Use of tgme49_219828 protein in preparation of diagnostic kit for toxoplasma gondii

Abstract

The application discloses application of a TGME49_219828 protein in preparation of a toxoplasma gondii diagnostic kit and belongs to the technical field of biological medicines. The amino acid sequence of the protein is shown as SEQ ID NO:1, the protein can specifically react with cat serum undergoing toxoplasma gondii sexual reproduction, and therefore can be used for detecting a toxoplasma gondii sexual reproduction infection stage of a cat. An indirect ELISA detection kit and a detection method based on the TGME49_219828 protein are established, the method has high sensitivity and strong specificity, and can be used for evaluating occurrence of toxoplasma gondii sexual reproduction in a cat population and environmental pollution risk.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to the application of TGME49_219828 protein in the preparation of Toxoplasma gondii diagnostic kits, especially a kit for detecting the sexual reproductive stage of Toxoplasma gondii infection in cats. Background Technology

[0002] Toxoplasma gondii is an obligate intracellular parasitic protozoan that infects almost all warm-blooded animals, including humans, causing toxoplasmosis. The disease is particularly severe in immunocompromised individuals and pregnant women, leading to encephalitis, retinitis, and congenital malformations. In livestock farming, toxoplasmosis infection is a major cause of abortion in pregnant animals, resulting in significant economic losses.

[0003] Felines are the only definitive host for Toxoplasma gondii. Toxoplasma gondii completes sexual reproduction solely within the cat's intestines, forming oocysts which are then excreted in feces. These excreted oocysts sporulate in the external environment and become highly infectious, spreading to intermediate hosts via water, food, and other routes—a crucial link in the transmission and spread of Toxoplasma gondii. Therefore, accurately identifying whether Toxoplasma gondii in a cat has undergone sexual reproduction is of great significance for assessing environmental pollution risks, guiding the scientific management of cat populations, and interrupting the Toxoplasma gondii transmission chain.

[0004] Currently, methods for detecting Toxoplasma gondii infection mainly include traditional etiological detection, molecular biological detection, and serological detection. Etiological detection (such as fecal microscopy) allows direct observation of oocysts, but this method has low sensitivity and can only detect cats that are currently shedding oocysts, not those that have finished. Molecular biological detection (such as PCR) amplifies Toxoplasma gondii-specific DNA sequences, and while highly sensitive, it suffers from limitations in sampling timing, complex operation, and high equipment requirements, and similarly only reflects the transient oocyst shedding state. Serological detection can determine whether a cat is infected with Toxoplasma gondii, but current serological methods cannot distinguish whether the Toxoplasma gondii in the cat has undergone sexual reproduction. Existing studies have shown that even if Toxoplasma gondii antibodies are present in a cat, it may ooze oocysts again due to decreased immune pressure or co-infection with other diseases (such as coccidiosis). Therefore, relying solely on infection status or transient oocyst shedding detection is insufficient to meet the needs of precise Toxoplasma gondii control.

[0005] In recent years, research on genes related to sexual reproduction in *Toxoplasma gondii* has gradually attracted attention. Transcriptomic data show that some genes are specifically highly expressed in the merozoites of *Toxoplasma gondii* and the intestinal epithelium of cats, which may be closely related to sexual reproduction. Among them, the TGME49_219828 protein (NCBI accession number XP_018634785.1) contains an HMG (high mobility group) domain. Such proteins play important roles in mammalian sex determination (such as the SRY factor) and sexual reproduction in *Plasmodium*, but their function in the sexual reproduction of *Toxoplasma gondii* has not yet been explored and utilized.

