A dual-channel paper-based microfluidic electrochemical aptamer sensing platform and detection method for simultaneously detecting E2 and P4

Abstract

The application discloses a double-channel paper-based microfluidic electrochemical aptamer sensing platform for simultaneously detecting E2 and P4. The platform comprises a paper-based microfluidic chip, has a common sample inlet and two spatially separated detection zones; two detection zones are respectively provided with a working electrode for fixing E2-specific aptamer and a working electrode for fixing P4-specific aptamer, and the aptamer fixing densities of the two channels are different to adapt to respective concentration scales; the surface of the working electrode is provided with a composite electroactive interface comprising carbon nanomaterial, redox active molecules and gold nanoparticles. After one-time sample adding, the sample is divided into two detection zones under capillary action, the target and the aptamer are combined to cause differential pulse voltammetry peak current to decrease, and double-hormone quantification is realized according to respective independent calibration curves. The application realizes synchronous detection of E2 and P4 on a single paper-based device, has low sample consumption and simple operation, and is suitable for dispersed detection in gynecological endocrine, assisted reproduction and ovulation monitoring and the like scenes.

Description

Technical Field

[0001] This invention relates to the field of in vitro diagnostics and biosensing technology, specifically to a detection platform that sets two spatially separated electrochemical detection channels on a paper-based microfluidic device and uses target-specific nucleic acid aptamers to identify estradiol E2 and progesterone P4 respectively. Background Technology

[0002] Estradiol (E2) and progesterone (P4) are key steroid hormones in the regulation of female reproductive endocrine function, and their biosynthesis and metabolism are important components of the human steroid production network. They play a synergistic role in follicular development, ovulation, cyclical changes in the endometrium, and pregnancy maintenance. E2 is mainly secreted by developing follicles, with its level gradually increasing during the follicular phase and reaching a high level around ovulation, participating in the regulation of follicular maturation and ovulation, as well as endometrial proliferation. P4 is mainly secreted by the corpus luteum after ovulation, and can also be produced by the placenta during pregnancy. Its level increases during the luteal phase, promoting the transformation of the endometrium from the proliferative to the secretory phase, and participating in endocrine support in early pregnancy. E2 and P4 exhibit temporal dynamic changes under different physiological or clinical conditions, such as the menstrual cycle, assisted reproductive technology, and pregnancy. The combined levels of both at the same time point and their continuous trends can help reflect follicular development and ovarian response, ovulation status, corpus luteum function, and pregnancy-related endocrine status. Compared to detecting only a single hormone, obtaining simultaneous E2 and P4 test results is more conducive to forming more complete reproductive endocrine information. Therefore, in applications such as assisted reproduction, ovulation monitoring, luteal function assessment, and pregnancy-related hormone monitoring, there is a practical need for simultaneous, rapid, and low-sample-volume testing of E2 and P4.

[0003] Current clinical testing primarily relies on techniques such as chemiluminescence immunoassay, electrochemiluminescence immunoassay, and liquid chromatography-tandem mass spectrometry. These methods provide reliable results, but typically depend on centralized laboratories, automated analytical instruments, specialized operators, and relatively complex sample handling. E2 and P4 are often tested as two separate items, increasing operational and equipment burdens and hindering proximity to patients, low cost, and repeatability. Mass spectrometry offers high specificity, but the instruments are expensive, and the method establishment and maintenance requirements are demanding. Immunoassay is relatively easy to automate, but it may still be limited by cross-reactivity, batch-to-batch reagent variability, and detection platform limitations. Paper-based microfluidic chips use paper or fiber materials as a substrate, utilizing hydrophilic / hydrophobic patterns, paper fiber pores, and capillary action to achieve the directional transport, distribution, and reaction of small volumes of liquid. Domestic and international reviews indicate that paper, with its wide availability, low cost, biodegradability, good biocompatibility, and ability to form capillary transport without external drive, makes it a valuable resource for paper-based microfluidic chips. These chips can be combined with colorimetric, fluorescence, chemiluminescence, and electrochemical analysis methods, demonstrating application potential in medical services, environmental monitoring, and rapid detection in resource-constrained environments. Compared to traditional silicon, glass, or polymer microfluidic chips, paper-based platforms are more suitable for single-use, low-cost, and small-sample-volume detection. However, current research still needs to address issues such as consistency in batch fabrication, applicability to complex matrices, integration of multiple indicators, and on-site quantitative readout.

[0004] In the field of paper-based electrochemical aptamer sensing, researchers have reported single-hormone detection schemes based on carbon nanomaterial / redox molecule / gold nanoparticle composite interfaces. However, these schemes have the following inherent limitations:

[0005] First, the detection throughput is limited to a single target. Reported paper-based electrochemical aptamer sensors primarily detect single hormones (such as E2), failing to provide combined endocrine information for both E2 and P4 within the same device. In assisted reproduction and ovulation monitoring, the E2 / P4 ratio and its synergistic trends are clinically more significant than single hormone levels. While studies have reported E2 aptamer-modified gold electrode sensors and P4 label-free impedance aptamer sensors, integrating these two recognition systems into a single paper-based device requires addressing multiple challenges, including liquid path distribution, electrode independence, and signal crosstalk.

[0006] Second, the design lacks compatibility with dual-target concentration scales. The clinical interpretation scale for E2 is typically in the pg / mL range, while P4 is often in the ng / mL range post-ovulation, a difference of approximately three orders of magnitude. Simply splicing two single-target sensors onto the same chip does not naturally yield a compatible quantitative window. The aptamer probe density for each target needs to be independently optimized for its respective concentration range and binding affinity, and this "asymmetric" differentiated design strategy has not been reported in existing paper-based aptamer sensor research.

[0007] Third, the applicability in complex serum matrices has not been fully validated. Most paper-based electrochemical aptamer sensors have been validated in buffer systems, but serum proteins and other matrix components can cause nonspecific adsorption and mass transfer changes, making it difficult to directly transfer buffer calibration results to clinical samples. Wearable aptamer nanobiosensors have demonstrated potential for non-invasive monitoring of female hormones, but their device morphology and sample systems differ from the paper-based serum detection method of this invention. Some biofluidic validation schemes require pretreatment such as hundredfold or thousandfold dilution, filtration, and centrifugation, increasing operational complexity and hindering applications in distributed detection scenarios.

[0008] Fourth, the selection of aptamer immobilization concentration lacks systematic optimization. Existing studies, when immobilizing aptamers on electrode surfaces, typically directly adopt concentrations reported in the literature or simply apply optimization results from single-target sensors, without considering the objective need for independent optimization of aptamer concentrations for each target in multi-target integrated scenarios. Too low an aptamer concentration leads to insufficient target binding sites and decreased sensitivity; too high a concentration may cause surface probe crowding, hindered target entry, and conformational limitations, resulting in a decreased response. This contradiction is even more pronounced when detecting multiple targets simultaneously.

[0009] Domestic research also indicates that paper-based microfluidics has good potential for combination with flexible electrodes, screen-printed electrodes, and portable readout circuits. For example, in the study of a wearable sweat pH sensor based on paper-based microfluidics, a sandwich-type paper-based microfluidic chip utilizes the capillary effect of filter paper for sweat sampling, diversion, detection, and expulsion, and filters sebum through an oil-absorbing paper layer. A sample response volume of approximately 25 µL and a sebum filtration efficiency of over 90% were reported, demonstrating the value of paper-based flow paths in micro-volume biological fluid processing and continuous detection. Another example is the study of a paper-based microfluidic electrochemical sensor for heavy metals based on screen-printed MXene. Researchers formed a hydrophilic detection area through wax printing, and used screen printing to prepare the MXene working electrode, carbon-pair electrode, and Ag / AgCl reference electrode. This was combined with a folded paper-based microfluidic structure for the simultaneous rapid detection of Cd(II) and Pb(II), demonstrating that the paper-based microfluidic and screen-printed three-electrode system can be used for on-site electrochemical analysis. The above research provides relevant technical background for the present invention to adopt wax-printed paper-based flow path, screen-printed three electrodes and small-volume sample transport; however, its detection objects, recognition elements and signal interfaces are different from those of E2 / P4 dual hormone aptamer detection, and it cannot yet solve the problems of independent recognition, independent calibration and complex serum matrix quantification of dual steroid hormones in the same paper-based device.

