An electrochemical detection method for detecting total viable bacteria in bioaerosols based on ATP

Abstract

The application discloses an electrochemical detection method for detecting total living bacteria of biological aerosol based on ATP, and belongs to the technical field of analysis and detection. The application utilizes ATP as a specific cofactor of T4 DNA ligase to trigger the circularization of linear single-strand DNA, and then generates a large amount of long-chain DNA and pyrophosphate anions through a rolling circle amplification reaction. The pyrophosphate anions combine with manganese ions to form manganese pyrophosphate precipitation as a structural framework. Meanwhile, the long-chain DNA combines with the manganese pyrophosphate to form a DNA-manganese complex particle (DMP) with electrochemical activity. The DMP can be loaded on a working electrode to realize quantitative detection of ATP and total living bacteria through the electrochemical signal intensity. The method of the application does not need an optical reading device, has high sensitivity, a wide detection range, and can distinguish between dead and living bacteria, is suitable for detecting total living bacteria of biological aerosol, and has a very good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of analytical detection technology, specifically relating to an electrochemical detection method for total viable bacteria in bioaerosols based on ATP. Background Technology

[0002] Bioaerosols contain a variety of live microorganisms, posing a significant risk to human health, including respiratory infections and allergic reactions. Given this threat, many countries have established regulatory limits for airborne bacterial concentrations, with total bacteria being the most frequently monitored air quality assessment indicator. The national standard GB 37488-2019 specifies a limit of 1500 CFU / m³ for rest areas. 3 Other public places have a CFU / m³ of 4000. 3 This standard also highlights the importance of monitoring total viable bacteria in bioaerosols for protecting public health.

[0003] Traditional quantitative analysis of bioaerosols commonly employs colony counting, with results presented in colony-forming units (CFU). While this method offers acceptable accuracy, the incubation period is lengthy, ranging from 48 to 72 hours. Furthermore, it only detects culturable microorganisms, easily underestimating the true microbial content, particularly missing surviving but unculturable bacteria that still possess metabolic activity and pathogenic potential. Polymerase chain reaction (PCR), designed for specific pathogens, is unsuitable for total microbial counting. Advanced techniques such as laser-induced fluorescence, flow cytometry, and mass spectrometry offer high sensitivity but rely on large and expensive instruments, require complex sample pretreatment or labeling, and cannot distinguish between live and dead cells without reactive dyes. Adenosine triphosphate (ATP) is a universal marker of metabolically active bacteria, making it an ideal target for monitoring total viable bacterial bioaerosols. Previous studies (Ko, HS; Hwang, J. Fluorescence Resonance Energy Transfer-Based Biosensor with Femtomolar Sensitivity for Culture-Independent Detection of Airborne Bacteria. Environ. Sci. Technol. 2026, 60 (5), 4279–4288. DOI: 10.1021 / acs.est.5c15957) have confirmed the correlation between ATP and colony forming unit (CFU) counts, validating its feasibility for quantifying total bacteria in the air. However, to date, no studies have been reported on the detection of total viable bacteria in bioaerosols using electrochemical methods based on ATP. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide an electrochemical detection method for total viable bacteria in bioaerosols based on ATP. This invention utilizes ATP as a specific cofactor for T4 DNA ligase to trigger the circularization of linear single-stranded DNA, thereby initiating a rolling circle amplification reaction to generate a large amount of long-chain DNA and pyrophosphate anions. The pyrophosphate anions combine with manganese ions to form manganese pyrophosphate precipitate as the structural backbone. Simultaneously, the long-chain DNA combines with manganese pyrophosphate to form electrochemically active DNA-manganese complex particles (DMPs). These DMPs can be loaded onto the working electrode, and the quantitative detection of ATP and total viable bacteria is achieved through electrochemical signal intensity. This method requires no optical readout equipment, has high sensitivity, a wide detection range, and can distinguish between live and dead bacteria, making it suitable for the detection of total viable bacteria in bioaerosols.

