Ionizable cationic lipid compounds for use in delivery systems and uses thereof

Abstract

The present disclosure relates to novel lipids for delivering one or more biologically active molecules to a subject. The present application also relates to compositions or nanoparticles comprising the lipids, methods of making the lipids, uses of the lipids, and methods of using the lipids.

Description

Invention Field

[0001] This disclosure pertains to the field of drug delivery. Specifically, this application relates to novel lipid compounds and nanoparticles comprising said lipid compounds for delivering one or more bioactive agents to a subject. Methods for preparing and using said lipid compounds and nanoparticles are also provided, as well as uses of said lipid compounds and nanoparticles.

[0002] sequence list

[0003] This disclosure includes a sequence list that is part of the disclosure. Background of the Invention

[0004] Nucleic acid-based therapeutics hold immense potential for therapeutic applications. These therapeutic nucleic acids include messenger RNA (mRNA), antisense oligonucleotides, siRNA, miRNA, ribozymes, guide RNA, deoxyribozymes, plasmids, plasmid-based interfering nucleic acids, closed-terminal DNA, and aptamers. Currently, various types of nucleic acids are being developed as therapeutics for a wide range of diseases.

[0005] Certain nucleic acids, such as mRNA, plasmids, and closed-terminal DNA, can be used to express specific proteins or enzymes, which is useful in treating monogenic diseases, such as those associated with deficiency or dysfunction of that protein or enzyme. Nucleic acids encoding pathogen antigens (including mRNA and DNA) can be used as vaccines to prevent infectious diseases, such as COVID-19. Nucleic acids encoding one or more neoantigens can be used as tumor vaccines, which can effectively activate the body's immune system to kill tumor cells, making personalized immunotherapy based on tumor neoantigens a new direction in the development of personalized tumor immunotherapy.

[0006] Other nucleic acids can downregulate or upregulate the intracellular levels of specific mRNAs, thereby affecting the expression of specific cellular proteins. Such nucleic acids (e.g., siRNAs and miRNAs) have extremely broad therapeutic applications. Targets can include mRNAs associated with disease states (e.g., tumor suppressor factors) and mRNAs of infectious pathogens. Antisense oligonucleotide constructs have shown the ability to specifically downregulate target proteins by degrading the corresponding mRNAs. Nucleic acids such as miRNA inhibitors are useful in treating diseases associated with protein or enzyme deficiencies.

[0007] While nucleic acid-based therapeutics hold immense potential, efficient delivery of these molecules to the appropriate sites within cells or organisms is a prerequisite for realizing this potential. Nucleic acid delivery in biological systems presents numerous challenges in achieving the desired effects. RNA molecules are readily degraded by nucleases in plasma and have extremely short half-lives. Furthermore, due to their unique molecular properties, nucleic acids cannot permeate cell membranes. Consequently, these molecules are virtually unable to enter intracellular compartments containing the relevant translational mechanisms. Therefore, naked nucleic acids are generally considered unsuitable for drug development. Improving nucleic acid delivery vectors is crucial for these molecules to realize their therapeutic potential.

[0008] Nanoscale delivery carriers, including lipid and polymer nanoparticles, have been used to facilitate cellular uptake of nucleotides and prevent their degradation in the biological environment. Lipid nanoparticles, formed from ionizable cationic lipids and other lipid components (e.g., neutral lipids, cholesterol, PEGylated lipids) and oligonucleotides, have proven to be among the most efficient delivery systems. Cationic lipids are crucial for protecting nucleic acid payloads from degradation and for facilitating intracellular delivery of nucleic acids.

[0009] A variety of structurally diverse cationic lipids have been developed to enhance mRNA delivery. Several research groups have reported that lipids with branched tails are more advantageous for mRNA delivery than linear lipids. Simultaneously, cationic lipids should possess biodegradability, good tolerability, and ease of synthesis. Xu's research group synthesized a library of cationic lipids for in vitro and in vivo mRNA delivery using simple Michael addition chemistry. These lipids contain degradable bonds (e.g., ester and disulfide bonds) and exhibit excellent biocompatibility both in vitro and in vivo. Unmet needs remain: cationic lipids with the aforementioned properties are required for the preparation of lipid nanoparticles for delivering therapeutic or preventative oligonucleotides. Invention Overview

[0010] The inventors have developed a novel cationic lipid with a thioether-bonded branched tail, which can be formed in vitro and in vivo into nanoparticles for intracellular delivery of bioactive agents (e.g., mRNA, ceDNA, gRNA).

[0011] In one aspect, this disclosure provides a lipid having formula (I), or a salt, tautomer, or stereoisomer thereof.

[0012] Wherein: m and n are each independently selected from any integer between 3 and 12; p is selected from any integer between 1, 2, or 3, and the sum of m and p is selected from any integer between 6 and 9; o is selected from any integer between 1 and 6; X1 is a bond, -C(O)O-, -OC(O)-, -OC(O)O-, or a biodegradable group; R1 is a group containing a hydrogen bond donor or a hydrogen bond acceptor group; the two R2 are the same and are selected from C1-C16 Alkyl, substituted C1-C 16 Alkyl, C2-C 16 Alkenyl, substituted C2-C 16 alkenyl, C3-C 12 Cycloalkyl, substituted C3-C 12 Cycloalkyl groups and combinations thereof; R3 is selected from C4-C6. 22 Alkyl, substituted C4-C 22 Alkyl, C4-C 22 alkenyl, substituted C4-C 22 alkenyl, C3-C 12 Cycloalkyl, substituted C3-C 12 Cycloalkyl groups and combinations thereof; or disulfides in which R3 has the following structure Two of the R4 values ​​are identical and are selected from C1-C. 16 Alkyl, substituted C1-C 16 Alkyl, C2-C 16 Alkenyl, substituted C2-C 16 alkenyl, C3-C 12 Cycloalkyl, substituted C3-C 12 Cycloalkyl groups and their combinations.