[0010] Dual hormone detection also faces three common challenges. First, E2 and P4 have small molecular weights and share similar scaffolds with endogenous steroids such as estrone, estriol, pregnenolone, cortisol, aldosterone, and cholesterol, requiring recognition elements with sufficient molecular discrimination capabilities. Second, their clinical concentration scales differ: E2 is typically measured in pg / mL. -1 Scale interpretation, while P4 is often in the range of ng / mL after ovulation. -1 First, simply combining two single-indicator detections does not naturally yield a compatible quantitative window. Second, serum proteins and other matrix components can cause non-specific adsorption and mass transfer changes, making it difficult to directly transfer buffer calibration results to clinical samples.

[0011] Nucleic acid aptamers can recognize small molecule targets through reproducibly synthesizable oligonucleotide sequences, exhibiting good chemical stability, ease of modification with groups such as thiol groups, and easy coupling with electrochemical interfaces. Combining aptamer recognition with paper-based microfluidics has been considered an important direction for developing low-cost, portable analytical devices. For steroid hormone detection, studies have reported E2 aptamer-modified gold electrode sensors and P4 label-free impedance aptamer sensors, providing sequence and interface foundations for aptamer recognition of these two targets. Furthermore, photoelectrochemical enzyme-assisted amplification and self-powered sandwich aptamer schemes have been observed in E2 or estrogen detection, while electrochemiluminescence signal enhancement and exonuclease cycling amplification schemes have been used in P4 detection. These schemes can achieve low detection limits, but often require a second probe, enzyme cycling, displacement reactions, photoelectrodes, or complex micro / nanofabrication; some biofluidic validations also require pretreatment such as hundredfold or thousandfold dilution, filtration, and centrifugation. Wearable aptamer nanobiosensors have demonstrated the potential for non-invasive monitoring of female hormones, but their device morphology and sample system differ from the paper-based serum detection used in this study. Existing spatially resolved three-channel photofuel cells can simultaneously detect cortisol and P4, but their target combination and photoelectric conversion structure differ from those in this study. Flexible microcone immunosensors have been developed to detect E2 and P4 in the same study, but they employ antibody recognition and complex three-dimensional electrodes, and saliva samples require centrifugation and high-level dilution. Overall, the technology for directly applying undiluted serum to two independent aptamer channels covering different concentration windows of E2 and P4 on a single, low-cost paper-based device remains insufficient. Summary of the Invention

[0012] The purpose of this invention is to provide a dual-channel paper-based microfluidic electrochemical aptamer sensing platform and detection method capable of simultaneously detecting estradiol E2 and progesterone P4.

[0013] This invention does not simply pursue the lowest detection limit, but rather achieves a balance suitable for decentralized detection among detection performance, device cost, manufacturing repeatability, sample volume, and operational complexity. To this end, this invention forms two physically separate detection zones within a laminated paper-based device, but both can be supplied with samples through the same inlet. Each detection zone is equipped with an independent working electrode, counter electrode, and reference electrode, and E2 and P4 aptamer recognition interfaces are constructed separately. Users can obtain two independent electrochemical responses by adding a small amount of sample at a time, followed by capillary transport and target incubation.

[0014] This invention utilizes the capillary action of paper to achieve pump-free sample transport. It employs a composite electroactive interface composed of functionalized carbon nanomaterials, redox-active molecules, and gold nanoparticles, and a molecular recognition layer formed by thiolized aptamers. Differential pulse voltammetry (DPV) is used to read the current reduction caused by target binding, thereby obtaining independent quantitative results for two hormones within the same device and detection process. This invention also relates to the preparation method of the platform, the dual-hormone detection method, the supporting reagent kit, and the detection system composed of a portable dual-channel electrochemical readout device.

[0015] The "simultaneous detection" referred to in this invention means that after a single sample is added, E2 and P4 identifications are completed separately in two detection areas of the same paper-based device, resulting in two distinguishable quantitative results in one detection process. The electrical signals can be acquired in parallel by a dual-channel device, or sequentially by a single electrochemical workstation connected to two channels. This invention does not consider "strictly simultaneous sampling" as a necessary condition for achieving the technical solution.

[0016] According to a first aspect of the present invention, a dual-channel paper-based microfluidic electrochemical aptamer sensing platform is provided for the simultaneous detection of estradiol and progesterone in a sample, comprising:

[0017] A sample import layer with a sample loading area for importing samples;

[0018] The auxiliary electrode functional layer that contacts the sample introduction layer;

[0019] The working electrode functional layer that contacts the auxiliary electrode functional layer;

[0020] The auxiliary electrode functional layer is provided with a first electrochemical detection area for detecting estradiol, a second electrochemical detection area for detecting progesterone, and a sample diversion and guiding area connecting the first electrochemical detection area and the second electrochemical detection area. The sample diversion and guiding area is in contact with the sample loading area of ​​the sample introduction layer.

[0021] The working electrode functional layer is provided with a first working electrode located in the first electrochemical detection area and a second working electrode located in the second electrochemical detection area;

[0022] An estradiol-specific thiolated aptamer is immobilized on the surface of the first working electrode;

[0023] The surface of the second working electrode is immobilized with a progesterone-specific thiolated aptamer.

[0024] Preferably, the surface of the first working electrode is sequentially stacked with a first composite electroactive interface and an estradiol-specific thiolated aptamer; the surface of the second working electrode is sequentially stacked with a second composite electroactive interface and a progesterone-specific thiolated aptamer.

[0025] Preferably, the first composite electroactive interface comprises a first carbon nanomaterial, a first redox active molecule, and a first gold nanoparticle. The first redox active molecule is loaded onto the surface of the first carbon nanomaterial via π-π interactions, and the first gold nanoparticle provides Au-S anchoring sites for the estradiol-specific thiolated aptamer. The second composite electroactive interface comprises a second carbon nanomaterial, a second redox active molecule, and a second gold nanoparticle. The second redox active molecule is loaded onto the surface of the second carbon nanomaterial via π-π interactions, and the second gold nanoparticle provides Au-S anchoring sites for the progesterone-specific thiolated aptamer.

[0026] Preferably, the estradiol-specific thiolated aptamer is modified at the 5′ end by 5′-SH-(CH2)6 and immobilized on the first gold nanoparticle by Au–S interaction; the progesterone-specific thiolated aptamer is modified at the 5′ end by 5′-SH-(CH2)6 and immobilized on the second gold nanoparticle by Au–S interaction.

[0027] Preferably, the auxiliary electrode functional layer further comprises a first reference electrode and a first pair of electrodes symmetrically arranged on the first electrochemical detection region; and a second reference electrode and a second pair of electrodes symmetrically arranged on the second electrochemical detection region.

[0028] Preferably, the first carbon nanomaterial and the second carbon nanomaterial are diethylenetriamine-functionalized graphene oxide (DETA-GO), and the first redox active molecule and the second redox active molecule are neomethylene blue (NMB).

[0029] Preferably, the fixed concentration of the estradiol-specific thiolated aptamer on the first working electrode is between 0.9 and 1.1 μM, and the fixed concentration of the progesterone-specific thiolated aptamer on the second working electrode is between 1.4 and 1.6 μM.

[0030] Preferably, the sample introduction layer, the auxiliary electrode functional layer, and the working electrode functional layer are all cellulose paper layers; the sample introduction layer, the auxiliary electrode functional layer, and the working electrode functional layer are laminated to form the paper-based microfluidic chip.