[0006] In summary, developing a serological detection method that can specifically identify whether Toxoplasma gondii in cats undergoes sexual reproduction is of significant public health and veterinary clinical importance. This invention, based on the TGME49_219828 protein, establishes for the first time an indirect ELISA detection method (Tg219828-iELISA), which can be used to assess the occurrence of sexual reproduction of Toxoplasma gondii in cat populations, providing an effective tool for assessing the environmental pollution risk of Toxoplasma gondii and for the scientific management of cat populations. Summary of the Invention

[0007] The purpose of this invention is to provide an application of the TGME49_219828 protein in the preparation of a Toxoplasma gondii diagnostic kit, in order to solve the problem that existing Toxoplasma gondii detection methods cannot distinguish whether a cat has undergone sexual reproduction. This invention also provides a detection method based on the TGME49_219828 protein.

[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution: The application of TGME49_219828 protein in the preparation of Toxoplasma gondii diagnostic kits, wherein the amino acid sequence of TGME49_219828 protein is shown in SEQ ID NO:1.

[0009] Furthermore, the nucleotide sequence of the gene encoding the TGME49_219828 protein is shown in SEQ ID NO:2.

[0010] Furthermore, the kit is an indirect ELISA kit for detecting the sexual reproductive stage of Toxoplasma gondii infection in cats.

[0011] Furthermore, the indirect ELISA detection kit includes: a solid-phase carrier coated with TGME49_219828 protein; enzyme-labeled secondary antibody; blocking solution; chromogenic solution; stop solution; and washing solution.

[0012] A method for detecting Toxoplasma gondii sexual reproduction-related antibodies for non-diagnostic purposes, comprising the following steps: (1) Using the TGME49_219828 protein as the coating antigen, a solid-phase carrier is coated; (2) Add sealing solution to seal; (3) Add diluted cat serum sample to be tested and incubate to allow the antibodies in the sample to bind specifically to the antigen; (4) Add diluted enzyme-labeled secondary antibody and incubate; (5) Add colorimetric solution to carry out the colorimetric reaction; (6) Add a stop solution to terminate the reaction; (7) Read the absorbance value at 630 nm to determine whether there are Toxoplasma gondii sexual reproduction-related antibodies in the sample.

[0013] Furthermore, the coating concentration of the TGME49_219828 protein is 0.5 μg / mL, and the dilution factor of the cat serum sample to be tested is 1:400.

[0014] Furthermore, the sealing liquid is 5% skim milk powder, and the sealing conditions are 37°C for 90 minutes.

[0015] Furthermore, the enzyme-labeled secondary antibody is HRP-labeled rabbit anti-cat IgG, and the dilution factor of the enzyme-labeled secondary antibody is 1:3000.

[0016] Furthermore, the incubation time is 30 minutes.

[0017] Furthermore, the color developing solution is TMB color developing solution, and the color developing conditions are 37°C and light-protected for 5 minutes.

[0018] Furthermore, the terminating solution is a 0.25% hydrofluoric acid solution.

[0019] Furthermore, the judgment criterion is: calculate the sample S / N value = sample OD. 630 / Negative control OD 630 If S / N ≥ 3.035, it indicates the presence of Toxoplasma gondii sexual reproduction-related antibodies in the sample; if S / N < 3.035, it indicates the absence of Toxoplasma gondii sexual reproduction-related antibodies in the sample.

[0020] The beneficial effects of this invention are: This invention marks the first discovery that the TGME49_219828 protein can specifically recognize antibodies induced by the sexual reproduction stage of Toxoplasma gondii. This protein can be used to distinguish whether Toxoplasma gondii in cats has undergone sexual reproduction. The established Tg219828-iELISA detection method exhibits high sensitivity, strong specificity, good reproducibility, and excellent stability. This invention can be used for monitoring Toxoplasma gondii transmission, such as assessing the occurrence of sexual reproduction in cat populations, evaluating the risk of Toxoplasma gondii environmental contamination, and guiding the scientific management of cat populations, providing an effective tool for Toxoplasma gondii control. Attached Figure Description

[0021] Figure 1 Agarose gel electrophoresis image of PCR amplification products of the TGME49_219828 gene. M: DNA molecular weight standard; 1: PCR product, with a specific band appearing at 294 bp.

