Infectious hematopoietic necrosis virus full premixed real-time fluorescent detection kit

Abstract

The application provides a full-premix real-time fluorescent detection kit for infectious hematopoietic necrosis virus, and belongs to the technical field of biological detection. The kit comprises a full-premix detection mixed solution, the mixed solution comprises upstream and downstream stem-loop primers, a detection probe and an enzyme; the upstream stem-loop primer comprises a stem part and a loop part, the stem part is formed by complementary pairing of a functional domain 1 and a functional domain 3 of the upstream stem-loop primer, the loop part is a functional domain 2 of the upstream stem-loop primer, and a functional domain 4 of the upstream stem-loop primer is connected to the 3' end of the functional domain 3 of the upstream stem-loop primer; the downstream stem-loop primer comprises a stem part and a loop part, the stem part is formed by complementary pairing of a functional domain 1 and a functional domain 3 of the downstream stem-loop primer, the loop part is a functional domain 2 of the downstream stem-loop primer, and a functional domain 4 of the downstream stem-loop primer is connected to the 3' end of the functional domain 3 of the downstream stem-loop primer; and the nucleotide sequence of the detection probe is shown in SEQ ID No: 4. The kit is uniform and stable, can rapidly, highly sensitively and highly specifically detect the infectious hematopoietic necrosis virus, and is easy to control pollution.

Description

Technical Field

[0001] This invention belongs to the field of agricultural and aquatic organism detection technology, specifically relating to a fully premixed real-time fluorescence detection kit for infectious hematopoietic organ necrosis virus. Background Technology

[0002] Infectious hematopoietic necrosis (IHN) is a viral disease caused by infectious hematopoietic necrosis virus (IHNV), primarily affecting Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) in the salmonid family, with a mortality rate as high as 90%, significantly impacting both wild and farmed fish populations. Previous studies have shown that IHNV can persist in the blood of rainbow trout for an extended period (approximately one year). Adult fish infected with IHNV may not exhibit clinical symptoms but can still act as transmission vectors. Furthermore, acute IHNV infection can lead to high mortality rates within a short period. These findings highlight the importance of early detection in both acute and latent stages of IHNV infection. Several diagnostic methods for IHNV have been developed, including enzyme-linked immunosorbent assay (ELISA), fluorescent antibody assays, immunohistochemistry, and molecular methods. The World Organisation for Animal Health (WOAH) recommends using cell culture for virus isolation or real-time quantitative RT-qPCR for the diagnosis of clinically diseased fish.

[0003] For the detection of infectious hematopoietic necrosis virus (IHNV), RT-qPCR technology achieves high-precision detection at the molecular level. By designing specific primers and probes targeting the conserved gene sequences of the virus, its detection sensitivity can reach less than 10 copies / μL. Compared with traditional virus isolation and culture methods that require 7–14 days and immunofluorescence detection, the detection efficiency is improved by more than 100 times, enabling early detection during the incubation period of viral infection. This effectively solves the problem of difficulty in early detection and delayed diagnosis of IHNV in actual testing. Although RT-qPCR has significant advantages, traditional detection systems are still relatively complex in operation. Experimenters need to perform thawing, mixing, aliquoting, and dilution of various reagents such as primers, probes, enzymes, and buffers. This process is not only lengthy and time-consuming but also prone to introducing contamination during operation. In contrast, the fully premixed reaction system pre-prepares all the reagents required for amplification. Usually, only template RNA needs to be added for direct fluorescence amplification. This not only greatly simplifies the sample pretreatment process and reduces operational errors such as missed or incorrect additions but also better adapts to the needs of high-throughput detection, significantly improving detection throughput.

[0004] However, the stability of fully premixed systems during long-term storage remains a key technical challenge. At 4°C or room temperature, primers and probes can spontaneously form non-specific dimers or secondary structures, leading to non-specific amplification. This not only interferes with the target amplification reaction and consumes effective reaction components but also causes a decrease in fluorescence signal, a lag in Ct values, or abnormally early Ct values, significantly increasing the incidence of false positives. When the amplification efficiency of primer dimers exceeds that of the target nucleic acid, it can even completely inhibit target amplification, resulting in no amplification curve and ultimately a sharp decline in detection sensitivity. Therefore, developing a fully premixed fluorescence quantitative PCR kit for IHNV that is rapid, sensitive, specific, contamination-resistant, and long-term uniformly stable has significant research value and practical application implications. Summary of the Invention

[0005] This invention provides a fully premixed real-time fluorescent detection kit for infectious hematopoietic necrosis virus. The kit is uniform and stable, and can detect infectious hematopoietic necrosis virus rapidly, with high sensitivity and high specificity, and is easy to control for contamination.