[0031] Preferably, the concentration of the DETA-GO dispersion is 1.0 mg / mL. -1 The concentration of NMB was 2.0 mg / mL. -1 The volume ratio of DETA-GO / NMB to the gold nanoparticles is 1:4.

[0032] Preferably, the estradiol-specific thiolated aptamer has the nucleotide sequence shown in SEQ ID NO.1, and the progesterone-specific thiolated aptamer has the nucleotide sequence shown in SEQ ID NO.2.

[0033] Preferably, the estradiol-specific thiolated aptamer and the progesterone-specific thiolated aptamer are blocked with 6-mercapto-1-hexanol (MCH) to reduce the non-specific adsorption of serum proteins and non-target molecules on the gold surface.

[0034] Preferably, the present invention forms a hydrophobic barrier region and a hydrophilic region after wax printing on the sample introduction layer, wherein the hydrophilic region includes a connected sample introduction channel and a sample loading region.

[0035] Preferably, the present invention forms a hydrophobic region and a hydrophilic region after wax printing on the auxiliary electrode functional layer. The hydrophilic region includes a first electrochemical detection region, a second electrochemical detection region, and a sample diversion and conduction region that are connected. Electrodes are printed on the auxiliary electrode functional layer to form a first reference electrode and a first pair of electrodes extending into the first electrochemical detection region, and a second reference electrode and a second pair of electrodes extending into the second electrochemical detection region.

[0036] According to a second aspect of the present invention, a method for simultaneously detecting estradiol and progesterone using the platform described in claim 1, characterized in that it comprises:

[0037] The sample to be tested is added to the sample loading area of ​​the sample introduction layer, so that the sample is diverted to the first electrochemical detection area and the second electrochemical detection area under capillary action, so that the sample can be incubated with the estradiol-specific aptamer on the first working electrode and the progesterone-specific aptamer on the second working electrode.

[0038] After incubation, the electrode surface was rinsed, and then the current decrease caused by target binding was read by differential pulse voltammetry (DPV) to determine the concentrations of estradiol and progesterone in the sample.

[0039] According to a third aspect of the present invention, a kit for simultaneous detection of estradiol and progesterone comprises:

[0040] Dual-channel paper-based microfluidic electrochemical aptamer sensing platform;

[0041] Estradiol series calibrators and progesterone series calibrators;

[0042] Detergent; and

[0043] The instruction manual contains the DPV testing parameters and the usage methods of the calibration curve.

[0044] This invention solves at least the following technical problems:

[0045] Firstly, how to reliably deliver the same sample to two detection zones without using an external pump, and reduce crosstalk between channels in the liquid path and electrical signals;

[0046] Secondly, how to form a composite interface on a screen-printed carbon working electrode that can both provide a stable electroactive signal and fix the thiol aptamer;

[0047] Third, how to configure aptamer probe density and calibration window for different physiological concentration scales of E2 and P4 respectively, so that the same device can be compatible with hormone detection at two significantly different concentration scales;

[0048] Fourth, how to convert the event of small molecules binding to aptamers, which is difficult to measure directly, into a change in current that does not require additional labeling;

[0049] Fifth, how to reduce the nonspecific response caused by steroid analogs and serum matrix, so that the platform can achieve reliable quantification in undiluted serum;

[0050] Sixth, how to maintain acceptable consistency in response within batches, between batches, and after storage, providing a process basis for productization.

[0051] This invention provides a dual-hormone platform with a simple structure, low sample consumption, no need for an external pump, independent calibration of the two channels, and the ability to operate in complex matrices. It also addresses the following technical problems of the closest prior art: single-target devices cannot provide coordinated E2 / P4 information; multi-step amplification systems are complex to manufacture and operate; if the two channels share electrodes or reaction zones, identification and electrical signal crosstalk are likely to occur; generally, paper-based devices lack an interface that simultaneously provides stable built-in redox signals, thiol probe anchoring points, and matrix resistance; and the high sensitivity obtained in buffer solutions may not necessarily translate into reliable quantification in undiluted clinical serum. Attached Figure Description

[0052] Figure 1 This is a wax printing layout for mass production of paper-based microfluidic chips. This layout is used to form sample inlets, fluid guiding areas, detection areas, and hydrophobic isolation boundaries on the paper-based material, forming the structural basis for subsequent lamination and assembly of the paper chip.

[0053] Figure 2 This is a screen-printed electrode pattern for a dual-channel, three-electrode system. This pattern is used to form the patterns of the counter electrode, reference electrode, and working electrode, and after alignment with the paper chip flow path layer, it constitutes two spatially separated electrochemical detection channels.

[0054] Figure 3 This is a schematic diagram of the functional areas and electrode partitions of a paper-based microfluidic chip. The diagram shows the front and back structures of the sample introduction layer, auxiliary electrode functional layer, and working electrode functional layer, as well as the relative positions of the sample loading area, shunt and conduction area, two electrochemical detection areas, reference electrode, counter electrode, and working electrode.

[0055] Figure 4 This is a schematic diagram of the synthesis of nanocomposite materials and electrode drop-coating modification. Redox-active molecules are first loaded and composited on the surface of functionalized carbon nanomaterials, then gold nanoparticles are introduced to form composite nanomaterials, and finally drop-coated onto the surface of the working electrode to form a sensitive interface that combines electroactivity and probe immobilization.

[0056] Figure 5 This is a schematic diagram of the E2 / P4 dual-channel working electrode aptamer immobilization and MCH blocking process. After the working electrode is modified with nanocomposite materials, the E2 and P4 aptamers are immobilized at their respective detection interfaces, and then the residual active sites are blocked by MCH, forming two independent electrochemical recognition interfaces.

[0057] Figure 6 This is a schematic diagram of the dual-channel aptamer recognition and signal reduction electrochemical detection mechanism. After the serum sample to be tested enters the paper-based chip, it reaches the E2 and P4 detection regions respectively. The target specifically binds to the corresponding aptamer, causing the interfacial electron transfer to be blocked and the DPV peak current to decrease, thereby achieving independent readout of the two hormone indicators.

[0058] Explanation of reference numerals in the attached figures: 100 - Sample introduction layer; 110 - Hydrophobic barrier region of sample introduction layer; 111 - Sample introduction channel; 112 - Sample loading region; 200 - Auxiliary electrode functional layer; 210 - Hydrophobic barrier region of electrode layer; 221 - First electrochemical detection region; 222 - First branch channel; 223 - Sample diversion and guiding region; 224 - Second branch channel; 225 - Second electrochemical detection region; 231 - First reference electrode; 232 - First pair of electrodes; 233 - Second pair of electrodes; 234 - Second reference electrode; 300 - Working electrode functional layer; 310 - Water-breaking barrier region of working electrode layer; 311 - First working electrode; 312 - Second working electrode; 321 - Observation and cleaning liquid guiding window of first working electrode; 322 - Observation and cleaning liquid guiding window of second working electrode. Detailed Implementation

[0059] This invention utilizes a hydrophobic boundary defined by wax printing to define the capillary flow path, employs two spatially separated three-electrode systems to achieve channel independence, utilizes functionalized carbon nanomaterials to load redox-active molecules to form a high-surface-area electroactive framework, utilizes gold nanoparticles to improve electron transport and fix thiol aptamers via Au-S bonds, utilizes 6-mercapto-1-hexanol (MCH) to block residual active sites, and utilizes the mechanism of increased interfacial steric hindrance and inhibited electron transport after target binding to generate a signal-reducing differential pulse voltammetric signal. The two detection channels use different aptamers at fixed concentrations to accommodate different concentration scales of the two hormones.