[0022] Figure 2 Electrophoresis image of bacterial culture PCR identification of recombinant plasmid pET28a-219828. M: DNA molecular weight standard; 1: positive clone, amplified target band.

[0023] Figure 3 SDS-PAGE analysis of TGME49_219828 recombinant protein induced expression. M: Protein molecular weight standard; Lane 1: Uninduced His-219828; Lane 2: Supernatant of induced His-219828; Lane 3: Precipitated His-219828.

[0024] Figure 4 SDS-PAGE analysis of the purified TGME49_219828 recombinant protein. M: Protein molecular weight standard; 1: Purified TGME49_219828 protein, shown as a single target band.

[0025] Figure 5 Western blot analysis results of TGME49_219828 protein with different cat sera. A: Oocyst-positive cat serum (having undergone sexual reproduction); B: Oocyst-negative cat serum (not having undergone sexual reproduction); C: Toxoplasma gondii-negative cat serum. The results show that TGME49_219828 protein reacts only with oocyst-positive cat serum.

[0026] Figure 6 The effect of different blocking solutions and concentrations on the P / N value of Tg219828-iELISA. The horizontal axis represents the type and concentration of blocking solution, and the vertical axis represents the P / N value. 5% skim milk powder had the highest P / N value.

[0027] Figure 7 The effect of different blocking times on the P / N value detected by Tg219828-iELISA. The horizontal axis represents the blocking time (min), and the vertical axis represents the P / N value. The P / N value reaches its peak after 90 min of blocking.

[0028] Figure 8 The effect of different primary antibody incubation times on the P / N value detected by Tg219828-iELISA. The horizontal axis represents the primary antibody incubation time (min), and the vertical axis represents the P / N value. The P / N value was highest at 30 min of incubation.

[0029] Figure 9The effect of different secondary antibody dilutions on the P / N value detected by Tg219828-iELISA. The horizontal axis represents the secondary antibody dilution factor, and the vertical axis represents the P / N value. The P / N value was optimal at a dilution of 1:3000.

[0030] Figure 10 The effect of different secondary antibody incubation times on the P / N value detected by Tg219828-iELISA. The horizontal axis represents the secondary antibody incubation time (min), and the vertical axis represents the P / N value. The P / N value was highest at 30 min of incubation.

[0031] Figure 11 The effect of different color development times on the P / N value detected by Tg219828-iELISA. The horizontal axis represents the color development time (min), and the vertical axis represents the P / N value. The optimal P / N value was achieved with a color development time of 5 min.

[0032] Figure 12 Stability analysis results of the Tg219828-iELISA assay. The changes in P / N values ​​of the coated enzyme-labeled strips after storage at 37℃ (A) and 4℃ (B) for different times (0–7 days) were compared. The results showed that the stability at 4℃ was better than that at 37℃. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions or conditions described in reference books such as *Molecular Cloning: A Laboratory Guide* (New York: Cold Spring Harbor Laboratory, 1989), or according to the methods recommended in the manufacturer's operating manual.

[0034] Example 1: Preparation of TGME49_219828 recombinant protein This embodiment aims to express and purify the Toxoplasma gondii TGME49_219828 protein in prokaryotes as an antigen for subsequent vaccine preparation.

[0035] 1.1 Total DNA extraction from Toxoplasma gondii tachyzoites Total DNA was extracted from tachyzoites of Toxoplasma gondii strain ME49 using a kit from Novizan. After collecting tachyzoites from Toxoplasma gondii strain ME49, centrifuging and discarding the supernatant, 200 μL of GA buffer and 20 μL of proteinase K solution were added, mixed well, and then 200 μL of GB buffer was added. The mixture was incubated at 70°C for 10 min. 200 μL of anhydrous ethanol was added, and the mixture was vortexed and transferred to an adsorption column. The column was centrifuged at 12000 rpm for 60 s. The cells were washed sequentially with 500 μL of GD buffer and 600 μL of PW buffer, and finally eluted with 50 μL of ddH2O. The total DNA concentration and purity were determined using a UV spectrophotometer.