[0006] The objective of this invention is achieved through the following technical solution: A fully premixed real-time fluorescence detection kit for infectious hematopoietic necrosis virus (IHCV) includes a fully premixed RT-qPCR detection mixture. The RT-qPCR fully premixed detection mixture includes an upstream stem-loop primer, a downstream stem-loop primer, a detection probe, and an enzyme for amplification and detection. The upstream stem-loop primer comprises a stem and a loop. The stem of the upstream stem-loop primer is formed by complementary pairing of its functional domain 1 and functional domain 3, and the loop is its functional domain 2. The 3' end of functional domain 3 of the upstream stem-loop primer is connected to its functional domain 4. The functional domains 1 to 4 of the upstream stem-loop primer correspond to bases 1 to 6, 7 to 12, 13 to 18, and 19 to 32 of SEQ ID NO:2, respectively. The downstream stem-loop primer comprises a stem and a loop. The stem of the downstream stem-loop primer is formed by complementary pairing of its functional domain 1 and functional domain 3, and the loop is its functional domain 2. The 3' end of functional domain 3 of the downstream stem-loop primer is connected to its functional domain 4. The functional domains 1 to 4 of the downstream stem-loop primer correspond to bases 1 to 6, 7 to 12, 13 to 18, and 19 to 32 of SEQ ID NO:2, respectively. The bases at positions 1-6, 7-12, 13-18, and 19-32 of NO:3; the 5' end of the detection probe is labeled with the fluorescent group FAM, and the 3' end is labeled with the quencher group BHQ1, and the nucleotide sequence is shown in SEQ ID No:4.

[0007] In this invention, the enzymes used for amplification detection include M-MLV reverse transcriptase, Taq DNA polymerase, and thermosensitive UNG enzyme.

[0008] In this invention, the kit also includes a positive control, which is a pseudovirus particle carrying a conserved target sequence of the infectious hematopoietic necrosis virus gene.

[0009] In the present invention, the nucleotide sequence of the target sequence in the conserved region of the infectious hematopoietic necrosis virus gene is shown as SEQ ID No.1.

[0010] The present invention further provides a method for detecting infectious hematopoietic necrosis virus using the kit for non-diagnostic purposes, comprising the following steps: (1) Extract the RNA of the sample to serve as template RNA; take 10 μL of the RT-qPCR fully premixed detection mixture and 10 μL of template RNA, and mix them to obtain a reaction system; (2) Place the reaction system obtained in step (1) in a real-time fluorescent quantitative PCR instrument, with the reaction program as follows: 50°C for 10 min; 95°C for 3 min; 45 cycles of 95°C for 15 s and 60°C for 30 s; collect the fluorescence signal of the FAM channel to obtain the Ct value; (3) Criteria for result interpretation: when the Ct value ≤ 38, the test result of the sample is determined to be positive; when the Ct value ≥ 40 or no Ct value is obtained, the test result of the sample is determined to be negative; when 38 < Ct < 40, the sample needs to be retested, if the Ct value after retest ≤ 38 or 38 < Ct value after retest < 40, the test result of the sample is determined to be positive; if the Ct value after retest ≥ 40 or no Ct value is obtained, the test result of the sample is determined to be negative.

[0011] The present invention has the following advantages compared with the prior art: (1) The present invention provides a fully premixed real-time fluorescent detection kit for infectious hematopoietic necrosis virus, which is based on RT-qPCR technology with high sensitivity and high specificity. The kit simplifies the operation process, reduces errors, and improves detection accuracy, uniformity and repeatability. The closed reaction system reduces the risk of contamination and improves detection stability. The process is optimized to reduce costs, improve efficiency, and enhance market competitiveness. The kit provides key technical support for molecular detection of aquatic animal diseases.