[0060] Figure 3 This invention demonstrates a dual-channel paper-based microfluidic electrochemical aptamer sensing platform, wherein... Figure 3 a and Figure 3 b shows the front and back sides of the sample introduction layer, respectively; Figure 3 c and Figure 3 d shows the front and back sides of the auxiliary electrode functional layer, respectively; Figure 3 e and Figure 3 f shows the front and back sides of the working electrode functional layer, respectively;

[0061] See Figure 3 The present invention discloses a dual-channel paper-based microfluidic electrochemical aptamer sensing platform for simultaneously detecting E2 and P4 in a sample, comprising: a sample introduction layer 100 for introducing the sample and having a sample loading region 112; an auxiliary electrode functional layer 200 contacting the sample introduction layer; and a working electrode functional layer 300 contacting the auxiliary electrode functional layer; the auxiliary electrode functional layer 200 is provided with a first electrochemical detection region 221 for detecting estradiol, a second electrochemical detection region 225 for detecting progesterone, and a region connected to the first electrochemical detection region 221. The sample diversion and guiding area 223 of the second electrochemical detection area 225 is in contact with the sample loading area 112 of the sample introduction layer 100; the working electrode functional layer 300 is provided with a first working electrode 311 located in the first electrochemical detection area 221 and a second working electrode 312 located in the second electrochemical detection area 225; an estradiol-specific thiolated aptamer is fixed on the surface of the first working electrode 311; and a progesterone-specific thiolated aptamer is fixed on the surface of the second working electrode 312.

[0062] The sample introduction layer 100, auxiliary electrode functional layer 200 and working electrode functional layer 300 of the present invention are all made of cellulose paper; the sample introduction layer 100, auxiliary electrode functional layer 200 and working electrode functional layer 300 are laminated to form the paper-based microfluidic chip.

[0063] This invention forms a hydrophobic barrier region 110 and a hydrophilic region by wax printing on a cellulose paper layer of the sample introduction layer 100. The hydrophilic region includes a connected sample introduction channel 111 and a sample loading region 112. See [link to relevant documentation]. Figure 3 a and Figure 3 b. The hydrophobic barrier zone and the hydrophilic zone are separated by a hydrophobic boundary.

[0064] This invention forms a hydrophobic barrier region 210 and a hydrophilic region by wax printing on a cellulose paper layer of the auxiliary electrode functional layer 200. The hydrophilic region includes a first electrochemical detection region 221, a second electrochemical detection region 225, and a sample diversion and conduction region 223 that are interconnected. See [link to relevant documentation]. Figure 3 c and Figure 3 d.

[0065] This invention involves printing electrodes on the auxiliary electrode functional layer 200 to form a first reference electrode 231 and a first pair of electrodes 232 extending into the first electrochemical detection region 221, and a second reference electrode 234 and a second pair of electrodes 233 extending into the second electrochemical detection region 225. (See also...) Figure 3 c and Figure 3 d.

[0066] Furthermore, in this invention, a hydrophobic barrier region 310 is formed by wax printing on a cellulose paper layer of the working electrode functional layer. The first working electrode 311 and the second working electrode 312 are printed on the hydrophobic barrier region. (See also...) Figure 3 e and Figure 3 f.

[0067] like Figure 3 As shown, the auxiliary electrode functional layer 200 is further provided with a first reference electrode 231 and a first pair of electrodes 232 symmetrically arranged on the first electrochemical detection region 221; and a second reference electrode 233 and a second pair of electrodes 234 symmetrically arranged on the second electrochemical detection region 225.

[0068] exist Figure 3 In this process, the sample is loaded into the sample loading area 112 via the sample inlet channel 111, and then diverted to the first electrochemical detection area 221 and the second electrochemical detection area 225 via the sample diversion and guiding area 223 that is in contact with the sample loading area 112. This allows the sample to be incubated with the estradiol-specific aptamer located on the first working electrode 311 in the first electrochemical detection area 221 and the progesterone-specific aptamer located on the second working electrode 312 in the second electrochemical detection area 225, so as to obtain two independent electrochemical responses.

[0069] See Figure 4 The surface of the first working electrode 311 is sequentially stacked with a first composite electroactive interface and an estradiol-specific thiolated aptamer; the surface of the second working electrode 312 is sequentially stacked with a second composite electroactive interface and a progesterone-specific thiolated aptamer.

[0070] The first composite electroactive interface comprises a first carbon nanomaterial, a first redox-active molecule, and a first gold nanoparticle. The second composite electroactive interface comprises a second carbon nanomaterial, a second redox-active molecule, and a second gold nanoparticle. The first and second carbon nanomaterials are diethylenetriamine-functionalized graphene oxide (DETA-GO), and the first and second redox-active molecules are neomethylene blue (NMB).

[0071] The first redox-active molecule NMB is loaded onto the surface of the first carbon nanomaterial DETA-GO through π-π interactions, and the first gold nanoparticles provide Au-S anchoring sites for the estradiol-specific thiolated aptamer; the second redox-active molecule NMB is loaded onto the surface of the second carbon nanomaterial DETA-GO through π-π interactions, and the second gold nanoparticles provide Au-S anchoring sites for the progesterone-specific thiolated aptamer.

[0072] Estradiol-specific thiolated aptamers were modified at the 5′ end by 5′-SH-(CH2)6 and immobilized on the first gold nanoparticles via Au–S interaction; progesterone-specific thiolated aptamers were modified at the 5′ end by 5′-SH-(CH2)6 and immobilized on the second gold nanoparticles via Au–S interaction.

[0073] The fixed concentration of the estradiol-specific thiolated aptamer on the first working electrode 311 is between 0.9 and 1.1 μM, and the fixed concentration of the progesterone-specific thiolated aptamer on the second working electrode 312 is between 1.4 and 1.6 μM.

[0074] The concentration of the DETA-GO dispersion was 1.0 mg / mL. -1 The concentration of NMB was 2.0 mg / mL. -1 The volume ratio of DETA-GO / NMB to the gold nanoparticles is 1:4.

[0075] The estradiol-specific thiolated aptamer has the nucleotide sequence shown in SEQ ID NO.1, and the progesterone-specific thiolated aptamer has the nucleotide sequence shown in SEQ ID NO.2.

[0076] SEQ ID NO.1 (E2 aptamer, 76 nt):

[0077] GCTTCCAGCT TATTGAATTA CACGCAGAGG GTAGCGGCTC TGCGCATTCA ATTGCTGCGCGCTGAAGCGC GGAAGC

[0078] SEQ ID NO.2 (P4 aptamer, 60 nt):

[0079] GCATCACACA CCGATACTCA CCCGCCTGAT TAACATTAGC CCACCGCCCA CCCCGCTGC

[0080] In this invention, the estradiol-specific thiolated aptamer and the progesterone-specific thiolated aptamer are blocked by MCH respectively to reduce the non-specific adsorption of serum proteins and non-target molecules on the gold surface.

[0081] On the other hand, the present invention provides a method for simultaneously detecting estradiol and progesterone using the platform described in claim 1, comprising:

[0082] The sample to be tested is added to the sample loading area 112 of the sample introduction layer 100, so that the sample is diverted to the first electrochemical detection area 221 and the second electrochemical detection area 225 under capillary action, so that the sample can be incubated with the estradiol-specific aptamer on the first working electrode 311 and the progesterone-specific aptamer on the second working electrode 312.

[0083] After incubation, the electrode surface was rinsed, and then the current decrease caused by target binding was read by differential pulse voltammetry (DPV) to determine the concentrations of estradiol and progesterone in the sample.

[0084] Furthermore, this invention provides a kit for the simultaneous detection of estradiol and progesterone, comprising:

[0085] Dual-channel paper-based microfluidic electrochemical aptamer sensing platform;

[0086] Estradiol series calibrators and progesterone series calibrators;

[0087] Detergent; and

[0088] The instruction manual contains the DPV testing parameters and the usage methods of the calibration curve.

[0089] The following detailed description will make the above technical solution and its achievable technical effects clearer.

[0090] The dual-channel paper-based microfluidic electrochemical aptamer sensing platform includes at least a paper-based microfluidic chip, an E2 detection channel formed on the paper-based microfluidic chip, and a P4 detection channel.