[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides an electrochemical detection method for total viable bacteria based on ATP, comprising the following steps: (1) Extracting bacterial ATP from the sample to be tested: The bacteria in the sample solution to be tested are broken, the bacterial suspension is centrifuged, and the supernatant is taken to obtain the test solution containing bacterial ATP. (2) ATP-triggered cyclization reaction: The test solution prepared in step (1) is mixed with 5' phosphorylated linear single-stranded DNA ( L Mix DNA and T4 DNA ligase buffer, add T4 DNA ligase, and react at 30-40℃ for 5-30 min, then inactivate the enzyme; ATP acts as a cofactor for T4 DNA ligase, catalyzing the circularization of linear single-stranded DNA into a circular DNA template. C DNA); (3) Rolling circle amplification and assembly of DNA-manganese complex particles: Add RCA buffer containing manganese ions, RCA primers and dNTPs to the reaction solution of step (2) to obtain RCA reaction solution. Heat at 80~95℃ for 2~10 min, then cool to room temperature. After the primers bind to the loop, add excess Super Phi29 DNA polymerase and perform rolling circle amplification reaction at 40~45℃ for 0.5~2 h. Then inactivate the enzyme and assemble at room temperature for 5~15 hours. Rolling circle amplification produces a large amount of long-chain DNA. The pyrophosphate anions generated during the reaction combine with manganese ions to form manganese pyrophosphate as the backbone. The long-chain DNA combines with manganese pyrophosphate to form electroactive DNA-manganese complex particles. (4) Signal detection: The DNA-manganese complex particles obtained in step (3) are dispersed in the electrode loading solution, dropped onto the surface of the working electrode and dried, connected to an electrochemical workstation, and detected by cyclic voltammetry. The peak current intensity is recorded, and the quantitative detection of total viable bacteria is achieved by the quantitative relationship between peak current intensity and bacterial concentration.

[0006] In the above technical solution, the sample solution to be tested in step (1) is obtained by collecting live bacteria in bioaerosol using a sampler.

[0007] In the above technical solution, the sampling solution used in step (1) is PBS buffer.

[0008] In the above technical solution, the crushing method described in step (1) further includes ultrasonic crushing.

[0009] In the above technical solution, the specific process of the ultrasonic fragmentation method in step (1) is as follows: ultrasonic fragmentation for 20~40 s, freezing in ice for 1~3 min, and repeating this operation 3~10 times.

[0010] In the above technical solution, further, the centrifugation speed in step (1) is 6000~10000 rpm.

[0011] In the above technical solution, the nucleotide sequence of the linear single-stranded DNA in step (2) is shown in SEQ ID NO.1.

[0012] In the above technical solution, the linear single-stranded DNA in step (2) is an aptamer sequence with a unique secondary structure, which can be efficiently circularized by T4 DNA ligase without the need for a splint chain.

[0013] In the above technical solution, the T4 DNA ligase buffer in step (2) is further composed of the following: 350~450 mM Tris-HCl, 50~150 mM MgCl2, 50~150 mM DTT, pH 7.5~8.0.

[0014] In the above technical solution, further, in step (2), the test solution and the 5' phosphorylated linear single-stranded DNA ( L The volume ratio of DNA (0.5~2 μM), T4 DNA ligase buffer, and T4 DNA ligase (0.01~0.1 U / μL) is 5~15:3~5:1~3:0.5~2.

[0015] In the above technical solution, further, the inactivation process in step (2) is to keep warm at 85~100 ℃ for 1~5 min.

[0016] In the above technical solution, the nucleotide sequence of the RCA primer in step (3) is shown in SEQ ID NO.2.

[0017] In the above technical solution, the composition of the RCA reaction solution in step (3) is as follows: 40~60 mM Tris-HCl, 5~15 mM (NH4)2SO4, 0.5~5 mM DTT, 5~10 mM MnSO4, 0.5~5 mM dNTPs, and 100~300 pmol RCA primers.

[0018] In the above technical solution, the assembly of the DNA-manganese complex particles in step (3) is carried out at room temperature for 10 h.

[0019] In the above technical solution, further, step (3) involves centrifuging the obtained solution at 6000~15000 rpm for 5~20 min, discarding the supernatant, adding ultrapure water to resuspend the particles, centrifuging at 6000~15000 rpm for 5~20 min, and repeating the above process 3~5 times to remove unreacted RCA reagent and obtain DNA-manganese complex particles.

[0020] In the above technical solution, further, the working electrode in step (4) is a glassy carbon electrode, and the electrode loading solution consists of: 2~4 mg acetylene black, 0.4~0.6 mL ultrapure water, 0.5~1.5 mL 2-propanol and 0.05~0.5 mL 5% Nafion. ® Solution, electrode loading liquid to enhance the conductivity and stability of the electrode.

