (SEQ ID NO: 1) is as follows: 5'-UAAUUUCUACUAAGUGUAGAUUAAGAGUGAUGAAGGAGUAUA-3'.

[0034] Cas12a protein: 25 nM, purchased from NEB, EnGen™ LbCas12a (#M0653T); Reporter molecule 1: The nucleotide sequence (SEQ ID NO:4) of reporter molecule 1 is as follows: 5'-TTTTTTTTTTTT-3', with FAM (carboxyfluorescein) labeled at the 5' end and BHQ1 labeled at the 3' end. The complete structure of reporter molecule 1 is 5'-Fam-TTTTTTTTTTTT-BHQ1-3', at a concentration of 10 nM.

[0035] Primer pairs: including F2 and R2, both at a concentration of 10 μM. The nucleotide sequence of F2 (SEQ ID NO: 2) is as follows: 5'-GGTTTAAAGACAGGGAAAAAATAAAC-3'; the nucleotide sequence of R2 (SEQ ID NO: 3) is as follows: 5'-GATTACACCGTGTATCCGTAGTTATGG-3'.

[0036] (2) Instructions for use of the bovine nodular dermatitis virus detection kit (microplate detection) ① DNA was extracted from the sample using conventional methods.

[0037] ② Using the extracted DNA as a template, PCR or RAA amplification was performed using primer pairs (F2 and R2) to obtain the amplification product.

[0038] PCR amplification: Reaction system: 4 μL DNA template, 12.5 μL 2×TSINGKE Master Mix, 1 μL each of 10 μM primer F2 and 10 μM primer R2, and nuclease-free water to a final volume of 25 μL. Amplification program: 94℃ pre-denaturation for 5 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 35 cycles; extension at 72℃ for 10 min. After the PCR reaction, DNA was extracted using DNA extraction reagent, and the supernatant was used as the amplification product.

[0039] RAA Amplification: Prepare the reaction mixture (50 μL) according to the Recombinase-Assisted Amplification (RAA) kit instructions: 4 μL DNA template, 2 μL each of 10 μM primer F2 and 10 μM primer R2, and the remaining components (RAA enzyme mixture, buffer, dNTPs) are provided by the kit. Incubate at 37℃ for 1 h. After incubation, extract the DNA using DNA extraction reagent and use the supernatant as the amplification product.

[0040] ③ Add 4 μL of the amplification product obtained in step ②, 10 μL of 10×NEBuffer 2.1 (purchased from NEB, #B7202S), 1 μL of crRNA (12.5 nM), 0.5 μL of Cas12a protein (25 nM), 1 μL of reporter molecule 1 (10 nM), and 1 μL of RNase inhibitor (0.5 U / μL, Yisheng 10703ES05) to a microplate, and add nuclease-free water to a final volume of 100 μL. Incubate at 37°C, and detect the fluorescence signal every 1 min using a microplate reader at an excitation wavelength of 494 nm and an emission wavelength of 518 nm. Nuclease-free water serves as a negative control.

[0041] ④ Result determination If the fluorescence signal intensity of the test sample is greater than or equal to 5 times that of the negative control, it is judged as positive; otherwise, it is judged as negative.

[0042] (3) Bovine nodular dermatitis virus detection kit (lateral flow detection and ultraviolet visual detection) The Bovine Nodular Dermatitis Virus Detection Kit (Lateral Flow Detection and UV Visual Detection) includes: crRNA, Cas12a protein, reporter molecule 2, primer pairs, and lateral flow strips (LFS).

[0043] crRNA: crRNA can guide the Cas12a protein to specifically recognize the target nucleic acid fragment of bovine nodular dermatitis virus (LSDV), the sequence of which is shown in SEQ ID NO: 1, and the concentration is 12.5 nM.

[0044] Cas12a protein: concentration 25 nM, purchased from NEB, is EnGen™ LbCas12a (#M0653T). Reporter molecule 2: The nucleotide sequence of reporter molecule 2 is as follows: 5'-NNNNNNNNNNNNN-3', with Digoxin labeled at the 5' end and Biotin labeled at the 3' end. The complete structure of reporter molecule 2 is 5'-Digoxin-NNNNNNNNNNNNN-Biotin-3', with a concentration of 50 nM, where N is any deoxyribonucleotide.

[0045] Primer pairs: including F2 and R2, both at a concentration of 10 μM. The nucleotide sequence of F2 is shown in SEQ ID NO: 2; the nucleotide sequence of R2 is shown in SEQ ID NO: 3.