[0091] See Figure 3The paper-based chip is preferably composed of three layers of cellulose paper laminate. The first layer is a sample introduction layer 100, which includes a sample introduction channel 111, a sample loading area 112, and a hydrophobic barrier area 110. The second layer is an auxiliary electrode functional layer 200 that carries paired auxiliary electrodes, which includes an electrode layer hydrophobic barrier layer 210, a sample diversion and guiding area 223, and a first electrochemical detection area 221 and a second electrochemical detection area 225 located on both sides of the sample diversion and guiding area 223. Each electrochemical detection area includes a screen-printed Ag / AgCl reference electrode and a carbon counter electrode. The third layer is a working electrode functional layer 300 that carries two screen-printed carbon working electrodes, which includes a first working electrode 311, a second working electrode 312, and a working electrode layer hydrophobic barrier area 310. The three layers are aligned in predetermined positions and bonded together by adhesive. After wetting, the paper fibers transport the sample by capillary action and establish ion communication between the working electrode, counter electrode, and reference electrode.

[0092] This invention detects the concentrations of estradiol and progesterone by electrochemically detecting DPV (not shown in the figure). Since DPV is prior art, its detailed description is omitted.

[0093] The sample introduction layer 100, auxiliary electrode functional layer 200 and working electrode functional layer 300 mentioned above were obtained by batch wax printing. Figure 1 The image shows the batch wax printing layout of paper-based microfluidic chips, in which... Figure 1 Multiple sample import layers 100 were displayed. Figure 1 The middle figure shows multiple auxiliary electrode functional layers 200. Figure 1 The right figure shows multiple working electrode functional layers 300.

[0094] Figure 2 shows the screen-printed electrode layout of the dual-channel three-electrode system, in which... Figure 2 The left figure shows multiple counter electrodes 232 and 233 printed on the auxiliary electrode functional layer 200. Figure 2 The middle figure shows multiple reference electrodes 231 and 234 printed on the auxiliary electrode functional layer 200. Figure 2 The left figure shows multiple working electrodes 311 and 322 printed on the working electrode functional layer 300.

[0095] The two detection zones are spatially separated, each with a complete three-electrode configuration. The E2 working electrode immobilizes the E2-specific thiol aptamer, and the P4 working electrode immobilizes the P4-specific thiol aptamer. Through this structure of "shared sample introduction, zoned identification, independent electrodes, and independent calibration," the same sample can be allocated to both reaction zones, and the aptamer and target complex from either channel will not serve as the direct electrode reactant for the other channel. In the validation experiment, 25 µL of sample was added each time.

[0096] Figure 4 The process of modifying the working electrode with nanocomposite materials is shown. NMB is first composited onto the DETA-GO surface, followed by the introduction of AuNPs to form a composite nanomaterial, which is then drop-coated onto the working electrode surface to form a sensitive interface that combines electroactivity and probe immobilization, thus obtaining a working electrode modified with nanocomposite materials.

[0097] Each working electrode surface is coated with a composite layer comprising functionalized carbon nanomaterials, redox-active molecules, and gold nanoparticles. The functionalized carbon nanomaterials provide a wrinkled, high-specific-surface-area framework and load redox-active molecules via π-π interactions. These redox-active molecules, embedded within the composite layer, generate measurable peak currents within a specified negative potential window. Gold nanoparticles (AuNPs) are dispersed on the carbon nanomaterial matrix, improving interfacial electron transport and providing Au-S anchoring sites for thiol aptamers. After modification with the composite material, the charge transfer resistance is reduced compared to the bare electrode. Immobilization of the aptamer and sealing with MCH results in a surface biorecognition layer that lowers the peak current. Further target binding increases steric hindrance and interfacial barrier, leading to a current signal that decreases with increasing target concentration.

[0098] As a preferred embodiment, the functionalized carbon nanomaterial is diethylenetriamine-functionalized graphene oxide (DETA-GO), and the redox active molecule is neomethylene blue (NMB). The concentration of the DETA-GO dispersion is 1.0 mg / mL. -1 The NMB concentration was 2.0 mg / mL. -1 The volume ratio of DETA-GO / NMB to gold nanoparticles is 1:4. These preferred values ​​are for illustrative purposes and should not be construed as absolute limitations on functionally equivalent ratios.

[0099] Both the E2 and P4 aptamers pass through the 5' end. ′ -SH-(CH2)6 modification was performed and immobilized via Au–S interaction. To obtain sufficient target recognition and avoid excessive crowding of the surface probe, concentration gradients of 0.5, 1.0, 1.5, 2.0, 3.0, and 5.0 µM were set for the two thiolized aptamers in the optimization experiment, and the DPV peak currents after incubation with no target and high-concentration standard solutions were compared. The E2 channel used 1 ng / mL... -1 E2 was used as a higher concentration for testing; the P4 channel used 50 ng / mL. -1 P4 was used as the test value for a higher concentration. The optimized index was the target-induced peak current difference.

[0100]

[0101] in I0 represents the peak current of DPV after blank treatment with phosphate-buffered saline (PBS), and Itarget represents the peak current of the same independent sensing interface after incubation with the corresponding hormone standard solution.

[0102] Key characteristics: The response ΔI was largest at 1.0 μM for the E2 aptamer and at 1.5 μM for the P4 aptamer; further increases in concentration resulted in a decrease in response, presumably related to surface probe crowding, aptamer conformational constraints, and hindered target entry. Therefore, 1.0 μM E2 aptamer was preferred for the E2 channel, and 1.5 μM P4 aptamer was preferred for the P4 channel—different probe densities were used for the two channels to accommodate different physiological concentration scales of E2 (pg / mL) and P4 (ng / mL), respectively. After probe immobilization, the probes were blocked with 1.0 mM MCH to reduce non-specific adsorption of serum proteins and non-target molecules on the gold surface.

[0103] The specific nucleotide sequences of the two aptamers are as follows; all sequences are written in the 5′ to 3′ direction, and the grouping spaces are for typesetting purposes only and do not represent additional bases or base spacing:

[0104] SEQ ID NO.1 (E2 aptamer, 76 nt):

[0105] GCTTCCAGCT TATTGAATTA CACGCAGAGG GTAGCGGCTC TGCGCATTCA ATTGCTGCGCGCTGAAGCGC GGAAGC

[0106] SEQ ID NO.2 (P4 aptamer, 60 nt):

[0107] GCATCACACA CCGATACTCA CCCGCCTGAT TAACATTAGC CCACCGCCCA CCCCGCTGC

[0108] In the actual construction of the sensing interface, both oligonucleotides were modified with 5′-SH-(CH2)6; the aforementioned thiol linker arms are terminal chemical modifications and are not included in the nucleotide lengths of SEQ ID NO.1 and SEQ ID NO.2. The E2 aptamer sequence is from Kim et al., and the P4 aptamer sequence is from Contreras Jiménez et al.; these sequences can serve as the basis for subsequent sequence listing and defining aptamer functional variants.

[0109] Figure 5 illustrates the E2 / P4 dual-channel working electrode aptamer immobilization and MCH blocking process. After the working electrode is modified with nanocomposite materials, the E2 and P4 aptamers are immobilized at their respective detection interfaces, and then the residual active sites are blocked by MCH, forming two independent electrochemical recognition interfaces.

[0110] Figure 6 The dual-channel aptamer recognition and signal reduction electrochemical detection mechanism is illustrated. In the figure, diethylenetriamine-functionalized graphene oxide, neomethylene blue, and gold nanoparticles correspond to DETA-GO, NMB, and AuNPs, respectively. After the serum sample enters the paper-based chip, it reaches the E2 and P4 detection regions, respectively. The target specifically binds to the corresponding aptamer, causing impaired interfacial electron transport and a decrease in the DPV peak current, thereby enabling independent readout of the two hormone indicators.