[0013] In some embodiments, the lipid of the first aspect has formula (II), or a salt, tautomer, or stereoisomer thereof.

[0014]

[0015] The sum of n and p is selected from any integer between 6 and 9.

[0016] In some embodiments, R1 is selected from hydroxyl, carboxyl, C1-C3 alkylamine, C5-C6 alkylamine, C6 ... 12 heteroaryl, C5-C 12 Heteroaryl ketones, C3-C8 heterocyclic alkanes, C3-C8 heterocyclic ketones, and combinations thereof with carbonyl, amide, imide, sulfinyl, sulfonamide, or sulfonamide groups.

[0017] In some implementations, R1 is selected from one of the following structures:

[0018] , , , , , , , or .

[0019] In some embodiments, each R2 has at least one carbon atom, wherein the hydrogen atom thereon is replaced by one or two side chains; and / or R3 has at least one carbon atom, wherein the hydrogen atom thereon is replaced by one or two side chains.

[0020] In some embodiments, each R2 has at least one carbon atom, wherein the hydrogen atom thereon is replaced by one or two side chains; and / or each R4 has at least one carbon atom, wherein the hydrogen atom thereon is replaced by one or two side chains.

[0021] In some implementations, the carbon atom whose hydrogen atom is replaced by one or two side chains is the second or more distant carbon atom counted from the junction point.

[0022] In some embodiments, the one or two side chains are C1-C4 alkyl.

[0023] In some implementations, each R2, R3, and / or each R4 is independently selected from one of the following structures:

[0024] , , , , , , , , , , , , , , , , , , , , , , or .

[0025] In some embodiments, the lipid is selected from one of the following structures:

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035] In one aspect, this disclosure provides lipid nanoparticles (LNPs) comprising lipids, neutral lipids, polyethylene glycol-lipids, and steroids of this disclosure.

[0036] In some embodiments, the neutral lipid is distearylphosphatidylcholine (DSPC) or dioleoylphosphatidylethanolamine (DOPE).

[0037] In some embodiments, the polyethylene glycol-lipid is polyethylene glycol-dimyristoylglycerol (PEG-DMG).

[0038] In some embodiments, the steroid is cholesterol, sitosterol, or stigmasterol.

[0039] In some embodiments, the molar ratio of the lipids is about 40% to about 60%, the molar ratio of the neutral lipids is about 5% to about 20%, the molar ratio of the polyethylene glycol-lipids is about 0.5% to about 5%, and the molar ratio of the steroids is about 25% to about 50%.

[0040] In some embodiments, the molar ratio of the lipids is about 50%, the molar ratio of the neutral lipids is about 10%, the molar ratio of the polyethylene glycol-lipids is about 1.5%, and the molar ratio of the steroids is about 38.5%.

[0041] In some implementations, the LNP further comprises a nucleic acid molecule.

[0042] In some implementations, the nucleic acid molecule is DNA or RNA.

[0043] In some implementations, the nucleic acid molecule is plasmid DNA or closed-terminal DNA (ceDNA).

[0044] In some embodiments, the nucleic acid molecule is selected from the group consisting of: messenger RNA (mRNA), guide RNA (gRNA), small interfering RNA (siRNA), RNA interference (RNAi) molecules, microRNA (miRNA), antagonistic microRNA, antisense RNA, ribozymes, short hairpin RNA (shRNA), or mixtures thereof.

[0045] In one aspect, this disclosure provides a pharmaceutical composition comprising the LNP of this disclosure and a pharmaceutically acceptable carrier.

[0046] In one aspect, this disclosure provides a method for delivering nucleic acid molecules to cells in vivo or in vitro, comprising contacting the cells with the LNP of this disclosure.

[0047] In one aspect, this disclosure provides a method for treating or preventing a disease in a subject in need, comprising administering to the subject a therapeutically effective amount of the LNP of this disclosure, wherein the LNP comprises a nucleic acid molecule having therapeutic activity.

[0048] In some implementations, the LNP is administered by injection.

[0049] Other aspects and advantages of this disclosure will become apparent to those skilled in the art from the following detailed description, in which only exemplary embodiments of this disclosure are shown and described. It should be understood that this disclosure is capable of other and different implementations, and that several details thereof can be modified in a variety of obvious ways, all without departing from the scope of this disclosure. Therefore, the drawings and description should be considered illustrative in nature and not restrictive.