[0021] In the above technical solution, further, the detection conditions of the cyclic voltammetry in step (4) are: potential range of 0 ~ 0.8 V (relative to Ag / AgCl), and scan rate of 10 ~ 30 mV / s.

[0022] In the above technical solution, further, the quantitative relationship between the peak current intensity and the bacterial concentration in step (4) is obtained by the following method: preparing a series of concentrations (10, respectively) 1 10 2 10 3 10 4 10 5 10 6 10 7 The bacterial suspension (CFU / mL) was tested according to steps (1) to (4) above, the peak current intensity was recorded, and a standard curve was obtained by fitting the peak current intensity and bacterial concentration.

[0023] Compared with the prior art, the present invention has the following beneficial effects: This invention uses ATP as a specific cofactor for T4 DNA ligase to initiate cyclization and rolling circle amplification reactions, achieving efficient amplification of the ATP signal and high detection sensitivity, with the ATP detection limit reaching the femtomolar level. By utilizing the rolling circle amplification product to form an electrochemically active complex with manganese pyrophosphate, a label-free electrochemical detection system is constructed, simplifying the detection steps. The electrical detection equipment and instruments used in the entire scheme are easy to integrate and are suitable for the detection of total viable bacteria in bioaerosols. Attached Figure Description

[0024] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.

[0025] Figure 1 This is a schematic diagram illustrating the principle of the detection method of the present invention.

[0026] Figure 2 This is a diagram showing the feasibility test results of ATP-based detection of total viable bacteria in simulated bioaerosols in Example 1.

[0027] Figure 3 The image shows the results of detecting the concentration of simulated bioaerosol bacteria using the culture method in Example 2.

[0028] Figure 4 This is a comparison chart of the results of detecting total viable bacteria in simulated bioaerosols using the ATP-based method and the culture method in Example 2. Detailed Implementation

[0029] The present invention will be described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention.

[0030] Unless otherwise specified, the materials and reagents used in the embodiments are commercially available.

[0031] The DNA oligonucleotide sequences used in this embodiment were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and purified by high performance liquid chromatography before use; T4 DNA ligase, ATP, dNTPs and Super Phi29 DNA polymerase were purchased from Sangon Biotech (Shanghai) Co., Ltd.; bacterial strains were purchased from China Industrial Microbial Culture Collection Center; all reagents were of analytical grade and were not further purified before use; the experimental water was ultrapure water (~18 MΩ·cm).

[0032] Example 1 This embodiment provides an electrochemical detection method for total viable bacteria in simulated bioaerosols based on ATP detection, specifically including the following steps: Step 1: Prepare standard solutions of ATP at different concentrations (using ultrapure water as solvent), namely 2 fM, 20 fM, 200 fM, 2 pM, 20 pM, 200 pM, 2 nM, 20 nM, 200 nM, 2 μM, and 20 μM. Step 2: ATP-triggered cyclization reaction: In a 1.5 mL microcentrifuge tube, add 10 μL of the ATP test solution prepared in Step 1 and 4 μL of 5' phosphorylated linear single-stranded DNA (…). L The reaction mixture consisted of 1 μM DNA, 2 μL of 10×T4 ligase buffer (400 mM Tris-HCl, 100 mM MgCl2, 100 mM DTT), and 3 μL of ultrapure water. Then, 1 μL of T4 DNA ligase (0.02 U) was added, resulting in a mixture with ATP concentrations of 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM, 100 nM, 1 μM, and 10 μM. The reaction solution was incubated at 37 °C for 10 min, and the reaction was terminated by heating at 90 °C for 2 min. ATP acts as a cofactor for T4 DNA ligase, catalyzing the circularization of linear single-stranded DNA into a circular DNA template. C DNA); L The nucleotide sequence of the DNA is as follows (SEQ ID NO.1): ATCTCGACTAGTCCCCAACCCGCCCTACCCCAAGTCTCCCCAGCTTTGTCGCCAGGGAGTTGGGGCATCTAGGTATCCGAATGTCTCGGAT; Step 3: Rolling circle amplification and assembly of DNA-manganese complex particles: Add 20 μL of RCA buffer, RCA primers and dNTPs to the reaction solution from Step 2 to obtain the RCA reaction solution (200 pmol RCA primers, 1 mM dNTPs, 50 mM Tris-HCl (pH=7.5), 10 mM (NH4)2SO4, 1 mM DTT, 8 mM MnSO4); heat the mixture at 90 °C for 5 min, then cool it to room temperature for 10 min; after the primers bind to the loop, add 20 U of Super Phi29 DNA polymerase and mix, then add ultrapure water to make up to 50 μL of the reaction system. Rolling circle amplification was performed at 42 °C for 1 h, followed by inactivation of SuperPhi29 DNA polymerase at 65 °C for 10 min. The reactants were then assembled at room temperature for 10 h. The rolling circle amplification produced a large amount of long-chain DNA. During the reaction, pyrophosphate anions were generated, which combined with manganese ions to form manganese pyrophosphate, which served as the backbone. The long-chain DNA and manganese pyrophosphate bound together to form electroactive DNA-manganese complex particles (DMPs). The resulting solution was centrifuged at 10,000 rpm for 10 min, the supernatant was discarded, and the particles were resuspended in ultrapure water. The mixture was centrifuged again and washed three times to remove unreacted RCA reagent. The nucleotide sequence of the RCA primer is as follows (SEQ ID NO.2): TAGTCGAGATATCCGAGACA; Step 4: Signal detection: Disperse the DNA-manganese complex particles obtained in step 3 in a solution containing 0.5 mL of ultrapure water, 1 mL of 2-propanol, 0.1 mL of 5% Nafion solution and 3 mg of acetylene black, sonicate for 2 min, take 10 μL of the mixture and load it onto the surface of a glassy carbon electrode, dry it and use it as the working electrode.