[0012] (2) The fully premixed real-time fluorescent detection kit for infectious hematopoietic necrosis virus of the present invention relies on the innovation of stem-loop structure-mediated primer design to construct a molecular self-locking system in the fully premixed system of primers, probes and enzymes, so as to improve reaction stability and detection specificity at the molecular level. In the self-locking state, the primer molecules are arranged in an orderly manner, which reduces the entropy of the reaction system, inhibits non-specific binding between molecules, and blocks non-specific annealing and extension. This strategy can eliminate false positives caused by non-specific amplification of fully premixed reagents and improve key technical bottlenecks such as insufficient fluorescence signal increment. The present invention realizes dynamic balance through conformational regulation, and provides a core molecular basis and technical guarantee for the stable storage and accurate detection of the fully premixed nucleic acid detection system; (3) The fully premixed real-time fluorescent detection kit for infectious hematopoietic necrosis virus of the present invention solves the problems of high dependence on enzyme raw materials and disordered amplification of primer-probe dimers in traditional fully premixed kits through the innovative design of stem-loop primer structure. The stem-loop primer can form hairpin structure or homodimer, which can effectively inhibit non-specific binding between primers and significantly reduce the requirements for Taq DNA polymerase and antibody blocking efficiency. This design can avoid non-specific amplification caused by enzyme activity leakage of Taq DNA polymerase, fundamentally solving the false positive problem caused by enzyme activity leakage in traditional methods, and providing an economical and efficient solution for high-throughput nucleic acid detection; (4) The primer design strategy of this invention has significant thermodynamic and kinetic advantages over the traditional molecular beacon hairpin structure. Traditional molecular beacons rely on the complementary pairing of the 5' and 3' ends to form a closed stem-loop structure, and the unwinding requires a temperature increase and other passive methods, which have two major drawbacks: thermodynamically, they cannot spontaneously initiate the chain displacement reaction, and the stem is difficult to unlock, leading to primer failure, manifested as abnormal amplification curves, delayed Ct values, and insufficient fluorescence signal amplification; kinetically, at low concentrations of target nucleic acids, they tend to maintain their own conformation, making it difficult to bind to the target and reducing detection sensitivity. In contrast, this invention innovates the stem-loop primer structure, setting functional domains 2-4 as target nucleic acid-specific binding sequences, with functional domain 2 forming the loop, functional domain 4 being a free sequence, and functional domains 1 and 3 forming a self-locking stem, which can be dynamically and adaptively controlled. When the target nucleic acid is present, functional domain 4 of the stem-loop primer triggers the chain displacement reaction, thermodynamically preferentially forming the stem-loop-target complex for unlocking, and kinetically increasing the chain displacement rate, breaking through the bottleneck of low-abundance nucleic acid detection sensitivity. Using this stem-loop primer in the IHNV fully premixed nucleic acid detection kit can solve the problems of enzyme raw material dependence and non-specific dimer amplification of primers and probes in traditional fully premixed systems. Its hairpin structure inhibits non-specific primer binding, reduces the requirements for Taq DNA polymerase activity and antibody blocking efficiency, eliminates false positives caused by enzyme activity leakage, and provides an economical, efficient and stable solution for high-throughput nucleic acid detection. (5) This invention innovatively designs a stem-loop primer structure, achieving high efficiency compatibility with the one-step reverse transcription RNA amplification system of infectious hematopoietic necrosis virus. Unlike traditional rigid hairpin primers, this invention retains an unclosed functional domain (functional domain 4) at the 3' end of the stem-loop primer. This functional domain dynamically unwinds at the reverse transcription temperature (42℃–55℃) and binds efficiently to the IHNV RNA template. During reverse transcriptase extension, the stem-loop primer releases the hairpin structure through a strand displacement reaction, maintaining the primer active site and preferentially forming a stem-loop-target complex. The free, flexible stem structure enhances the unwinding rate, ensuring reverse transcription efficiency. The core advantages are: firstly, the unclosed stem exhibits good thermal stability at the reverse transcription temperature (e.g., 50℃), inhibiting primer self-unwinding and the formation of non-specific dimers, thus ensuring detection specificity; secondly, it improves the primer-template binding efficiency, resulting in amplification product specificity and sensitivity superior to traditional hairpin primers. This conformational dynamic regulation strategy enables primers to function as both DNA amplification primers and reverse transcription guiding primers, providing an innovative solution for the development of fully premixed RT-qPCR reagents for IHNV detection. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of this application, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 The diagram shows two self-locking states of stem-loop primers. The left figure shows the hairpin structure formed by the upstream or downstream stem-loop primers, and the right figure shows the homodimer formed between two upstream stem-loop primers or two downstream stem-loop primers. The numbers in the diagram indicate the names of the structural domains.

[0015] Figure 2 The diagrams show the reverse transcription reaction of stem-loop primers binding to target RNA in two states, as well as the PCR process of stem-loop primers binding to target cDNA. The numbers in the diagrams represent the names of the structural domains.

[0016] Figure 3 This graph shows the sensitivity comparison between the kit of the present invention and the traditional IHNV RT-qPCR detection kit. The green curve corresponds to the kit of the present invention, and the blue curve corresponds to the traditional IHNV RT-qPCR detection kit.