[0036] 1.2 Amplification of the Target Fragment and Vector Primers were designed based on the TGME49_219828 gene sequence (NCBI accession number XP_018634785.1): Upstream primer (219828-F): CAAATGGGTCGCGGATCCATGGCACCGAAGAAGGTGAC (SEQ ID NO: 3) Downstream primer (219828-R): GGTGGTGGTGGTGCTCGAGTTTCTTCTTGTTGTAGAGAGACATTTCACG (SEQ ID NO: 4) Using extracted Toxoplasma gondii DNA as a template, PCR amplification was performed using Phanta Max Super-Fidelity DNA polymerase. The PCR reaction mixture (50 μL) consisted of: 2 μL cDNA template, 2 μL each of forward and reverse primers, 1 μL dNTP mix, 25 μL 2×PhantaMax Buffer, 1 μL polymerase, and ddH2O to a final volume of 50 μL. The reaction program was: 95℃ pre-denaturation for 5 min; 35 cycles (95℃ denaturation for 15 s, 57℃ annealing for 15 s, 72℃ extension for 30 s); and 72℃ final extension for 10 min. The PCR products were detected by agarose gel electrophoresis, and a specific band was obtained at 294 bp, consistent with the expected size. Figure 1 Simultaneously, the pET28a vector was amplified, yielding a 5369bp fragment.

[0037] 1.3 Target Fragment Recovery Using the Novizan DNA Agarose Gel Extraction Kit, the target band was excised, and an equal volume of sol was added. The gel was incubated at 55°C until completely melted. The melted liquid was added to the extraction column, centrifuged at 12000 rpm for 1 min, and washed sequentially with 300 μL GDP and 650 μL GW. Finally, the DNA was eluted with 30 μL of preheated sterile water.

[0038] 1.4 Construction of the pET28a-219828 recombinant plasmid The TGME49_219828-CDS fragment was ligated to the pET28a vector using homologous recombination. The ligation system (10 μL) consisted of 2 μL of 5×CE MultiS buffer, appropriate amounts of linearized vector and insert fragment, 1 μL of Exnase™ Multis, and ddH2O to a final volume of 10 μL. After incubation at 37°C for 30 min, the ligation product was transformed into *E. coli* DH5α competent cells and plated onto cells containing kanamycin (Kanamycin). + LB agar plates were incubated overnight at 37°C. Single colonies were picked for PCR identification. Figure 2 After the positive clones were expanded and cultured, plasmids were extracted and sequenced for verification. The sequencing results showed a complete match with the CDS sequence of TGME49_219828, with no frameshift or mutation, indicating that the recombinant expression plasmid pET28a-219828 was successfully constructed.

[0039] 1.5 Construction and Protein Expression of TGME49_219828 Expression Bacterium The correctly sequenced recombinant plasmid was transformed into E. coli BL21(DE3) competent cells and plated on Kana. + LB plates were incubated overnight at 37°C. Single colonies were picked for optimization of induction expression conditions: IPTG concentrations were set at 0.2, 0.5, 0.8, and 1.0 mmol / L, and induction was performed at 37°C for 4 h. SDS-PAGE analysis showed that under the conditions of 0.8 mmol / L IPTG and 37°C induction for 4 h, a clear protein band appeared around 15.6 kDa, and it mainly existed in the supernatant in a soluble form. Figure 3 ).

[0040] 1.6 Purification of TGME49_219828 protein The bacterial cells were collected by centrifugation of 1 L of induced expression culture, resuspended, and then disrupted 5 times at 4℃ and 1000 bar. The supernatant was separated by centrifugation at 7000 rpm for 40 min. The supernatant was filtered through a 0.45 μm filter and bound to a nickel column at 4℃ for 30 min. The supernatant was washed sequentially with His Binding Buffer and eluted with a gradient of 20–1000 mmol / L imidazole. The eluted product was dialyzed against PBS, and SDS-PAGE analysis showed that high-purity target protein was obtained. Figure 4 Protein concentration was determined using the BCA method and stored at -80℃ for later use.