[0033] Electrochemical tests were performed using a CHI650E electrochemical potentiostat / galvanostat with 1.0 M Na2SO4 as the electrolyte. Cyclic voltammetry was used to detect the current in the potential range of 0–0.8 V (relative to Ag / AgCl) at a scan rate of 20 mV / s, and the peak current intensity was recorded.

[0034] The results are as follows Figure 2 As shown, a characteristic redox peak was observed near 0.4 V, indicating that the DNA-manganese complex particles are electrochemically active. The peak current intensity increased in a concentration-dependent manner as the ATP concentration increased from 1 fM to 10 μM.

[0035] Example 2: Comparison of this method and culture method for detecting total viable bacteria in simulated biological aerosols Step 1: Bacterial culture: Add 10 μL of *E. coli* BL21 (CICC23796) to 5 mL of LB medium and incubate overnight at 37 ℃ and 150 rpm. After overnight incubation, determine the bacterial concentration of *E. coli*. Take 1 mL of bacterial suspension (OD200)... 600 =1), centrifuge at 10000 rpm for 10 min at 4 ℃, discard the supernatant, and resuspend the precipitate in ultrapure water to form 10 7 CFU / mL bacterial suspension.

[0036] Step 2: Simulate the preparation of bioaerosols with high, medium, and low bacterial concentrations: First, prepare the bioaerosol simulation chamber (1m³ volume). 3 Material: PMMA) Sterilize with UV for 30 minutes, then dilute the bacterial suspension from step 1 to 10. 6 After adding CFU / mL, the solution was added to a microbial aerosol generator (TK-3, Zhengzhou Zhaowei Instrument Equipment), nebulized into a bioaerosol simulation chamber, and nebulized for 5 minutes; after being suspended in the air for one hour, the bacterial concentration reached approximately 10. 6 CFU / m 3 The aerosol sample was collected from the surrounding air using a microbial aerosol sampler (QY-S6, Beijing Qinye Zhiyuan Technology). The sampling liquid was 1×PBS (10 mL), the sampling rate was 120 L / min, the sampling time was 8 min, and the collection efficiency was 80%. After collection, the bioaerosol simulation chamber was sterilized with UV light for 30 minutes. The simulated bacterial concentration was approximately 10⁻⁶. 4 CFU / m 3 and 10 5 CFU / m 3 The operation method for bioaerosols is the same as described above.