[0017] Figure 4The images show the fluorescence amplification results of the traditional IHNV RT-qPCR detection kit after storage at 37°C for 0 and 3 days. The green fluorescence amplification curve represents the result after storage at 37°C for 0 days; the blue fluorescence amplification curve represents the result after storage at 37°C for 3 days. The sample concentrations corresponding to the same color amplification curves from left to right are 10000 copies / μL, 1000 copies / μL, 100 copies / μL, and 10 copies / μL, respectively.

[0018] Figure 5 The images show the fluorescence amplification results of the kit after storage at 37°C for 0 days and 3 days. The green curve represents the fluorescence amplification result after storage at 37°C for 0 days; the blue curve represents the fluorescence amplification result after storage at 37°C for 3 days. The amplification curves of the same color correspond to sample concentrations of 10000 copies / μL, 1000 copies / μL, 100 copies / μL, and 10 copies / μL, respectively, from left to right.

[0019] Figure 6 The results represent the detection rate of the traditional IHNV RT-qPCR detection kit.

[0020] Figure 7 The results show the detection rate of the reagent kit of this invention. Detailed Implementation

[0021] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are merely some embodiments of this application, and not all embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort should fall within the functional domain protected by this application. Unless otherwise specified, the methods described in the following embodiments are conventional methods in the art.

[0022] Example 1: Infectious Hematopoietic Necrosis Virus Fully Premixed Real-Time Fluorescent Detection Kit and its Usage Method The fully premixed real-time fluorescence detection kit for infectious hematopoietic necrosis virus (hereinafter referred to as the kit of this invention) includes: RT-qPCR fully premixed detection mixture, positive control and negative control.

[0023] 1. RT-qPCR fully premixed detection solution The fully premixed RT-qPCR detection solution contains 250 nM upstream stem-loop primers, 250 nM downstream stem-loop primers, 125 nM detection probe (see Table 1), and 2×RT-qPCR Mix. The specific preparation method is as follows: Take 25 μL of 10 μM upstream stem-loop primers, 25 μL of 10 μM downstream stem-loop primers, 12.5 μL of 10 μM detection probe, and 500 μL of 4×RT-qPCR Mix (purchased from Bailige Biotechnology (Shanghai) Co., Ltd., catalog number: SM0361, containing M-MLV reverse transcriptase, Taq DNA polymerase, thermosensitive UNG enzyme, and reaction buffer) and mix them together. Then, add nuclease-free water to make up the volume to 1000 μL.

[0024] (1) Upstream stem-loop primers (designed for the N gene sequence of IHNV virus) The upstream stem-loop primer, as shown in SEQ ID NO:2, includes a stem and a loop. The stem is formed by complementary pairing of its own functional domain 1 and functional domain 3, and the loop is its own functional domain 2. The 3' end of the functional domain 3 of the upstream stem-loop primer is connected to its own functional domain 4. The functional domain 1 of the upstream stem-loop primer corresponds to the 1st to 6th bases of SEQ ID NO:2; the functional domain 2 of the upstream stem-loop primer corresponds to the 7th to 12th bases of SEQ ID NO:2; the functional domain 3 of the upstream stem-loop primer corresponds to the 13th to 18th bases of SEQ ID NO:2; and the functional domain 4 of the upstream stem-loop primer corresponds to the 19th to 32nd bases of SEQ ID NO:2.

[0025] The stem structure of the upstream stem-loop primer remains stable during reverse transcription and PCR annealing and extension stages.

[0026] The sequence of functional domain 2 of the upstream stem-loop primer can specifically recognize the infectious hematopoietic necrosis virus gene sequence and is not complementary to other functional domains of the upstream stem-loop primer; the sequences of functional domains 3 and 4 of the upstream stem-loop primer can specifically recognize the infectious hematopoietic necrosis virus gene sequence, and functional domain 4 of the upstream stem-loop primer exists in single-stranded form and its sequence is not complementary to other functional domain sequences of the upstream stem-loop primer.

[0027] like Figure 1 The upstream stem-loop primers form their own hairpin structure by complementing functional domains 1 and 3. On the other hand, the functional domain 1 and functional domain 3 sequences of one upstream stem-loop primer are complementary to the functional domain 3 and functional domain 1 sequences of another upstream stem-loop primer, respectively. That is, the two upstream stem-loop primers can be assembled into a more stable homodimer through the complementarity of functional domains 1 and 3. The dual structure ensures its conformational stability.

[0028] Table 1. Sequences of each primer and probe

[0029] Note: In Table 1, bold uppercase letters represent functional domain 1, lowercase letters represent functional domain 2, italic uppercase letters represent functional domain 3, and underlined uppercase letters represent functional domain 4.