[0050] Incorporated by reference

[0051] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference in their entirety as if each individual publication, patent or patent application were expressly and individually indicated to be incorporated by reference. Attached Figure Description

[0052] The novel features of the invention are particularly pointed out in the appended claims. The features and advantages of the invention will be better understood by referring to the following detailed description, which sets forth exemplary embodiments employing the principles of the invention, and the accompanying drawings (also referred to herein as “Figures” or “FIG.”), in which:

[0053] Figure 1 The expression levels of GFP mRNA delivered by lipid nanoparticles composed of different lipids of this disclosure are shown in HEK293 cells.

[0054] Figure 2 The expression levels of GFP mRNA delivered by lipid nanoparticles composed of different lipids of this disclosure are shown in HepG2 cells.

[0055] Figure 3 The expression levels of human erythropoietin (hEPO) protein, as detected at 6 and 24 hours post-injection, were shown in mice after administration of lipid nanoparticles with different lipid compositions disclosed herein.

[0056] Detailed description

[0057] Although various embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Many variations, modifications, and substitutions can be made by those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed.

[0058] I. Definition

[0059] As used herein, the term "lipid nanoparticle" or its abbreviation "LNP" refers to a drug carrier with a size in the nanometer range, consisting of a monolayer of lipids. In the context of this application, the term "lipid nanoparticle" also includes "lipid-polymer hybrid nanoparticles," which comprise a lipid portion and a hydrophobic polymer portion.

[0060] The term "lipid" refers to a class of organic compounds that are poorly soluble in water but soluble in nonpolar solvents. Lipids include, but are not limited to, fatty acid esters.

[0061] As used in this article, "cationic lipid" refers to a positively charged amphiphilic molecule consisting of a hydrophilic head group linked to a hydrophobic tail group by a linker. Because of its positive charge, cationic lipids can bind to negatively charged molecules or entities, such as cell membranes.

[0062] The term "polymer-coupled lipid" refers to a molecule that comprises both a lipid moiety and a polymer moiety.

[0063] The term "polyethylene glycol-modified lipid" refers to a molecule that comprises both a lipid portion and a polyethylene glycol portion.

[0064] In the context of LNP, the terms “neutral lipid” or “auxiliary lipid” are used interchangeably to refer to lipids that are uncharged at a selected pH or remain in a neutral zwitterionic form.

[0065] The term "charged lipids" refers to lipids that carry a positive or negative charge.

[0066] As used in this article, "alkyl" refers to a straight-chain or branched saturated hydrocarbon chain free radical consisting only of carbon and hydrogen atoms.

[0067] As used in this article, "alkene" refers to a straight-chain or branched hydrocarbon radical consisting only of carbon and hydrogen atoms, containing one or more double bonds.

[0068] The term "stereoisomer" refers to a compound that consists of identical atoms linked by the same chemical bonds but has different three-dimensional structures.

[0069] The term "tautomer" refers to a structural isomer in which a proton is transferred from one atom of a molecule to another atom of the same molecule.

[0070] In this article, the terms “nucleotide,” “oligonucleotide,” and “nucleic acid” are used interchangeably to refer to the base-sugar-phosphate units that make up a nucleic acid sequence (such as a deoxyribonucleic acid (DNA) sequence or a ribonucleic acid (RNA) sequence).

[0071] In this article, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably to refer to a polymer consisting of at least two amino acid residues linked by one or more peptide bonds.

[0072] As used herein, the term "subject" refers to an individual, preferably a vertebrate, more preferably a non-human mammal or a human. The non-human mammal may be a rodent (e.g., a rat) or a non-human primate (e.g., a monkey). The term "subject" may also include cells, tissues, and their progeny obtained from an in vivo or in vitro culture of a biological entity.

[0073] The phrase “effective amount” or “therapeutic effective amount” refers to an amount of composition (e.g., a composition containing LNP) sufficient to produce the desired activity when delivered to a subject in need. The desired activity may include delaying disease onset, halting or slowing disease progression, or alleviating at least one symptom of the disease.

[0074] II. Ionizable cationic lipids

[0075] This application provides a novel type of ionizable cationic lipid, suitable for the preparation of lipid nanoparticles.

[0076] In some embodiments, the ionizable cationic lipids of this application are compounds having formula (I), or salts, tautomers, or stereoisomers thereof.

[0077]

[0078] Wherein: m and n are each independently selected from any integer between 3 and 12; p is selected from any integer between 1, 2, or 3; o is selected from any integer between 1 and 6; X1 is a bond, -C(O)O-, -OC(O)-, -OC(O)O-, or a biodegradable group; R1 is a group containing a hydrogen bond donor or a hydrogen bond acceptor group; the two R2 are the same and are selected from C1-C 16 Alkyl, substituted C1-C 16 Alkyl, C2-C 16 Alkenyl, substituted C2-C 16 alkenyl, C3-C 12 Cycloalkyl, substituted C3-C 12 Cycloalkyl groups and combinations thereof; R3 is selected from C4-C6.22 Alkyl, substituted C4-C 22 Alkyl, C4-C 22 alkenyl, substituted C4-C 22 alkenyl, C3-C 12 Cycloalkyl, substituted C3-C 12 Cycloalkyl groups and combinations thereof; or disulfides in which R3 has the following structure: Two of the R4 values ​​are identical and are selected from C1-C. 16 Alkyl, substituted C1-C 16 Alkyl, C2-C 16 Alkenyl, substituted C2-C 16 alkenyl, C3-C 12 Cycloalkyl, substituted C3-C 12 Cycloalkyl groups and their combinations.