[0041] Example 2: Verification of the sexual reproduction recognition ability of the TGME49_219828 protein in Toxoplasma gondii To assess whether the TGME49_219828 protein can specifically recognize antibodies produced by Toxoplasma gondii during the sexual reproduction stage, this study prepared infected serum from cats that had undergone sexual reproduction and those that had not, and detected them using Western blotting.

[0042] First, two serologically negative Toxoplasma gondii cats were selected and orally administered Toxoplasma gondii DB#3 genotype cysts. Fecal samples were collected daily after infection, and microscopic examination revealed no Toxoplasma gondii oocysts. Further tissue samples were collected from the heart, liver, spleen, lungs, kidneys, brain, and intestines. PCR amplification of the 529 bp repeat sequence of Toxoplasma gondii was performed, and specific bands were amplified in all tissue samples, confirming successful infection of both cats with the Toxoplasma gondii DB#3 strain. Since no oocysts were detected after infection, it indicates that Toxoplasma gondii only completed asexual reproduction in these cats and did not enter the sexual reproduction stage. Serum from these two cats was collected and named oocyst-negative cat serum (i.e., serum from Toxoplasma gondii-positive cats that did not undergo sexual reproduction). Serum from cats confirmed to have undergone sexual reproduction and expelled oocysts was collected as oocyst-positive cat serum, and the Toxoplasma gondii-negative cat serum served as a negative control.

[0043] Using recombinant TGME49_219828 protein as an antigen, Western blot analysis was performed with the above three types of serum. Results are as follows: Figure 5 As shown, the TGME49_219828 protein only exhibits a specific immune response with oocyst-positive cat serum, but does not react with oocyst-negative cat serum or Toxoplasma gondii-negative cat serum.

[0044] These results indicate that the TGME49_219828 protein can specifically recognize antibodies induced by the sexual reproduction stage of Toxoplasma gondii, and can be used to distinguish whether Toxoplasma gondii in cats has undergone sexual reproduction.

[0045] Example 3: Establishment of the Tg219828-iELISA detection method This embodiment aims to establish an indirect ELISA method (hereinafter referred to as Tg219828-iELISA) using recombinant TGME49_219828 protein as an antigen, for detecting specific antibodies against the sexual reproductive stage of Toxoplasma gondii in cat serum, and to systematically optimize various reaction conditions.

[0046] 1. Optimization of various testing conditions (1) Optimization of antigen coating concentration and serum dilution factor The TGME49_219828 protein was diluted with carbonate coating buffer (pH 9.6) to 0.25, 0.5, 1, 2, 4, 6, 8, and 16 μg / mL, respectively, and coated onto microplates. Toxoplasma gondii-positive and negative cat serum were added at dilutions of 1:25, 1:50, 1:100, 1:200, 1:400, and 1:800, respectively, and the P / N ratio (positive OD) was measured under each condition. 630 / Negative OD 630 The results showed that the P / N ratio was highest when the antigen coating concentration was 0.5 μg / mL and the serum dilution was 1:400, which was determined to be the optimal reaction condition.

[0047] (2) Optimization of sealing solution, sealing concentration and sealing time Under optimized conditions, 0.1%, 0.5%, 1%, 2%, and 5% BSA and 1%, 3%, 5%, 10%, and 20% skim milk powder were used for sealing. The results showed that 5% skim milk powder had the best sealing effect. Figure 6 Further closure times were set to 30, 45, 60, 75, 90, 105, and 120 minutes. The results showed that the P / N value was highest when the closure time was 90 minutes. Figure 7 Therefore, 5% skim milk powder and sealing at 37℃ for 90 minutes were selected as the optimal sealing conditions.