[0030] (2) Downstream stem-loop primers (designed for the N gene sequence of IHNV virus) The downstream stem-loop primer, as shown in SEQ ID NO:3, includes a stem and a loop. The stem of the downstream stem-loop primer is formed by complementary pairing of its own functional domain 1 and functional domain 3, and the loop is its own functional domain 2. The 3' end of the functional domain 3 of the downstream stem-loop primer is connected to its own functional domain 4.

[0031] The functional domain 1 of the downstream stem-loop primer corresponds to the 1st to 6th bases of SEQ ID NO:3; the functional domain 2 of the downstream stem-loop primer corresponds to the 7th to 12th bases of SEQ ID NO:3; the functional domain 3 of the downstream stem-loop primer corresponds to the 13th to 18th bases of SEQ ID NO:3; and the functional domain 4 of the downstream stem-loop primer corresponds to the 19th to 32nd bases of SEQ ID NO:3.

[0032] The stem structure of the downstream stem-loop primer remains stable during reverse transcription and PCR annealing and extension stages.

[0033] The sequence of functional domain 2 of the downstream stem-loop primer can specifically recognize the infectious hematopoietic necrosis virus gene sequence and is not complementary to other functional domains of the downstream stem-loop primer; the sequences of functional domain 3 and functional domain 4 of the downstream stem-loop primer can specifically recognize the infectious hematopoietic necrosis virus gene sequence, and the sequence of functional domain 4 is not complementary to other functional domain sequences of the downstream stem-loop primer, and the sequence of functional domain 4 exists in single-stranded form.

[0034] Downstream stem-loop primers form their own hairpin structures by complementing their functional domains 1 and 3. Furthermore, the functional domain 1 and functional domain 3 sequences of one downstream stem-loop primer are complementary to the functional domain 3 and functional domain 1 sequences of another downstream stem-loop primer, respectively. This means that two downstream stem-loop primers can assemble into a more stable homodimer through the complementary use of functional domains 1 and 3. Figure 1 The dual structure ensures its conformational stability.

[0035] When there is no target nucleic acid in the detection system, each stem-loop primer forms a hairpin structure or a homodimer between two upstream stem-loop primers or between two downstream stem-loop primers, exhibiting a regular self-locking state. This significantly reduces the entropy of the system and reduces disordered collisions between molecules, thereby inhibiting non-specific binding between upstream and downstream stem-loop primers and between primers and probes.

[0036] When the target nucleic acid is present in the detection system, the functional domain 4 sequence of the upstream and downstream stem-loop primers preferentially binds to the target, initiating a highly efficient reverse transcription reaction under the action of enzymes to obtain a cDNA template. This further triggers a strand displacement reaction, i.e., the stem portions of functional domains 1 and 3 of the upstream stem-loop primers unwind, and the stem portions of functional domains 1 and 3 of the downstream stem-loop primers unwind. The functional domains 2-4 sequences of each stem-loop primer form a perfect pair with the target nucleic acid cDNA, allowing for PCR amplification. Figure 2 This design utilizes dynamic conformational switching to transition from a self-locking state to an unlocked state, achieving intelligent regulation of "silent standby - precise response." This ensures both the long-term stability of the system and the specific amplification triggered by the target, providing an innovative solution for nucleic acid detection with high sensitivity and low background.

[0037] (3) Detection probe The detection probe is labeled with the fluorescent group FAM (6-Carboxyfluorescein) at its 5' end and with the quencher group BHQ1 (Black Hole Quencher 1) at its 3' end. The nucleotide sequence is shown in SEQ ID No:4. The nucleotide sequence of the detection probe specifically binds to the gene sequence of infectious hematopoietic necrosis virus and does not specifically bind to the upstream stem-loop primer or the downstream stem-loop primer.

[0038] 2. Positive control samples Positive control: Contains pseudovirus particles carrying the conserved target sequence of the infectious hematopoietic necrosis virus gene, with the pLVX vector as the backbone. These pseudovirus particles do not have autonomous replication capability and only possess single-round infectious activity.

[0039] The pseudovirus particles were prepared using an industry-standard third-generation lentivirus triple plasmid packaging system. The standard procedure was as follows: the nucleotide sequence shown in SEQ ID NO:1 was inserted between the BamHI and XhoI restriction sites of the pLVX lentiviral transfer vector to obtain the recombinant pLVX vector; this recombinant pLVX vector, gag / pol helper plasmid, and VSV-G envelope plasmid were used together, with HEK293T cells as packaging cells, and the three plasmids were co-transfected using standard liposome transfection reagents; then, the cells were cultured in standard DMEM complete medium, and the cell supernatant was collected 48–72 h after transfection. Cell debris was removed by low-speed centrifugation, and the cells were filtered through a 0.45 μm filter membrane. The supernatant was then concentrated by ultrafiltration to obtain a high-droplet pseudovirus stock solution; this solution was diluted to 1×10⁻⁶. 6 A positive control sample was obtained at an IU / mL concentration.