[0079] In some embodiments, the lipid of the first aspect is a compound having formula (II), or a salt, tautomer, or stereoisomer thereof.

[0080]

[0081] In the structures shown in equations (I) and (II), R1-(CH2) O - The head group of the lipid compound of this application is formed by the central nitrogen atom (N). The head group of the cationic lipid carries a positive charge in an acidic environment, which is crucial for the delivery of nucleic acid payloads because it can interact with the negatively charged phosphate groups of nucleic acids. Unlike double-stranded DNA or siRNA (where only the phosphate backbone is exposed, while the bases face inward), mRNA has a more complex secondary structure, containing single-stranded and double-stranded regions, with some nucleosides exposed to the surrounding environment (e.g., solvents). Therefore, other interactions (e.g., hydrogen bonds) between the head group and the ribose and nucleobases of mRNA may contribute to improved LNP expression. In the structures shown in Formulas (I) and (II), R1 is used to provide a set of hydrogen bond donors and / or acceptors with different hydrogen bond capabilities in the head group.

[0082] The group containing hydrogen bond donors or acceptors may contain nitrogen (N), oxygen (O), carbon (C), or fluorine (F) atoms as hydrogen bond donors or acceptors. Exemplary groups containing hydrogen bond donors or acceptors include, but are not limited to, hydroxyl-containing groups, carboxyl-containing groups, carbonyl-containing groups, amides, imides, sulfoxides, and sulfonamides.

[0083] In some embodiments, R1 is selected from hydroxyl, carboxyl, C1-C3 alkylamine, C5-C6 alkylamine, C6 ... 12 heteroaryl, C5-C 12Heteroaryl ketones, C3-C8 heterocyclic alkanes, C3-C8 heterocyclic ketones, and combinations thereof with carbonyl, amide, imide, sulfinyl, sulfonamide, or sulfonamide groups.

[0084] In a preferred embodiment of this application, R1 is selected from groups represented by the following formula:

[0085] , , , , , , , or .

[0086] In some implementations, the sum of m and p is selected from any integer between 6 and 9.

[0087] In some implementations, the sum of n and p is selected from any integer between 6 and 9. In certain implementations, the sum of m and p and the sum of n and p have the same value, which is selected from the integers 6, 7, 8, or 9.

[0088] In a preferred embodiment, p is 1 and X1 is -C(O)O-.

[0089] In some embodiments, each R2 has at least one carbon atom, wherein the hydrogen atom thereon is replaced by one or two side chains; and / or R3 has at least one carbon atom, wherein the hydrogen atom thereon is replaced by one or two side chains.

[0090] In some embodiments, each R2 has at least one carbon atom, wherein the hydrogen atom thereon is replaced by one or two side chains; and / or each R4 has at least one carbon atom, wherein the hydrogen atom thereon is replaced by one or two side chains.

[0091] In some embodiments, the carbon atom whose hydrogen atom is replaced by one or two side chains is the second or more distant carbon atom counted from the junction point.

[0092] In some embodiments, the one or two side chains are C1-C4 alkyl groups.

[0093] In a preferred embodiment, R2 is a branched alkyl or branched alkenyl group. Hyperbranched structures are preferred in this application because they enhance the cone-shaped morphology, thereby improving intracellular delivery efficiency. Therefore, R2, R3, and R4 are preferably all branched. For example, R2 and / or R3 may have one or more side chains. In a particular embodiment, R2 and R3 are each independently selected from 2-methylhexyl or 2,6-dimethyloctyl.

[0094] In some implementations, each R2, R3, and / or each R4 is independently selected from one of the following formulas:

[0095] , , , , , , , , , , , , , , , , , , , , , , or .

[0096] In some specific embodiments, this disclosure provides compounds of formula (II) or formula (II-I):

[0097]

[0098] Each L is independently non-existent, and C is... 1-10 Alkylene or C 3-7 Cycloalkylene; each R5 and R6 is independently hydrogen, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl and C3-C 12 Cycloalkyl.

[0099] In certain embodiments of either formula (II) or formula (II-I), each -LC(R5)R6 is independently selected from the group consisting of:

[0100]

[0101] The branched tail containing a dialkylthio group can be readily synthesized by coupling R2-SH or R3-SH with an alkynyl group. In some specific embodiments, the intermediate structure containing a dialkylthio group is synthesized via the following reaction:

[0102]

[0103] In some specific embodiments, the lipid compound is selected from any of the following compounds shown below, including compounds 1-27, 41 and 42 having the chemical structure of formula (I), and compounds 28-40 and 43 having the chemical structure of formula (II).

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112] This invention includes the free form of the cationic lipids described herein, as well as their pharmaceutically acceptable salts and stereoisomers. The cationic lipids may be protonated salts of amine cationic lipids. The term "free form" refers to the non-salt form of amine cationic lipids. The free form can be regenerated by treating the salt with a suitable diluted aqueous alkaline solution (e.g., diluted aqueous sodium hydroxide, potassium carbonate, ammonia, and sodium bicarbonate).