[0048] (3) Optimization of primary antibody incubation time, secondary antibody dilution concentration and incubation time The primary antibody incubation time was set to 15, 30, 45, 60, and 75 min, and the P / N value was measured. The results showed that the best detection effect was obtained after an incubation of 30 min. Figure 8 Subsequently, the HRP-labeled rabbit anti-cat IgG secondary antibody was diluted at ratios of 1:1000, 1:2000, 1:3000, 1:4000, 1:5000, and 1:6000, respectively, and the optimal dilution was determined to be 1:3000. Figure 9 Further, the incubation time for the secondary antibody was set to 15, 30, 45, 60, and 75 minutes. The results showed that 30 minutes was the optimal incubation time. Figure 10 ).

[0049] (4) Optimization of color development time The color development times were set to 3, 5, 10, 15, 20, 25, and 30 minutes, and the P / N value was measured. The results showed that the P / N value was highest at 5 minutes of color development. Figure 11 This was determined to be the optimal color development time.

[0050] 2. Determination of the cutoff value for the Tg219828-iELISA detection method Twenty-five MAT-negative cat serum samples were tested using the optimized Tg219828-iELISA method, with positive, negative, and blank controls set up simultaneously. The OD values ​​of the 25 serum samples were then analyzed. 630 The S / N value for each sample was calculated, as shown in Table 1. The final cutoff value for this method was determined to be mean (X) + 3 standard deviations (SD) = 3.035. The judgment criterion was that S / N ≥ 3.035 was considered positive, and otherwise negative.

[0051] Table 1. OD values ​​of 25 Toxoplasma gondii-negative cat serum samples 630 and S / N value

[0052] In summary, the specific steps of the Tg219828-iELISA detection method are as follows: Dilute TGME49_219828 protein to a final concentration of 0.5 μg / mL with carbonate coating buffer (pH 9.6), coat ELISA plates, 100 μL / well, and incubate overnight at 4°C. Wash each well three times with 180 μL of washing buffer, and block with 5% skim milk powder at 37°C for 90 min. After washing three times with washing buffer, add 100 μL of test serum and positive / negative control serum diluted 1:400 with 0.1% BSA to each well, with three replicates per sample, and incubate at 37°C for 30 min. Then wash three times with washing buffer, add 100 μL / well of HRP-labeled rabbit anti-cat IgG diluted 1:3000, and incubate at 37°C for 30 min. Then wash 5 times with washing buffer, add 100 μL of chromogenic solution (substrate buffer: TMB stock solution = 1:19, 0.2 μL / mL 30% hydrogen peroxide) to each well, and incubate at 37℃ in the dark for 5 min. Finally, add 50 μL of 0.25% hydrofluoric acid to each well to stop the reaction, and read the value at 630 nm. If sample S (sample OD) is... 630 ) / N (negative serum OD) 630 A value ≥ 3.035 is considered positive; otherwise, it is considered negative.

[0053] Example 4: Performance evaluation of the Tg219828-iELISA detection method 1. Sensitivity analysis of the Tg219828-iELISA detection method Two serum samples from cats positive for Toxoplasma gondii oocysts were serially diluted at dilution ratios ranging from 1:25 to 1:800. The diluted serum was then detected using the optimized Tg219828-iELISA method. The results showed that even at a serum dilution of 1:200, the sample remained detectable (see Table 2). This indicates that the Tg219828-iELISA method has good sensitivity, greater than 1:200.

[0054] Table 2. Sensitivity analysis results of the Tg219828-iELISA detection method

[0055] Note: The data outside the parentheses in the table are OD630 values, and the data inside the parentheses are S / N values.

[0056] 2. Specificity analysis of the Tg219828-iELISA detection method This detection method was used to test feline serum samples positive for different pathogens, and all these serum samples were negative for Toxoplasma gondii according to the MAT test. The results showed that the Tg219828-iELISA did not cross-react with feline coccidia and feline panleukopenia virus, as shown in Table 3. This indicates that the method has good specificity.