[0040] Nucleotide sequence of the conserved target region of the infectious hematopoietic necrosis virus gene (SEQ ID NO:1): 5'-CTCCTGTGCGCGTTCGTCATTGCAGAGACGGTCCCATCGGAGGCAGGTACGGTCGCCGAACTTCTGGAAGCCCTGGGTTTCGTGCTGGAGTCTTTGGACACTGGGGCACCACCAGACGCTAC-3'.

[0041] 3. The negative control was nuclease-free water (purchased from Bailige Biotechnology (Shanghai) Co., Ltd., product number: JDW0201).

[0042] Example 2: Method of using the reagent kit of the present invention The method of using the reagent kit of the present invention includes the following steps: (1) Viral RNA extraction kit (purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number: YDP315) was used to extract RNA from the test samples. The reaction system (20 μL) consisted of 10 μL of RT-qPCR fully premixed detection solution and 10 μL of the test sample RNA. Simultaneously, RNA was extracted from the positive control and used to replace the test sample RNA in the reaction system as a positive control. Nuclease-free water was used to replace the test sample RNA in the reaction system as a negative control.

[0043] (2) Place each reaction system obtained in step (1) into a real-time quantitative PCR instrument (qPCR instrument). The reaction program is as follows: 50℃ for 10 min; 95℃ for 3 min; 95℃ for 15 s, 60℃ for 30 s, 45 cycles. Collect the fluorescence signal of the FAM channel and obtain the Ct value (the number of amplification cycles corresponding to when the fluorescence signal reaches the instrument's set threshold).

[0044] (3) Result interpretation criteria: The test is valid when the Ct value of the positive control is ≤38, the Ct value of the negative control is ≥40 or there is no Ct value (NoCt, that is, no specific fluorescence amplification curve appears throughout the amplification process and there is no effective Ct value). Under the condition that the test is valid, if the Ct value of the sample to be tested is ≤38, the IHNV detection result of the sample to be tested is determined to be positive; if the Ct value of the sample to be tested is ≥40 or there is no Ct value (No Ct, that is, no specific fluorescence amplification curve appears throughout the amplification process and there is no effective Ct value), the IHNV detection result of the sample to be tested is determined to be negative; if 38 < Ct value of the sample to be tested <40, the sample to be tested needs to be retested. If the Ct value after retesting is ≤38 or 38 < Ct value after retesting <40, the IHNV detection result of the sample to be tested is determined to be positive; if the Ct value after retesting is ≥40 or there is no Ct value, the IHNV detection result of the sample to be tested is determined to be negative.

[0045] Example 3: Sensitivity Comparison Experiment of the Reagent Kit of the Present Invention (1) Traditional IHNV RT-qPCR detection kit Specific primers and probes for the IHNV virus N gene were designed for traditional RT-qPCR detection kits, and their sequences are shown in Table 2.

[0046] Table 2 Primer and probe sequences in traditional IHNV RT-qPCR detection kits

[0047] A traditional RT-qPCR detection kit includes a 10 μM upstream primer IHNV-F, a 10 μM downstream primer IHNV-R, a 10 μM detection probe IHNV-P, 5×RT-qPCR buffer, dNTPs (dATP, dTTP, dCTP, and dGTP are all at 25 mM), Taq DNA polymerase, reverse transcriptase, and thermosensitive UNG enzyme.

[0048] Taq DNA polymerase, reverse transcriptase, and thermosensitive UNG enzyme were all purchased from Bailige Biotechnology (Shanghai) Co., Ltd., with catalog numbers SE1001, SE0301, and SE1102, respectively. 5×RT-qPCR buffer was purchased from Bailige Biotechnology (Shanghai) Co., Ltd., and is the buffer in SE1001.