[0113] The compounds disclosed herein, or pharmaceutically acceptable salts thereof, may contain one or more stereocenters, thus yielding enantiomers, diastereomers, and other stereoisomers that can be defined by absolute stereochemistry as (R)- or (S)-type, or (D)- or (L)-type for amino acids. This disclosure is intended to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (−), (R)- and (D)-, or (D)- and (L)- isomers can be prepared using chiral synthons or chiral reagents, or resolved by conventional techniques such as chromatography and fractional crystallization. Conventional techniques for preparing / separating single enantiomers include chiral synthesis from suitable chiral pure precursors, or resolution of racemic mixtures (or racemic mixtures of their salts or derivatives) using, for example, chiral high-performance liquid chromatography (HPLC). When the compounds described herein contain a double bond or other geometrically asymmetric center of an alkene, unless otherwise stated, the compounds are intended to include both E-type and Z-type geometric isomers. Similarly, all tautomer forms are intended to be included.

[0114] Pharmaceutically acceptable salts of the cationic lipids of this invention can be synthesized from cationic lipids containing basic or acidic moieties as described herein using conventional chemical methods. Typically, salts of basic cationic lipids can be prepared by ion-exchange chromatography, or by reacting a free base with a stoichiometric or excess amount of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly, salts of acidic compounds are formed by reacting with a suitable inorganic or organic base.

[0115] III. Other lipid components of LNP

[0116] In addition to ionizable cationic lipids, the lipid components included in the LNP of this application also include neutral lipids, polymer-coupled lipids, and steroids. In another embodiment, the lipid components further include charged lipids.

[0117] neutral lipids

[0118] Neutral lipids, such as phospholipids, help LNPs bind and cross the cell membrane. Exemplary neutral lipids include, but are not limited to: distearyl-sn-glycerol-ethanolamine phosphate, distearyl-phosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoylphosphatidylcholine (POPC), palmitoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimide)-cyclohexane-1-carboxylic acid ester (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (e.g., 16-O-monomethylPE), dimethyl-phosphatidylethanolamine (e.g., 1... 6-O-dimethyl PE), 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylcholine (HSPC), methionine phosphatidylcholine (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearate phosphatidylglycerol (DSPG) Disqualyl phosphatidylcholine (DEPC), palmitoyl oleoyl phosphatidylglycerol (POPG), transoleoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysophosphatidyl lecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, methionine (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetylphosphatidylphosphate, lysophosphatidylcholine, dilinoleoyl phosphatidylcholine, or mixtures thereof. It should be understood that other diacylphosphatidylcholines and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably derived from the acyl groups of fatty acids having a C10-C24 carbon chain, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. In various embodiments, the molar ratio of ionizable cationic lipids to neutral lipids is approximately 2:1 to 8:1, preferably 5:1.

[0119] Polymer-coupled lipids

[0120] The polymer-coupled lipid can be polyethylene glycol-modified lipid or polyethylene glycol-lipid. In various embodiments, the polyethylene glycol-lipid is polyethylene glycol-modified diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG); polyethylene glycol-modified phosphatidylethanolamine (PEG-PE); polyethylene glycol succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2′,3′-di(tetradecanoyloxy)propyl)-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG); polyethylene glycol-modified ceramide (PEG-cer); or polyethylene glycol dialkoxypropyl carbamate, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(ω-methoxy(polyethoxy)ethyl)carbamate. In various implementations, the molar ratio of ionizable cationic lipids to polyethylene glycol-modified lipids is approximately 100:1 to 20:1.

[0121] steroids

[0122] The steroid or steroid analogue. In some embodiments, the steroid or steroid analogue is cholesterol, sitosterol, or stigmasterol. In some embodiments, the steroid or steroid analogue is cholesterol. In some embodiments, the steroid or steroid analogue is β-sitosterol. In some embodiments, the steroid or steroid analogue is stigmasterol. In some of these embodiments, the molar ratio of the ionizable cationic lipid to cholesterol is about 5:1 to 1:1, preferably 3:1 to 1:1.

[0123] In a preferred embodiment, the nanoparticles of this disclosure comprise the following components in a molar ratio of 50:10:38.5:1.5 or 40:10:48.5:1.5: (1) cationic lipids of this disclosure, preferably selected from compounds 15-22 and 31-35; (2) neutral lipids selected from DSPC or DOPE; (3) steroids, i.e. cholesterol; and (4) polymer-coupled lipids, i.e. PEG-DMG.

[0124] IV. Nucleic Acid Loading

[0125] The LNP of this application is particularly suitable for delivering nucleic acid molecules into cells.

[0126] The nucleic acid molecule can be DNA or RNA or a mixture thereof, such as a chimeric oligonucleotide. The nucleic acid molecule may contain naturally occurring or modified polynucleotides. The nucleic acid molecule can be a coding sequence or a non-coding sequence. The nucleic acid molecule can be a DNA molecule, such as plasmid DNA, closed-terminal DNA, or a mixture thereof. The nucleic acid molecule can be an RNA molecule, such as messenger RNA (mRNA), guide RNA (gRNA), small interfering RNA (siRNA), RNA interference (RNAi) molecules, microRNA (miRNA), antagonistic microRNA, antisense RNA, ribozymes, short hairpin RNA (shRNA), or a mixture thereof.

[0127] Plasmid DNA or closed-terminal DNA can range in length from 500 to 500,000 base pairs. mRNA can range in length from 200 to 100,000 base pairs. gRNA can range in length from 30 to 1,000 base pairs. siRNA, miRNA, or shRNA can range in length from 15 to 1,000 base pairs.