[0046] The lateral flow test strip (LFS) was prepared according to the method of Zeng et al. (Microchem. J. 2020, 156, 104982) with modifications. The specific method is as follows: 0.085 g / L chloroauric acid aqueous solution and 0.18 g / L trisodium citrate aqueous solution were mixed at a volume ratio of 100:3, boiled for 10 min, and allowed to cool naturally to obtain a gold nanoparticle (AuNP) solution. 1 mL of AuNP solution was taken, and 4 μL of 1 mg / mL anti-digoxin mouse antibody (purchased from Abcam, #ab77315) was added. After stirring for 1 h, 10% (w / w) BSA aqueous solution was added, and stirring was continued for 1 h. After centrifugation at 8000 rpm for 10 min, the precipitate was resuspended in an aqueous solution containing 9% (w / w) BSA and 1% (w / w) sucrose to obtain the AuNP-anti-digoxin antibody conjugate. The sample pads were soaked in Tris-HCl buffer (0.05 M, pH 8.0) containing 0.15 M NaCl and 0.25% (v / v) Triton X-100; the conjugation pads were soaked in PB buffer (0.01 M, pH 7.4) containing 5% (w / w) sucrose, 0.25% (w / w) PEG 20000, 0.3% (v / w) Tween 20 and 1% (w / w) trehalose, dried, and then 6 μL of 1 mg / mL AuNP-anti-digoxigenin antibody conjugate was added. The membranes were then dried at room temperature. The detection line of the nitrocellulose membrane was coated with 1 mg / mL streptavidin (ThermoFisher, #21125), and the control line was coated with 1 mg / mL goat anti-mouse antibody (Abcam, #ab6789). After drying at 37℃ for 2 hours, the strips were assembled into lateral flow test strips using conventional methods.

[0047] (4) Instructions for use of the bovine nodular dermatitis virus detection kit (lateral flow detection and ultraviolet visual detection): Steps ① and ② are the same as those for the Bovine Nodular Dermatitis Virus Detection Kit (lateral flow detection and ultraviolet visual detection).

[0048] ③ Mix 4 μL of the amplification product obtained in step ② with 0.25 μL of Cas12a protein at a concentration of 25 nM, 0.5 μL of crRNA at a concentration of 12.5 nM, and 0.5 μL of reporter molecule 2 at a concentration of 50 nM in a 96-well microplate and incubate at 37°C for 90 min.

[0049] ④ Result determination: Lateral flow detection: Take 10 μL of the reaction solution after the reaction in step ③ and add it to the sample pad of the lateral flow test strip. After chromatography at room temperature for 5-10 min, interpret the results visually using a UV transilluminator at a wavelength of 302 nm. If both the test line and the control line show a fluorescent band, the result is positive; if only the control line shows a fluorescent band, the result is negative; if the control line shows no band, the result is invalid.

[0050] Ultraviolet visual inspection: Take the reaction solution after the reaction in step ③ is completed and irradiate it with an ultraviolet lamp. If there is green fluorescence, it is positive.

[0051] Example 3 Specificity Evaluation The genomic DNA or cDNA (10⁻¹⁰) of LSDV (bovine nodular dermatitis virus), GTPV (goat pox virus), SPPV (sheep pox virus), BHV-1 (bovine herpesvirus type 1), PRV (pseudorabies virus), FMDV (foot-and-mouth disease virus), PPRV (small ruminant peste virus), and BVDV (bovine viral diarrhea virus) were used respectively. 9 Using copy / reaction as a template, the bovine nodular dermatitis virus (BSDV) detection kit (microplate detection) and the bovine nodular dermatitis virus (BSDV) detection kit (lateral flow detection and UV visual detection) from Example 1 were used for detection. The results showed that only LSDV could activate a significant fluorescent signal (…). Figure 3 (B), both UV visual and lateral flow test strips showed only LSDV positivity. Figure 3 (C and D in the text) demonstrate that this kit has high specificity.

[0052] Example 4 Sensitivity Evaluation The LSDV ORF013 sequence (refer to the ORF013 region in NC_003027.1, the specific sequence is as follows: agaagaagaatcgttagaaa caagtgatgt tccgtctttg aagcaatcta attataaagttggctcgtcc atatctattaatatagagga taccaatcaa caaaatataa ctaacgcaagcctaataagt tctaaaatat cagctattaaaaaaagatac acaagaagag taagtttatttgaaattact ggtattatag ctgaaagtta taatcttttacaacgtggaa gaatgccacttgtattaaat ttatcagatg atactatgaa acaaaagatt ttacatatagttattgaagaaattaaagag ggtacttgtc ctataataat tgaaaagaat ggagaattgt The recombinant plasmid pUC57-ORF013 was constructed by inserting tatccgtaac into the Xba I restriction site of the pUC57 vector. The recombinant plasmid pUC57-ORF013 was then serially diluted 10-fold (10...). 0 ~10 9 The amplification step was performed using bovine nodular dermatitis virus (BND) detection kits (microplate detection) and (lateral flow and UV visual detection), starting from step ① or directly from step ③. When the amplification step is omitted, the detection limit for the microplate detection method is 10-1. 8 The limits of detection for copy / reaction, UV visual detection, and lateral flow detection were 10⁻⁶. 9 Copy / reaction and 10 8 Copy / reaction. After RAA or PCR pre-amplification (i.e., using both kits starting from step ①), the detection limit of the microplate reached 1 copy / reaction. Figure 4 (B, 4C) The detection limits for the UV visual detection method are 10 copies / reaction (RAA) and 10 copies / reaction (PCR), while the detection limits for lateral flow chromatography are 7 copies / reaction (RAA) and 4 copies / reaction (PCR). This indicates that the two kits of the present invention have extremely high sensitivity, significantly superior to existing methods.