[0037] Step 3: Count simulated bioaerosols at high, medium, and low bacterial concentrations using the culture method: Dilute the collected samples at high, medium, and low concentrations by 100 times respectively (10... 6 CFU / m 3 ), 10 times (10 5 CFU / m 3 ), 1 times (10 4 CFU / m 3 Afterwards, 50 μL was inoculated into a petri dish and cultured at 37 ℃ for 48 h for bacterial culture; colonies of 20-300 were counted on plates, and the bacterial concentration of the sampled liquid and the total viable bacterial concentration of the simulated bioaerosol were calculated using the following formula: (1) (2) In the formula: C1 is the concentration of bacteria in the air (CFU / m³)3 Q is the sampler's sampling flow rate (m³ / s). 3 / min); T is the sampling time (min); V1 is the volume of the sampling solution (mL); η is the sampling efficiency of the sampler; C2 is the bacterial concentration in the sampling solution (CFU / mL); X is the number of colonies in the petri dish (CFU); M is the dilution factor of the bacterial solution; V2 is the volume of the bacterial solution when spreading (mL).

[0038] Step 4: Bacterial lysis and ATP extraction: The high, medium and low concentration sample solutions were sonicated for 30 s and frozen on ice for 2 min. This operation was repeated 6 times. The lysate was centrifuged at 8000 rpm for 10 min at 4 ℃. The supernatant was collected to obtain the test solution containing bacterial ATP.

[0039] Step 5: ATP-triggered cyclization reaction: In a 1.5 mL microcentrifuge tube, add 10 μL of the bacterial ATP test solution prepared in step 4 and 4 μL of 5' phosphorylated linear single-stranded DNA (…). L DNA (1 μM), 2 μL 10×T4 DNA ligase buffer and 3 μL ultrapure water, followed by 1 μL T4 DNA ligase (0.02 U), and the reaction mixture was incubated at 37 °C for 10 min. The reaction was terminated by heating at 90 °C for 2 min.

[0040] Step 6: Rolling circle amplification and assembly of DNA-manganese complex particles: Add 20 μL of RCA buffer, RCA primers, and dNTPs to the reaction solution from Step 5 to form the RCA reaction solution (200 pmol RCA primers, 1 mM dNTPs, 50 mM Tris-HCl (pH=7.5), 10 mM (NH4)2SO4, 1 mM DTT, 8 mM MnSO4); heat the mixture at 90 °C for 5 min, then cool to room temperature for 10 min. After the primers bind to the loop, add 20 U of Super Phi29 DNA polymerase and mix, then add ultrapure water to bring the reaction volume to 50 μL. The reaction mixture was amplified by rolling circle at 42 °C for 1 h, and then inactivated by heating at 65 °C for 10 min. The reactants were assembled at room temperature for 10 h to form DNA-manganese complex particles (DMP). The resulting solution was centrifuged at 10,000 rpm for 10 min, the supernatant was discarded, the particles were resuspended in ultrapure water, centrifuged, and washed three times to remove unreacted RCA reagent.

[0041] Step 7: Signal detection and bacterial counting: The DNA-manganese complex particles obtained in Step 6 were dispersed in a solution containing 0.5 mL of ultrapure water, 1 mL of 2-propanol, 0.1 mL of 5% Nafion solution and 3 mg of acetylene black. The mixture was sonicated for 2 min. 10 μL of the mixture was loaded onto the surface of a glassy carbon electrode and dried to serve as the working electrode. Electrochemical tests were performed using a CHI650E electrochemical potentiostat / galvanostat with 1.0 M Na2SO4 as the electrolyte. Cyclic voltammetry was used to detect the peak current intensity within a potential range of 0 ~ 0.8 V (relative to Ag / AgCl) at a scan rate of 20 mV / s.

[0042] Step 8: Preparation of the standard curve for fitting bacterial concentration and peak current: Prepare bacterial concentrations of 10... 1 10 2 10 3 10 4 10 5 10 6 10 7 The CFU / mL Escherichia coli BL21 bacterial suspension was analyzed according to steps 4 to 7 above. The peak current intensity was recorded, and a standard curve was obtained by fitting the peak current intensity and bacterial concentration. The equation of the standard curve is as follows: (3) (4) In the formula: I is the peak current of the electrochemical test (µA); C3 is the bacterial concentration (CFU / mL); Substitute the peak current into the above formula (the standard curve of the bacterial concentration and the peak current fitting) to calculate the bacterial concentration in the sample solution. Substitute this into formula (1) to obtain the total viable bacterial concentration of the simulated bioaerosol.