[0111] Compared with the prior art, the present invention has at least the following beneficial effects:

[0112] First, it achieves synergistic detection of two hormones on a single paper-based device. Two independent detection zones, E2 and P4, are formed on a single paper-based device, allowing for dual-target identification with a single sample addition, reducing the need for separate samples, consumables, and operational steps. Each channel has an independent three-electrode system and independent calibration, supporting coordinated reporting while avoiding the forced coverage of two hormones with significantly different concentration scales using the same measurement range. Compared to existing single-channel paper-based aptamer sensors, this invention elevates detection from single hormone detection to synergistic detection of two hormones, providing combined E2 / P4 endocrine information, making it more suitable for clinical scenarios such as assisted reproduction and ovulation monitoring.

[0113] Second, differentiated probe density design achieves dual-concentration scale compatibility. This invention, through systematic concentration gradient optimization, discovered that the E2 aptamer exhibits the highest target response at 1.0 μM, while the P4 aptamer shows the highest target response at 1.5 μM. This "asymmetric" optimization result is unpredictable by those skilled in the art from studies using a single-target sensor: if the same concentration is used in both channels, at least one channel will experience a decrease in sensitivity and a narrowing of its linear range. Through differentiated probe density design, optimized detection performance is achieved in both channels at the pg / mL and ng / mL scales, respectively, enabling the same device to cover different concentration scales of E2 and P4.

[0114] Third, paper-based passive shunting and spatial partitioning reduce system complexity. Paper-based capillary transport does not rely on an external pump; the device is mainly manufactured through wax printing, screen printing, and lamination, making it suitable for low-cost, mass production and single-use applications. The sample volume required for validation is only 25 μL, which helps reduce clinical sample consumption and provides a structural basis for applications in patient-friendly or resource-constrained scenarios. The two detection zones are spatially separated and each has a complete three-electrode system, avoiding crosstalk between channel fluid paths and electrical signals.

[0115] Fourth, the composite interface integrates signal generation, enhanced electron transfer, and probe immobilization. In the functionalized carbon nanomaterial / NMB / AuNPs interface, redox-active molecules are assembled within the composite material, eliminating the need for additional labeled probes during detection. Gold nanoparticles improve conductivity and immobilize thiol aptamers, while carbon nanomaterials provide a high surface area framework. Target binding is directly converted into peak current reduction, eliminating the need for multiple amplification steps such as sandwich probes, enzyme cycling, or chain displacement, thus simplifying the operation process.

[0116] Fifth, aptamer recognition and MCH blocking together provide selectivity. Aptamer probe concentrations are optimized for each channel, and combined with MCH blocking and spatial partitioning, the platform maintains its target-advantage response even when faced with various structurally similar steroids and single interfering substances at 10-fold excess. The dual-channel standard solution has a wide linear range, covering the concentration range from low levels to significantly elevated states.

[0117] Sixth, good manufacturing repeatability and storage stability. Both the composite-modified electrodes and the complete aptamer devices exhibited low intra-batch and inter-batch RSDs (<1.4%); after 28 days of refrigeration, they still maintained more than 83% of the initial response. These results demonstrate the feasibility of the process in prefabrication, quality control, and storage.

[0118] Seventh, preliminary validation in undiluted serum. The platform has been matrix-matched and validated on undiluted clinical serum, with all validated samples falling within ±15% of the reference method. This result is closer to real-world usage conditions than studies that validated only in buffer or spiked samples.

[0119] Fabrication of paper-based microfluidic devices

[0120] The implementation method of this invention is as follows:

[0121] 1. Design the chip pattern using graphic design software, and wax print the microfluidic pattern onto Whatman Grade 1 qualitative filter paper or equivalent cellulose paper. After wax printing, heat the paper at 120°C for 5 minutes to allow the wax to fully penetrate the paper thickness and form a hydrophobic boundary defining the liquid flow. Then, fabricate the electrodes using screen printing: Ag / AgCl conductive ink is used for the reference electrode, and conductive carbon ink is used for the counter and working electrodes. After the ink has cured, align the sample / flow path layer, auxiliary electrode layer, and working electrode layer according to the design positions, and use adhesive lamination to form the complete device. During processing, control the continuity of the wax barrier, the alignment deviation of the three layers, the effective electrode area, and contamination of the electrode contacts; the working, counter, and reference electrodes in each detection area should be able to establish a stable three-electrode circuit after wetting.

[0122] 2. Preparation of gold nanoparticles

[0123] Gold nanoparticles can be prepared using the sodium citrate reduction method. 50 mL of a 0.01% (w / w) chloroauric acid solution is heated to boiling under magnetic stirring. Then, 2.5 mL of a 1% (w / w) trisodium citrate solution is rapidly added, and vigorous stirring continues for 20 min. Heating is stopped when the solution turns wine-red, and stirring is maintained until cooled to room temperature. The target particle size of the obtained gold nanoparticles is approximately 15 nm; when used for composite material preparation, the gold nanoparticle solution concentration is 0.05 mg / mL. -1 Particle size and dispersibility can be confirmed using transmission electron microscopy. If commercial gold nanoparticles or other reduction routes are used, it should be ensured that they can stably load on functionalized carbon nanomaterials / redox reactive molecules, improve electron transfer, and provide sufficient Au-S binding sites.

[0124] 3. Preparation of composite materials (preferred embodiment)

[0125] Prepare 1.0 mg mL solutions using deionized water. -1 DETA-GO dispersion and 2.0 mg mL -1 The NMB solutions were sonicated for 30 min each to obtain a homogeneous system. The two were then mixed at a 1:1 volume ratio and magnetically stirred at 1000 rpm for 24 h at room temperature to allow NMB to assemble onto the DETA-GO surface via π-π interactions. The mixture was centrifuged and repeatedly washed with deionized water to remove unbound NMB, and the resulting DETA-GO / NMB was resuspended to its original volume.

[0126] Take 0.5 mL of the resuspended DETA-GO / NMB dispersion and mix it with 2.0 mL of a 0.05 mg / mL solution. -1A solution of gold nanoparticles with a particle size of approximately 15 nm (volume ratio 1:4) was mixed and stirred at 1000 rpm for 12 h at room temperature. The purified DETA-GO / NMB / AuNPs composite material was collected after centrifugation and washing. For batch manufacturing, the raw material batch number, ultrasonic power, centrifugation speed and time, final solids content of the composite material, and resuspension volume can be further recorded to facilitate process scale-up and batch-to-batch consistency control.

[0127] 4. Working electrode modification and aptamer fixation

[0128] 10 μL of the prepared composite material dispersion was drop-coated onto each screen-printed carbon working electrode and dried at 50°C for 4 h to form a stable electroactive layer. Subsequently, 10 μL of 1.0 μM thiolized E2 aptamer was added to the E2 detection region, and 10 μL of 1.5 μM thiolized P4 aptamer was added to the P4 detection region. Both were incubated at 4°C for 6 h to immobilize the aptamers via Au-S interaction. The electrodes were then gently washed with Tris-EDTA buffer at pH 7.4 to remove loosely adsorbed probes.

[0129] Add 10 μL of 1.0 mM MCH to each of the two working electrodes and block for 1 h. After blocking, wash with Tris-EDTA buffer and PBS, and store the assembled device at 4°C.

[0130] 5. Sample Testing Procedure

[0131] The assay was performed at room temperature. 25 μL of standard solution or serum sample was added to the sample inlet, allowing the liquid to enter both detection zones under capillary action, and incubated with the corresponding aptamer interface for 60 min. After incubation, the electrode surface was rinsed three times with PBS by dropwise addition to reduce non-specific adsorption before DPV measurement. Clinical validation of this invention used undiluted serum directly, but samples with visible hemolysis or lipemia were excluded. For actual unknown serum samples, a calibration curve using the same matrix should be used, rather than directly applying a PBS standard curve.