[0128] The nucleic acid molecule may contain modifications, such as one or more modifications to the backbone, one or more modifications to the bases, and / or one or more modifications to the sugar moiety.

[0129] V. Compound Synthesis

[0130] The compounds disclosed herein can be prepared in a variety of ways, using commercially available starting materials, compounds known in the literature, or readily prepared intermediates, employing standard synthetic methods and procedures known to those skilled in the art or obvious to a person of equal skill in light of the teachings herein. Standard synthetic methods and procedures for the preparation of organic molecules and the transformation and manipulation of functional groups are available from relevant scientific literature or from standard textbooks in the field.

[0131] General reaction scheme

[0132] The following description of the synthetic methods is intended to be illustrative and not to limit the general procedure for the preparation of the compounds disclosed herein. Compounds having the structure of formula (I) in this disclosure can be prepared by steps 1-4 as shown in Scheme 1. Compounds having the structure of formula (II) in this disclosure can be prepared by steps 1-3 as shown in Scheme 1. Those skilled in the art will note that the order of certain steps in the reaction sequences and synthetic schemes described herein can be changed, for example, the introduction and removal of protecting groups.

[0133]

[0134]

[0135]

[0136] X is a reactive group, selected to promote the desired reaction (e.g., halogen). A-1 and A-2 undergo a condensation reaction under suitable conditions (e.g., using EDCI and DMAP) to give product A-3. A-3 reacts with a mercapto group A-4 under suitable conditions (e.g., AIBN, dioxane, and heating) to give A-5. Halogen A-5 then reacts with the primary amine of A-6 under suitable conditions (e.g., heating) to give compound (II) or A-7. A-7 then reacts with another molecule of halide A-5 under suitable conditions (e.g., DIEA and heating) to give compound (I).

[0137] VI. Preparation of Nanoparticles

[0138] Nanoparticles can be prepared through a hybrid process, such as microfluidics and T-tube mixing of two fluid flows, one containing therapeutic and / or preventative substances and the other containing lipid components.

[0139] The lipid compositions are prepared by reconstituted cationic lipids (e.g., lipids of formula (I)), accessory lipids (e.g., DSPC), steroids (e.g., cholesterol), and polyethylene glycol-lipids (e.g., 1,2-dimyristoyl-sn-glycerol methoxy polyethylene glycol, also known as DMG-PEG2000) in ethanol to concentrations of approximately 5 mg / mL and 25 mg / mL. The solutions should be stored refrigerated, for example, at -80 °C.

[0140] Nanoparticle compositions comprising therapeutic and / or preventative substances and lipid components are prepared by mixing a lipid solution with a solution containing the therapeutic and / or preventative substances, wherein the weight ratio of the lipid component to the therapeutic and / or preventative substances is approximately 10:1 to 20:1. The lipid solution is injected into the solution of the therapeutic and / or preventative substances using a microfluidic system at a flow rate of 0.25 mL / min to 2.0 mL / min to produce a suspension with a water to ethanol ratio of approximately 3:1.

[0141] For nanoparticle compositions containing RNA or pDNA, the RNA or pDNA solution is diluted with 50 mM sodium citrate buffer (pH 3 to 4) to form a stock solution with a concentration of 0.1–0.5 mg / mL.

[0142] The nanoparticle composition can be dialyzed to remove ethanol and achieve buffer replacement. The formulation was dialyzed twice with 20 mM Tris-HCl solution (pH 7.4) at 0–4 °C for 2 hours using a Slide-A-Lyzer dialyzer (Thermo Fisher Scientific Inc., Rockford, Ill.), with the dialysate volume approximately 2500 times the initial product volume, resulting in a molecular weight cutoff of 10 kDa. Then, a 40% sucrose solution was added, typically yielding the final nanoparticle composition solution at a concentration of 0.03 mg / mL to 0.1 mg / mL (mRNA or pDNA), and stored at -80 °C.

[0143] VII. Properties of Nanoparticle Compositions

[0144] The physical and chemical properties of the lipid nanoparticles in this application depend on the formulation of LNP.

[0145] For example, the inventors have found that the selection of ionizable cationic lipids significantly affects the particle size of the formulated LNPs. For instance, the average diameter of the lipid nanoparticles is approximately 100 nm to 350 nm, preferably 150 nm to 250 nm. In a particular embodiment, the average diameter of the lipid nanoparticles is approximately 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, or 300 nm.

[0146] The polydispersity index (PDI) is a parameter describing the molecular weight distribution of particles in an LNP formulation. A larger PDI indicates a wider molecular weight distribution. For example, the PDI of this formulation may be from 0.10 to 0.50, preferably from 0.20 to 0.45, and more preferably from 0.05 to 0.30.

[0147] In some embodiments, the lipid nanoparticles are substantially non-toxic or have acceptable toxicity to the subject. For example, the lipid nanoparticles of this application exhibit reduced hepatotoxicity compared to nanoparticles comprising different cationic lipids. Hepatotoxicity can be determined according to methods known in the art.

[0148] The lipid nanoparticles disclosed herein can provide ideal transduction efficiency, which can be determined, for example, by the amount of loading or the expression level. In a preferred embodiment, the lipid nanoparticles of this application provide comparable or higher loading amounts or loading expression levels compared to nanoparticles containing different cationic lipids.