[0043] The results of the culture method test are as follows Figure 3 As shown, the calculated concentrations of simulated aerosol bacteria at high, medium, and low concentrations were 1.78 × 10⁻⁶. 6 CFU / m 3 1.30×10 5 CFU / m 3 9.75×10 3 CFU / m 3 .

[0044] The electrochemical test results are as follows: Figure 4 The calculated concentrations of simulated aerosol bacteria at high, medium, and low concentrations were 2.52 × 10⁻⁶. 6 CFU / m 3 1.38×10 5 CFU / m 31.12×10 4 CFU / m 3 The bacterial concentration obtained by this electrochemical testing method is slightly higher than that obtained by the culture method, but basically the same.

[0045] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; modifications may be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions may be made to some or all of the technical features therein; however, these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An electrochemical detection method for total viable bacteria based on ATP, characterized in that, Includes the following steps: (1) The bacteria in the sample solution to be tested are broken, the bacterial suspension is centrifuged, and the supernatant is taken to obtain the test solution containing bacterial ATP. (2) The test solution prepared in step (1) is mixed with 5' phosphorylated linear single-stranded DNA ( L Mix DNA and T4 DNA ligase buffer, add T4 DNA ligase, react at 30-40 ℃ for 5-30 min, and then inactivate the enzyme; (3) Add RCA buffer containing manganese ions, RCA primers and dNTPs to the reaction solution of step (2) to obtain RCA reaction solution. Heat at 80~95℃ for 2~10 min, then cool to room temperature, add excess Super Phi29 DNA polymerase, and perform rolling circle amplification reaction at 40~45℃ for 0.5~2 h. Then inactivate the enzyme and assemble at room temperature for 5~15 hours to form electroactive DNA-manganese complex particles. (4) Disperse the DNA-manganese complex particles obtained in step (3) in the electrode loading solution, add them to the surface of the working electrode and dry them, connect to the electrochemical workstation, use cyclic voltammetry to detect them, record the peak current intensity, and realize the quantitative detection of total viable bacteria by the quantitative relationship between peak current intensity and bacterial concentration.

2. The electrochemical detection method according to claim 1, characterized in that, The sample solution to be tested mentioned in step (1) is a sample solution obtained by collecting live bacteria in bioaerosol using a sampler.

3. The electrochemical detection method according to claim 1, characterized in that, The crushing method described in step (1) includes ultrasonic crushing; the specific process of ultrasonic crushing is as follows: ultrasonic crushing for 20~40 s, freezing in ice for 1~3 min, and repeating this operation 3~10 times.

4. The electrochemical detection method according to claim 1, characterized in that, The nucleotide sequence of the linear single-stranded DNA described in step (2) is shown in SEQ ID NO.

1.

5. The electrochemical detection method according to claim 1, characterized in that, The T4 DNA ligase buffer in step (2) consists of the following components: 350-450 mM Tris-HCl, 50-150 mM MgCl2, 50-150 mM DTT, and pH 7.5-8.

0.

6. The electrochemical detection method according to claim 1, characterized in that, In step (2), the test solution and 5' phosphorylated linear single-stranded DNA ( L The volume ratio of DNA (0.5~2 μM), T4 DNA ligase buffer, and T4 DNA ligase (0.01~0.1 U / μL) is 5~15:3~5:1~3:0.5~2.

7. The electrochemical detection method according to claim 1, characterized in that, The nucleotide sequence of the RCA primer described in step (3) is shown in SEQ ID NO.

2.

8. The electrochemical detection method according to claim 1, characterized in that, The composition of the RCA reaction solution in step (3) is as follows: 40~60 mM Tris-HCl, 5~15 mM (NH4)2SO4, 0.5~5 mM DTT, 5~10 mM MnSO4, 0.5~5 mM dNTPs, and 100~300 pmol RCA primers.

9. The electrochemical detection method according to claim 1, characterized in that, The working electrode mentioned in step (4) is a glassy carbon electrode, and the electrode loading solution consists of: 2~4 mg acetylene black, 0.4~0.6 mL ultrapure water, 0.5~1.5 mL 2-propanol and 0.05~0.5 mL 5% Nafion. ® Solution.

10. The electrochemical detection method according to claim 1, characterized in that, The detection conditions for the cyclic voltammetry described in step (4) are: potential range of 0 ~ 0.8 V (relative to Ag / AgCl), and scan rate of 10 ~ 30 mV / s.

Images