[0132] The electrochemical parameters are as follows: cyclic voltammetry (CV) scan range is -0.5 to 0.1 V, scan rate is 100 mV s. -1 The step potential is 10 mV; the differential pulse voltammetry (DPV) uses the same potential range, with a step potential of 5 mV, an interval of 0.5 s, and a scan rate of 10 mV / s. -1 Channels E2 and P4 can be read sequentially using the same DPV parameters, or they can be read in parallel using a portable dual-channel potentiostat. When using electrochemical impedance spectroscopy (EIS) for interface characterization, in a 5 mM [Fe(CN)6] solution containing 0.1 M KCl... 3- / 4-Tested in solution, frequency from 1 Hz to 100 kHz, DC potential 0.0 V, AC amplitude 10 mV.

[0133] 6. Calibration, quality control, and result calculation

[0134] The E2 standard curve uses 5 pg mL -1 Up to 200 ng / mL -1 For series concentrations, the P4 standard curve uses 100 pg / mL. -1 Up to 2 μg mL -1 Series concentrations. Record the peak current of the NMB-related DPV and perform logarithmic regression on the peak current and concentration respectively. Detection limits are calculated based on a signal-to-noise ratio of 3. At least blank, low-value, and high-value quality controls should be set up for each batch of devices, and blank peak current, target response difference, intra-batch relative standard deviation (RSD), and inter-batch RSD should be monitored. If used with serum, matrix-matched curves should be constructed using serum values ​​assigned by the reference method, and independent samples should be used for methodological comparison.

[0135] Morphology and composition can be confirmed using scanning electron microscopy (SEM), transmission electron microscopy (TEM), and transmission electron microscopy-energy dispersive spectroscopy (TEM-EDS): a qualified composite interface should exhibit a rough, wrinkled structure, with gold nanoparticles distributed within the carbon nanomaterial / redox active molecular matrix. Electrochemical function can be confirmed using CV, DPV, and EIS: the bare electrode shows no obvious redox peaks within the set window; after composite material modification, anodic and cathodic peaks appear at approximately -0.23 V and -0.32 V, respectively; the peak current decreases sequentially after aptamer immobilization, MCH blocking, and target binding. These layer-by-layer changes can serve as the basis for process release and failure analysis.

[0136] The test results and performance verification of this invention are as follows:

[0137] 1. Results of aptamer concentration optimization

[0138] In the concentration gradients of 0.5, 1.0, 1.5, 2.0, 3.0, and 5.0 μM, the E2 aptamer exhibited the largest ΔI at 1.0 μM, while the P4 aptamer showed the largest ΔI at 1.5 μM; however, the response decreased with further increases in concentration. This indicates that different probe densities are required for the two channels to obtain optimal detection performance, confirming the necessity of the differentiated probe density design of this invention. If the same concentration is used in both channels, the sensitivity of at least one channel will decrease, and the linear range will narrow, making it impossible to simultaneously achieve compatible detection of two hormones.

[0139] 2. Composite materials and interface construction results

[0140] The NMB concentration was increased from 0.5 to 2.0 mg / mL. -1At that time, the DPV response increased; it continued to rise to 4.0 mg / mL. -1 The response actually decreased. When the volume ratio of DETA-GO / NMB to AuNPs was changed from 1:1 to 1:6, the highest current was obtained at 1:4. The batch-average peak current of the composite-modified electrodes of four independent batches was 15.33-15.70 μA, the intra-batch RSD was all below 1.6%, the combined intra-batch RSD was 1.37%, and the inter-batch RSD was 1.06%, indicating that the composite layer preparation had good reproducibility.

[0141] SEM revealed that the modified electrode has a rough, wrinkled surface, which is beneficial for increasing the effective area. TEM showed that AuNPs are distributed in a thin, folded DETA-GO / NMB matrix, and TEM-EDS supported successful Au loading. EIS showed that the charge transfer resistance of the modified composite material was lower than that of the bare electrode. Layer-by-layer characterization by CV and DPV further showed that the current decreased after the formation of the aptamer and MCH layer, and continued to decrease after the addition of the corresponding target, consistent with the design mechanism of "target binding increases interfacial barrier".

[0142] 3. Analytical range, linearity, and limit of detection

[0143] E2 channel at 5 pg mL -1 Up to 200 ng / mL -1 Within the specified range, the peak current decreases with increasing E2 concentration. The commonly used logarithmic regression equation for peak current versus E2 concentration is: I(μA) = -2.2081 log 10 (C_E2) + 14.9565, R² = 0.9989 C_E2 was expressed in pg mL -1 The DPV response at the target-free interface was 14.1578 μA, and the limit of detection, calculated based on a signal-to-noise ratio of 3, was 3.7 pg / mL. -1 .

[0144] P4 channel at 100 pg mL -1 Up to 2 μg mL -1 Within the range, a peak current reduction response in the same direction is obtained, and the regression equation is: I(μA) = -2.1337 log 10 (C_P4) + 11.0089, R² = 0.9980 C_P4 in ng mL -1 The DPV response at the target-free interface was 13.8991 μA, and the detection limit was 76.8 pg / mL. -1 The two channels are configured with separate probe concentrations and ranges, allowing the same device to cover different concentration scales for E2 and P4.

[0145] 4. Repeatability and storage stability

[0146] The average peak current of the four batches of devices in channel E2 ranged from 14.081 to 14.252 μA, with intra-batch RSDs ranging from 0.884% to 1.202%. The overall RSD for the 20 devices was 1.077%, and the combined intra-batch RSD and inter-batch RSD were 1.019% and 0.575%, respectively. The average peak current of the four batches in channel P4 ranged from 13.768 to 13.975 μA, with intra-batch RSDs ranging from 0.781% to 1.412%. The overall, combined intra-batch, and inter-batch RSDs were 1.227%, 1.140%, and 0.684%, respectively.

[0147] The fully assembled sensor was stored at 4°C and then administered at 1 ng / mL. -1 E2 and 50 ng mL -1 P4 monitors the target response. After 28 days, the E2 and P4 channels maintained 85.23% and 83.14% of their initial responses, respectively. This result supports the device's prefabrication and storage using a refrigerated method.

[0148] 5. Selectivity and anti-interference performance

[0149] E2 channel at 100 pg mL -1 E2 was the target, compared to 1 ng / mL -1 P4, pregnenolone, cholesterol, cortisol, estrone, estriol, and aldosterone; P4 channel at 5 ng / mL -1 P4 was the target, compared to 50 ng / mL. -1 The hormones included pregnenolone, cholesterol, cortisol, estrone, E2, estriol, and aldosterone. Even at 10 times the target concentration, the normalized responses of the two aptamer channels to the corresponding hormones remained significantly dominant.

[0150] After adding a 10-fold excess of a single interfering agent to the target, the maximum signal deviation of the E2 channel was 10.62% and the maximum signal deviation of the P4 channel was 11.50% compared with the response containing only the target. This indicates that aptamer recognition, spatial partitioning, and MCH closure together provide the ability to distinguish structurally similar steroids.

[0151] 6. Clinical serum validation

[0152] Clinical samples were assigned values ​​using electrochemiluminescence immunoassay. E2 matrix-matched calibration values ​​were selected at 16.8, 256, 788.3, ​​1349.5, 2055.3, and 3885 pg / mL. -1 Six serum levels; P4 was selected at 1.12, 6.59, 15.11, 23.15, 30.67, and 37.59 ng / mL. -1Six serum levels were used. Samples with visible hemolysis or lipemia were excluded. The DPV peak currents of both channels in serum decreased with increasing target concentration. The serum curve for E2 was I = -0.0006444C_E2 + 5.848, R² = 0.9864; the serum curve for P4 was I = -0.06553C_P4 + 6.779, R² = 0.9831.

[0153] Ten additional independent clinical serum samples not included in the calibration were used for validation. Compared to the electrochemiluminescence reference values, the average relative bias for E2 was 1.86%, and for P4, it was -2.23%. All samples were within the pre-defined ±15% deviation range, with the maximum absolute relative errors for E2 and P4 not exceeding 13.17% and 14.23%, respectively. These results demonstrate that the platform can maintain a concentration-dependent response in undiluted serum and preliminarily achieve dual-hormone quantification.