[0049] Prepare 10 μL of the traditional IHNV RT-qPCR reaction system according to Table 3, then add 10 μL of the RNA sample to be tested. Place the system in a real-time quantitative PCR instrument (qPCR instrument) and perform 45 cycles: 50℃ for 10 min; 95℃ for 3 min; 95℃ for 15 s; 60℃ for 30 s. Acquire the fluorescence signal of the FAM channel and obtain the Ct value (the number of amplification cycles corresponding to the fluorescence signal reaching the instrument's set threshold). The result interpretation criteria are as follows: when the Ct value of the sample is ≤38, the IHNV detection result of the sample is considered positive. When the Ct value of the sample is ≥40 or there is no Ct value (No Ct, i.e., no specific fluorescence amplification curve appears throughout the amplification process, and there is no effective Ct value), the IHNV detection result of the sample is considered negative. When 38 < Ct value of the sample to be tested < 40, the sample to be tested needs to be retested. If the Ct value after retesting is ≤ 38 or 38 < Ct value after retesting < 40, the IHNV test result of the sample to be tested is determined to be positive; if the Ct value after retesting is ≥ 40 or there is no Ct value, the IHNV test result of the sample to be tested is determined to be negative.

[0050] Table 3 Traditional IHNV RT-qPCR reaction system

[0051] (2) Comparison of sensitivity The sensitivity of the kit of this invention was compared with that of the traditional IHNV RT-qPCR detection kit.

[0052] RNA was extracted from the infectious hematopoietic organ necrosis virus (IHNV) isolate Ch20101008 (GenBank accession no. KJ421216.1). Samples were quantified to 10000 copies / μL, 1000 copies / μL, 100 copies / μL, and 10 copies / μL using 1×TE buffer (pH 8.0, 10 mmol / L Tris-HCl buffer containing 1 mmol / L of disodium EDTA, Na2EDTA), respectively. Detection was performed using both the kit of this invention and a conventional IHNV RT-qPCR detection kit. Each concentration was tested three times. The results are shown in Table 4. Figure 3 As shown.

[0053] Table 4. Ct values ​​for each sample detected by the kit of this invention and the conventional IHNV RT-qPCR detection kit.

[0054] The experimental results show that the kit of this invention exhibits a standard "S"-shaped amplification curve, and the Ct value of the kit is earlier under the same template concentration conditions. The detection sensitivity of the kit of this invention can reach 10 copies / μL. Under the same target gene detection conditions, the detection curve of the traditional IHNV RT-qPCR detection kit is low and lacks the standard "S"-shaped characteristic, indicating that the traditional IHNV RT-qPCR detection kit has non-specific amplification and primer dimers, which interfere with the normal amplification process, and the sensitivity is 10 copies / μL.

[0055] Example 4: Storage stability verification of the kit of the present invention and the conventional IHNV RT-qPCR detection kit RNA was extracted from the infectious hematopoietic necrosis virus (HIV) isolate Ch20101008 (GenBank accession no. KJ421216.1), and the RNA was quantified to 10000 copies / μL, 1000 copies / μL, 100 copies / μL, and 10 copies / μL samples using 1×TE buffer (pH 8.0, 10 mmol / L Tris-HCl buffer containing 1 mmol / L of disodium EDTA, Na2EDTA).

[0056] The kit of the present invention (used in the same manner as in Example 2) was stored at 37°C in the dark for 3 days. Additionally, the reagents in the conventional IHNV RT-qPCR detection kit were prepared into an RT-qPCR reaction system according to the method in Table 3, and this RT-qPCR reaction system was stored at 37°C in the dark for 3 days. Then, samples of 10000 copies / μL, 1000 copies / μL, 100 copies / μL, and 10 copies / μL were tested using the RT-qPCR reaction systems of the kit of the present invention and the conventional IHNV RT-qPCR detection kit after 3 days of storage, respectively. Each concentration was repeated three times. The experimental results are shown in Table 5. Figure 4 and Figure 5 .

[0057] Table 5. Stability test Ct values ​​of the kit of the present invention and the traditional IHNV RT-qPCR detection kit.

[0058] The experimental results show that the fluorescence amplification curve of the detection kit of the present invention, after being stored at 37°C for 3 days, still maintains a standard "S" shape. There is no significant difference in fluorescence intensity detected after 3 days of storage at 37°C. For example, the average fluorescence intensity of a sample with a concentration of 10,000 copies / μL stored at 37°C for 0 days was 3266, while the average fluorescence intensity after 3 days was 3307. In contrast, the fluorescence intensity of the traditional IHNV RT-qPCR detection kit decreases significantly with decreasing positive control concentration. For example, after 0 days of kit storage, the average fluorescence intensity of a sample with a concentration of 10,000 copies / μL was 2104, but after 3 days of storage, the average fluorescence intensity was below 1000, meaning that the fluorescence intensity decreased by at least half after 3 days of storage at 37°C. These results fully demonstrate that the kit of the present invention has uniform and stable characteristics.