[0149] VIII. Applications

[0150] LNPs, formed from ionizable cationic lipids and loaded with nucleic acid molecules, can have a variety of uses, depending on the type and function of the nucleic acid molecules.

[0151] For example, the LNP can be used to treat a disease or condition. In some embodiments, the disease or condition is caused by a protein deficiency, and the LNP contains a nucleic acid molecule encoding that protein.

[0152] For example, LNPs can be used to prevent diseases or conditions. For example, LNPs can be made into vaccines, wherein the nucleic acid molecules therein encode antigens, such as antigens derived from pathogens (e.g., bacteria, fungi, or viruses), or antigens derived from tumor cells, such as tumor-associated antigens.

[0153] For example, LNPs can treat diseases or conditions by affecting the expression of specific cellular proteins. In some embodiments, LNPs comprise nucleic acids, such as siRNA and microRNAs (miRNAs), which downregulate or upregulate the intracellular levels of target mRNAs associated with disease states. For example, the target mRNA could be the mRNA of a tumor suppressor factor or the mRNA of an infectious pathogen.

[0154] For example, LNPs can be used to treat diseases or conditions by influencing the expression of specific cellular proteins through gene editing. In some embodiments, for treating diseases or conditions caused or associated with a mutation (e.g., a mutation leading to loss of protein function or acquisition of toxicity), LNPs may contain nucleic acid molecules encoding gene editing tools. For example, LNPs can be used to deliver the mRNA and / or guide RNA of a nuclease (e.g., Cas nuclease) for nuclease-mediated gene editing. Example

[0155] The following examples are intended to fully disclose and describe how to make and use the present invention to those skilled in the art, and are not intended to limit the scope of the invention as the inventors believe, nor are they intended to represent all or only the experiments conducted. Every effort has been made to ensure the accuracy of the numerical values ​​used (e.g., dosage, temperature, etc.), but some experimental errors and deviations should still be considered. Unless otherwise stated, parts refer to parts by weight, molecular weight is weight-average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric pressure. Standard abbreviations may be used, such as: bp, base pair; kb, kilobase; pl, picoliter; s or sec, second; min, minute; h or hr, hour; aa, amino acid; nt, nucleotide; im, intramuscular (injection); ip, intraperitoneal (injection); sc, subcutaneous (injection); etc.

[0156] Example 1. Synthesis of the compound

[0157] 1. General Precautions

[0158] Unless otherwise stated, all solvents and reagents used are commercially available products and should be used directly. 1 ¹H NMR spectra were determined in CDCl₃ on a 400 MHz instrument. The chemical shift of ¹H is expressed as parts per million (ppm) relative to TMS (0.00).

[0159] The following methods can be used for the synthesis of compounds 1-43.

[0160] The following abbreviations are used in this article.

[0161] ACN: Acetonitrile

[0162] LAH: Lithium Aluminum Hydrogen

[0163] DCM: Dichloromethane

[0164] DMAP: 4-Dimethylaminopyridine

[0165] DIEA: Diisopropylethylamine

[0166] EDCI: 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide

[0167] PPTS: Pyridonium p-toluenesulfonate

[0168] RT: Room temperature

[0169] THF: Tetrahydrofuran

[0170] TLC: Thin-layer chromatography

[0171] 2. Synthesis of exemplary compounds

[0172] Compound 1: 2,3-bis(heptylthio)propyl 6-[(2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino]hexanoic acid

[0173] Synthesis of prop-2-yn-1-yl 6-bromohexanoate

[0174]

[0175] 6-Bromhexanoic acid (20 g, 103 mmol, 1.0 equivalent) was dissolved in DCM (140 mL). Propan-2-yn-1-ol (8.12 g, 145 mmol, 8.56 mL, 1.41 equivalent), EDCI (29.5 g, 154 mmol, 1.5 equivalent), and DMAP (2.51 g, 20.5 mmol, 0.2 equivalent) were added at 0 °C, and the mixture was then stirred at 25 °C for 1.5 hours. TLC (petroleum ether / ethyl acetate = 5 / 1, product R) was performed. f = 0.45) indicates that the reaction is complete. The reaction mixture was poured into water (50 mL), extracted with EtOAc (50 mL, 30 mL, 20 mL), the combined organic phases were washed with brine (30 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 1 to 0 / 1) to give propionic-2-yn-1-yl 6-bromohexanoate (21 g, 80.4 mmol, 78.4% yield) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ 4.68 (d, J = 6.4 Hz, 2H), 3.41 (t, J = 6.8 Hz, 2H), 2.47 (t, J = 2.4 Hz, 1H), 2.38 (t, J = 7.2 Hz, 2H), 1.87–1.90 (m, 2H), 1.67–1.71 (m, 2H), 1.47–1.51 (m, 2H).