[0154] 7. Summary of Key Performance Analysis of Preferred Embodiments

[0155]

[0156] The following are alternative solutions to the present invention:

[0157] Without altering the core concepts of "shared sample introduction, spatial partitioning, independent identification, and independent electrochemical output," the following alternatives are all foreseeable variations of this invention:

[0158] The paper-based material can be cellulose filter paper, nitrocellulose membrane, glass fiber paper, or a porous sheet formed by a combination of these; the hydrophobic boundary can be formed by wax printing, hydrophobic ink printing, photolithography, laser modification, or hot pressing; the three-layer structure can also be integrated into a two-layer, four-layer, or origami-style structure. The above alternatives must ensure that the sample can be passively distributed to the two detection zones without unacceptable cross-contamination.

[0159] Electrodes can be formed by screen printing, inkjet printing, aerosol spraying, vapor deposition, or sputtering. The working electrode substrate can be carbon, gold, or other conductive materials; the reference electrode can be Ag / AgCl or a quasi-reference structure suitable for disposable devices. The two channels can each be configured with a complete three-electrode setup, or they can share a counter electrode or reference electrode if no significant crosstalk is demonstrated. Readouts can be performed sequentially by a benchtop workstation or in parallel by a portable dual-channel potentiostat, mobile phone connectivity module, or integrated circuit.

[0160] The carbon nanomaterials in the composite interface can be replaced with other functionalized carbon materials; the redox-active molecules can be replaced with methylene blue, anthraquinone, ferrocene, or other redox-active compounds that can output signals within a selected potential window; the particle size, morphology, and loading of gold nanoparticles can be adjusted, and gold nanoflowers, gold nanorods, or conductive nanostructures with thiol affinity can also be used. The alternative materials must simultaneously satisfy requirements for stable electrochemical signals, probe immobilization, and suitability for complex matrices.

[0161] The recognition element can be the E2 and P4 aptamers of this invention, or a truncated, extended, point-mutated, or chemically modified sequence with the same target binding function. In addition to the 5′ thiol group, the immobilization method can also be the 3′ thiol group, dithiol group, biotin-avidin, amino-carboxyl coupling, or click chemistry.

[0162] Sample types can be expanded to include plasma, saliva, sweat, urine, or interstitial fluid, and buffer salts, stabilizers, filter materials, or antifouling agents can be pre-stored in the sample application layer. For different matrices, calibration curves and interference assessments should be re-established. The platform can also add a third or more detection channels for detecting indicators such as luteinizing hormone, follicle-stimulating hormone, and cortisol, but the two core channels, E2 and P4, should be retained.

[0163] Although the present invention has been described in detail above, it is not limited thereto, and those skilled in the art can make various modifications based on the principles of the present invention. Therefore, all modifications made in accordance with the principles of the present invention should be understood to fall within the protection scope of the present invention.

Claims

1. A dual-channel paper-based microfluidic electrochemical aptamer sensing platform for the simultaneous detection of estradiol and progesterone in a sample, comprising: A sample import layer (100) for importing samples and having a sample loading area (112); The auxiliary electrode functional layer (200) of the sample introduction layer is in contact with the sample introduction layer. The working electrode functional layer (300) that contacts the auxiliary electrode functional layer; The auxiliary electrode functional layer (200) is provided with a first electrochemical detection area (221) for detecting estradiol, a second electrochemical detection area (225) for detecting progesterone, and a sample diversion and guiding area (223) connecting the first electrochemical detection area (221) and the second electrochemical detection area (225). The sample diversion and guiding area (223) is in contact with the sample loading area (112) of the sample introduction layer (100). The working electrode functional layer (300) is provided with a first working electrode (311) located in the first electrochemical detection area (221) and a second working electrode (312) located in the second electrochemical detection area (225). An estradiol-specific thiolated aptamer is immobilized on the surface of the first working electrode (311); The surface of the second working electrode (312) is fixed with a progesterone-specific thiolated aptamer.

2. The dual-channel paper-based microfluidic electrochemical aptamer sensing platform according to claim 1, wherein, The surface of the first working electrode (311) is sequentially stacked with a first composite electroactive interface and an estradiol-specific thiolated aptamer; the surface of the second working electrode (312) is sequentially stacked with a second composite electroactive interface and a progesterone-specific thiolated aptamer.

3. The dual-channel paper-based microfluidic electrochemical aptamer sensing platform according to claim 2, wherein, The first composite electroactive interface comprises a first carbon nanomaterial, a first redox active molecule, and a first gold nanoparticle. The first redox active molecule is loaded onto the surface of the first carbon nanomaterial via π-π interactions, and the first gold nanoparticle provides Au-S anchoring sites for the estradiol-specific thiolated aptamer. The second composite electroactive interface comprises a second carbon nanomaterial, a second redox active molecule, and a second gold nanoparticle. The second redox active molecule is loaded onto the surface of the second carbon nanomaterial via π-π interactions, and the second gold nanoparticle provides Au-S anchoring sites for the progesterone-specific thiolated aptamer.

4. The dual-channel paper-based microfluidic electrochemical aptamer sensing platform according to claim 3, wherein, The estradiol-specific thiolated aptamer is modified at the 5′ end by 5′-SH-(CH2)6 and immobilized on the first gold nanoparticle by Au–S interaction; the progesterone-specific thiolated aptamer is modified at the 5′ end by 5′-SH-(CH2)6 and immobilized on the second gold nanoparticle by Au–S interaction.

5. The dual-channel paper-based microfluidic electrochemical aptamer sensing platform according to claim 1, wherein, The first carbon nanomaterial and the second carbon nanomaterial are diethylenetriamine-functionalized graphene oxide (DETA-GO), and the first redox active molecule and the second redox active molecule are neomethylene blue (NMB).

6. The platform according to claim 1, characterized in that, The fixed concentration of the estradiol-specific thiolated aptamer on the first working electrode (311) is between 0.9 and 1.1 μM, and the fixed concentration of the progesterone-specific thiolated aptamer on the second working electrode (312) is between 1.4 and 1.6 μM.

7. The dual-channel paper-based microfluidic electrochemical aptamer sensing platform according to claim 1, wherein, The sample introduction layer (100), auxiliary electrode functional layer (200) and working electrode functional layer (300) are all cellulose paper layers; the sample introduction layer (100), auxiliary electrode functional layer (200) and working electrode functional layer (300) are laminated to form the paper-based microfluidic chip.

8. The dual-channel paper-based microfluidic electrochemical aptamer sensing platform according to claim 4, wherein, The estradiol-specific thiolated aptamer and the progesterone-specific thiolated aptamer were blocked with 6-mercapto-1-hexanol MCH, respectively, to reduce the non-specific adsorption of serum proteins and non-target molecules on the gold surface.

9. A method for simultaneously detecting estradiol and progesterone using the platform described in claim 1, characterized in that, Includes the following steps: The sample to be tested is added to the sample loading area (112) of the sample introduction layer (100), so that the sample is diverted to the first electrochemical detection area (221) and the second electrochemical detection area (225) under capillary action, so that the sample can be incubated with the estradiol-specific aptamer on the first working electrode (311) and the progesterone-specific aptamer on the second working electrode (312). After incubation, the electrode surface was rinsed, and then the current decrease caused by target binding was read by differential pulse voltammetry (DPV) to determine the concentrations of estradiol and progesterone in the sample.

10. A kit for the simultaneous detection of estradiol and progesterone, characterized in that, include: The dual-channel paper-based microfluidic electrochemical aptamer sensing platform according to claim 1; Estradiol series calibrators and progesterone series calibrators; Detergent; as well as The instruction manual contains the DPV testing parameters and the usage methods of the calibration curve.

Images