[0059] Example 5: Validation of the detection rate of the kit of the present invention and the conventional IHNV RT-qPCR detection kit RNA was extracted from the infectious hematopoietic necrosis virus Ch20101008 isolate (GenBank accession no. KJ421216.1), and the sample was quantified to 10 copies / μL using 1×TE buffer (pH 8.0, 10 mmol / L Tris-HCl buffer containing 1 mmol / L of disodium EDTA Na2EDTA).

[0060] The kit of the present invention was stored at 37°C in the dark for 3 days. Separately, the reagents in the conventional IHNV RT-qPCR detection kit were prepared into an RT-qPCR reaction system according to the method in Table 3, and this RT-qPCR reaction system was stored at 37°C in the dark for 3 days. Then, 10 copies / μL of samples were tested using both the kit of the present invention and the RT-qPCR reaction system of the conventional IHNV RT-qPCR detection kit after 3 days of storage, and the detection rates of the two kits were calculated.

[0061] Table 6. Detection rate of the mixed reaction solution of the kit of the present invention and the conventional IHNV RT-qPCR detection kit after 3 days of storage.

[0062] Note: In Table 6, Ct values ​​greater than 38 and less than 40 are all Ct values ​​after retesting, and all are positive.

[0063] Results (Table 6) Figure 6 , 7 The results showed that after storage at 37°C for 3 days, the template concentration was 10 copies / μL, and all 24 replicates of the detection kit of this invention were detected, which was significantly higher than the detection rate of the traditional IHNV RT-qPCR detection kit (66.7%).

Claims

1. A fully premixed real-time fluorescent detection kit for infectious hematopoietic organ necrosis virus, characterized in that, The kit comprises a full RT-qPCR premix detection mixture, which includes an upstream stem-loop primer, a downstream stem-loop primer, a detection probe, and enzymes for amplification and detection; the upstream stem-loop primer comprises a stem portion and a loop portion; the stem portion of the upstream stem-loop primer is formed by complementary pairing of its own functional domain 1 and functional domain 3, the loop portion is its own functional domain 2, and the 3' end of functional domain 3 of the upstream stem-loop primer is connected to its own functional domain 4; functional domains 1 to 4 of the upstream stem-loop primer correspond sequentially to bases 1 to 6, 7 to 12, 13 to 18, and 19 to 32 of SEQ ID NO: 2; the downstream stem-loop primer comprises a stem portion and a loop portion; the stem portion of the downstream stem-loop primer is formed by complementary pairing of its own functional domain 1 and functional domain 3, the loop portion is its own functional domain 2, and the 3' end of functional domain 3 of the downstream stem-loop primer is connected to its own functional domain 4; functional domains 1 to 4 of the downstream stem-loop primer correspond sequentially to bases 1 to 6, 7 to 12, 13 to 18, and 19 to 32 of SEQ ID NO: 3; the 5' end of the detection probe is labeled with the fluorophore FAM, the 3' end is labeled with the quencher BHQ1, and the nucleotide sequence is shown in SEQ ID No:

4.

2. The kit according to claim 1, characterized in that... The enzymes for amplification and detection include M-MLV reverse transcriptase, Taq DNA polymerase and thermolabile UNG enzyme.

3. The kit according to claim 1 or 2, characterized in that, The kit further comprises a positive control, which is a pseudoviral particle carrying the target sequence of the conserved region of the infectious hematopoietic necrosis virus gene.

4. The reagent kit according to claim 3, characterized in that, The nucleotide sequence of the target sequence of the conserved region of the infectious hematopoietic necrosis virus gene is shown in SEQ ID No:

1.

5. A method for detecting infectious hematopoietic necrosis virus using the kit described in claim 1 for non-diagnostic purposes, characterized in that, The method comprises the following steps: (1) Extract sample RNA to serve as template RNA; take 10 μL of the full RT-qPCR premix detection mixture and 10 μL of template RNA, and mix them to obtain a reaction system; (2) Place the reaction system obtained in step (1) in a real-time fluorescent quantitative PCR instrument, with the reaction procedure as follows: 50°C for 10 min; 95°C for 3 min; 45 cycles of 95°C for 15 s and 60°C for 30 s; collect the fluorescence signal of the FAM channel to obtain the Ct value; (3) Result interpretation criteria: when the Ct value ≤ 38, the sample test result is determined to be positive; when the Ct value ≥ 40 or no Ct value is obtained, the sample test result is determined to be negative; when 38 < Ct < 40, the sample needs to be retested, if the retested Ct value ≤ 38 or 38 < retested Ct value < 40, the sample test result is determined to be positive; if the retested Ct value ≥ 40 or no Ct value is obtained, the sample test result is determined to be negative.

Images