[0053] Example 5 Clinical Sample Testing LSDV-negative beef was purchased from a supermarket, and 50 homogenate samples were prepared. The specific method is as follows: 5 g of beef was taken, 1 mL of pH 7.4 PBS buffer was added, homogenized, and the supernatant was collected by centrifugation as one homogenate sample. Among these, 25 homogenate samples were infused with different amounts of LSDV genomic DNA (10 g / mL). 6 ~10 9 (Copies), with another 25 homogenate samples serving as negatives. Bovine nodular dermatitis virus (BND) detection kits (microplate detection), qPCR1 (Alexander et al., BMC Res. Notes 2019, Vol. 12, p. 371), and qPCR2 (Chinese National Standard GB / T 39602-2020) were used for detection. Results ( Figure 5 A) The results showed that the bovine nodular dermatitis virus (BND) detection kit (microplate assay) detected 25 positive and 25 negative samples, which was completely consistent with the expectation. For qPCR1, 23 out of the 25 expected positive samples were positive and two were false negatives; 24 out of the 25 expected negative samples were negative and one was a false positive. For qPCR2, 25 positive and 25 negative samples were detected (consistent with expectations). The BND detection kit (microplate assay) showed no false positives or false negatives and good repeatability (intra-assay RSD 1.72%, inter-assay RSD 5.11%). Consistent results were also obtained using UV visual detection and lateral flow assays with the BND detection kit. Figure 5 (C, 5D) This demonstrates that both the Bovine Nodular Dermatitis Virus Detection Kit (microplate detection) and the Bovine Nodular Dermatitis Virus Detection Kit (lateral flow detection and ultraviolet visual detection) can be used for rapid on-site screening.

[0054] Example 6 Cost and Time Analysis Taking 50 samples as an example, the cost of the bovine nodular dermatitis virus (BND) detection kit (microplate detection) is approximately 12 yuan per test, while the cost of the lateral flow test strip in the bovine nodular dermatitis virus (BND) detection kit (UV detection) is approximately 65 yuan per test. From DNA extraction to result reporting, the entire process takes about 5 hours, with the CRISPR reaction time being 30-90 minutes, making it suitable for large-scale screening.

Claims

1. A kit for detecting bovine nodular dermatitis virus, characterized in that... The kit includes crRNA, Cas12a protein, reporter molecule and primer pair; the nucleotide sequence of the crRNA is shown in SEQ ID NO: 1; the primer pair includes F2 and R2, the nucleotide sequence of F2 is shown in SEQ ID NO: 2 and the nucleotide sequence of R2 is shown in SEQ ID NO:

3.

2. The kit according to claim 1, characterized in that... The nucleotide sequence of the reporter molecule is 5'-TTTTTTTTTTTT-3', with a carboxyfluorescein label at the 5' end and a BHQ1 label at the 3' end.

3. The kit according to claim 1, characterized in that... The reporter molecule has a nucleotide sequence of 5'-NNNNNNNNNNNNN-3', with Digoxin labeled at the 5' end and Biotin labeled at the 3' end.

4. A method for detecting bovine nodular dermatitis virus using the kit described in claim 1 for non-diagnostic purposes, characterized in that... Includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, PCR or RAA amplification was performed using F2 and R2 as primers to obtain the amplification product; (3) Add 4 μL of the amplification product obtained in step (2), 10 μL of 10×NEBuffer 2.1, 1 μL of crRNA, 0.5 μL of Cas12a protein, 1 μL of reporter molecule, and 1 μL of RNase inhibitor to a microplate, add nuclease-free water to a final volume of 100 μL, and incubate at 37°C; use nuclease-free water as a negative control. (4) Result determination: When the fluorescence signal intensity of the test sample is greater than or equal to 5 times the fluorescence signal intensity of the negative control, it is judged as positive; otherwise, it is judged as negative.

5. A method for detecting bovine nodular dermatitis virus using the kit described in claim 1 for non-diagnostic purposes, characterized in that... Includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, PCR or RAA amplification was performed using F2 and R2 as primers to obtain the amplification product; (3) Mix 4 μL of the amplification product obtained in step (2) with 0.25 μL of Cas12a protein, 0.5 μL of crRNA and 0.5 μL of reporter molecule in a 96-well microplate and incubate at 37°C for 90 min. (4) Result determination.

6. The method according to claim 5, characterized in that... After the reaction in step (3) is completed, 10 μL of the reaction solution is added to the sample pad of the lateral flow test strip. The test strip is then subjected to chromatography at room temperature. If a fluorescent band appears on both the detection line and the control line, the result is considered positive. If only the control line shows a fluorescent band, the result is considered negative. If the control line shows no band, the result is considered invalid.

7. The method according to claim 5, characterized in that... If the reaction solution after the reaction in step (3) is completed is irradiated with an ultraviolet lamp and shows green fluorescence, then it is positive.

Images