[0057] Table 3. Specificity analysis results of the Tg219828-iELISA detection method

[0058] 3. Repeatability analysis of the Tg219828-iELISA detection method Intra-assay assays were performed using ELISA plates coated with the same batch of TGME49_219828, while inter-assay assays were performed using three batches of TGME49_219828-coated strips. Both intra-assay and inter-assay assays tested four Toxoplasma gondii-negative cat sera, with nine replicates per serum sample. Results showed that the coefficients of variation for both intra-assay and inter-assay assays were less than 10%, as shown in Table 4, indicating that the Tg219828-iELISA has good reproducibility.

[0059] Table 4. Repeatability analysis results of the Tg219828-iELISA detection method

[0060] 4. Stability analysis of the Tg219828-iELISA detection method The enzyme-labeled strips coated with 0.5 μg / mL Tg_219828 were blocked and placed in an oven at 37°C and a refrigerator at 4°C, respectively, with random sampling every 24 hours. The results showed that the strips placed at 37°C were still detectable on day 6, but the P / N value had already decreased significantly on day 1; while the strips placed at 4°C were still detectable on day 7, and the P / N value was relatively stable. Figure 12 This indicates that the TGME49_219828 protein exhibits good stability at 4°C.

[0061] In summary, the Tg219828-iELISA detection method can be used to specifically detect whether Toxoplasma gondii in cats has undergone sexual reproduction, and it has the advantages of high sensitivity, strong specificity, good repeatability, and good stability.

Claims

1. Application of TGME49_219828 protein in the preparation of Toxoplasma gondii diagnostic kits, wherein the amino acid sequence of the TGME49_219828 protein is shown in SEQ ID NO:

1.

2. The application as described in claim 1, characterized in that, The nucleotide sequence of the gene encoding the TGME49_219828 protein is shown in SEQ ID NO:

2.

3. The application as described in claim 1, characterized in that, The kit is an indirect ELISA kit for detecting the sexual reproductive stage of Toxoplasma gondii infection in cats.

4. The application according to claim 3, characterized in that, The indirect ELISA detection kit includes: a solid-phase carrier coated with TGME49_219828 protein; enzyme-labeled secondary antibody; blocking solution; chromogenic solution; stop solution; and washing solution.

5. A method for detecting Toxoplasma gondii sexual reproduction-related antibodies for non-diagnostic purposes, characterized in that, Includes the following steps: (1) Using the TGME49_219828 protein described in claim 1 as the coating antigen, a solid-phase carrier is coated; (2) Add sealing solution to seal; (3) Add diluted cat serum sample to be tested and incubate to allow the antibodies in the sample to bind specifically to the antigen; (4) Add diluted enzyme-labeled secondary antibody and incubate; (5) Add colorimetric solution to carry out the colorimetric reaction; (6) Add a stop solution to terminate the reaction; (7) Read the absorbance value at 630 nm to determine whether there are Toxoplasma gondii sexual reproduction-related antibodies in the sample.

6. The method according to claim 5, characterized in that, The coating concentration of the TGME49_219828 protein was 0.5 μg / mL, and the dilution factor of the cat serum sample to be tested was 1:

400.

7. The method according to claim 5, characterized in that, The sealing solution is 5% skim milk powder, and the sealing conditions are 37°C for 90 minutes.

8. The method according to claim 5, characterized in that, The enzyme-labeled secondary antibody is HRP-labeled rabbit anti-cat IgG, and the dilution ratio of the enzyme-labeled secondary antibody is 1:3000.

9. The method according to claim 5, characterized in that, The colorimetric solution is TMB colorimetric solution, and the colorimetric conditions are 37°C and light-protected for 5 minutes.

10. The method according to claim 5, characterized in that, The judgment criteria are as follows: calculate the sample S / N value = sample OD630 / negative control OD630. If S / N ≥ 3.035, it indicates that there are Toxoplasma gondii sexual reproduction-related antibodies in the sample. If S / N < 3.035, it indicates that there are no Toxoplasma gondii sexual reproduction-related antibodies in the sample.

Images