[0176] Synthesis of 2,3-bis(heptylthio)propyl 6-bromohexanoate

[0177]

[0178] Propyl-2-yn-1-yl 6-bromohexanoate (10.5 g, 45.0 mmol, 1.0 equivalent) was dissolved in dioxane (70 mL), and heptane-1-thiol (17.9 g, 135 mmol, 21.2 mL, 3.0 equivalent) was added. The solution was stirred at 25–100 °C for 1 hour, then AIBN (740 mg, 4.50 mmol, 0.1 equivalent) was added, and the mixture was stirred at 100 °C for 12 hours. TLC (petroleum ether / ethyl acetate = 10 / 1, product R) was performed. f= 0.35) indicates that the reaction has been completed. The reaction mixture was concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 50 / 1) to give 20 g (40.1 mmol, 89.2% yield) of 2,3-bis(heptylthio)propyl 6-bromohexanoate, as a yellow oil. 1H NMR (400MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.6 Hz, 1H), 4.25 (dd, J = 6.0, 11.2 Hz, 1H), 3.41 (t, J = 6.8 Hz, 2H), 2.97–3.04 (m, 1H), 2.78 (d, J = 6.8 Hz, 2H), 2.54–2.61 (m, 4H), 2.37 (t, J = 7.2 Hz, 2H), 1.86–1.93 (m, 2H), 1.50–1.72 (m, 9H), 1.25–1.40 (m, 17H), 0.89 (t, J = 6.4Hz, 6H).

[0179] Synthesis of 2,3-bis(heptylthio)propyl 6-[(2-hydroxyethyl)amino]hexanoic acid

[0180]

[0181] 2-Aminoethanol (1.84 g, 30.2 mmol, 1.82 mL, 3.0 equivalent) and 2,3-bis(heptylthio)propyl 6-bromohexanoate (5 g, 10.1 mmol, 1.0 equivalent) were dissolved in MeCN (35 mL) at 25 °C, followed by stirring at 90 °C for 12 hours. TLC (dichloromethane / methanol = 7 / 1, product R) was performed. f = 0.20) indicates that the reaction is complete. The reaction mixture was poured into water (50 mL), extracted with EtOAc (50 mL, 30 mL, 20 mL), the combined organic phases were washed with brine (20 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to dichloromethane / methanol = 5 / 1) to give 2,3-bis(heptylthio)propyl 6-[(2-hydroxyethyl)amino]hexanoic acid (2.6 g, 5.44 mmol, 54.1% yield) as a yellow oil. 1H NMR(400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.6 Hz, 2H), 4.25 (dd, J = 5.2, 11.6 Hz, 2H), 3.52 (t, J = 5.2 Hz, 2H), 2.97–3.03 (m, 2H), 2.78 (d, J = 6.8 Hz, 4H), 2.54–2.62 (m, 10H), 2.45 (t, J = 7.2 Hz, 4H), 2.34 (t, J = 7.2 Hz, 4H), 1.56–1.69 (m, 13H), 1.28–1.46 (m, 41H), 0.89 (t, J = 6.4 Hz, 12H).

[0182] Synthesis of undecyl 6-bromohexanoate

[0183]

[0184] Undecane-1-ol (30.0 g, 174 mmol, 1.0 equivalent) and 6-bromohexanoic acid (50.9 g, 261 mmol, 1.5 equivalent) were dissolved in DCM (180 mL), and DMAP (4.25 g, 34.8 mmol, 0.2 equivalent) and EDCI (50.1 g, 261 mmol, 1.5 equivalent) were added. The reaction was stirred at 20°C for 3 hours. TLC (petroleum ether:ethyl acetate = 10:1, R f =0.51) indicates that undecane-1-ol has been completely consumed. The residue was diluted with saturated sodium carbonate solution (100 mL) and extracted with EtOAc (200 mL × 2). The combined organic phases were washed with brine (50.0 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 70 / 1 to 50 / 1). The product of et49878-110 was combined with et49878-118. Undecyl 6-bromohexanoate (61.0 g, 175 mmol, 85.9% yield) was given as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.07 (t, J = 6.4 Hz, 2 H), 3.41 (t, J = 6.4 Hz, 2 H), 2.32 (t, J = 7.6 Hz, 2 H), 1.86–1.90 (m, 2 H), 1.60–1.68 (m, 4 H), 1.44–1.50 (m, 2 H), 1.29–1.31 (m, 5 H), 1.27–1.31 (s, 10 H), 0.88 (t, J = 6.8 Hz, 3 H).

[0185] Synthesis of Compound 1

[0186]

[0187] 2,3-bis(heptylthio)propyl 6-[(2-hydroxyethyl)amino]hexanoic acid (1 g, 2.09 mmol, 1.0 equivalent) and undecyl 6-bromohexanoate (877 mg, 2.51 mmol, 1.2 equivalent) were dissolved in EtOH (7 mL), and DIEA (541 mg, 4.19 mmol, 729 μL, 2.0 equivalent) was added at 25 °C. The mixture was then stirred at 90 °C for 12 hours. TLC (dichloromethane / methanol = 10 / 1, product R) f = 0.40) indicates that the reaction was complete. The reaction mixture was poured into water (5 mL), extracted with EtOAc (5 mL, 3 mL, 2 mL), the combined organic phases were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to THF / EtOH = 5 / 1) to give compound 1 (770 mg, 1.03 mmol, 49.3% yield) as a yellow oil. 1HNMR (400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.6 Hz, 1H), 4.25 (dd, J = 6.4, 11.2 Hz, 1H), 4.06 (t, J = 6.4 Hz, 2H), 3.53 (t, J = 4.8 Hz, 2H), 2.97–3.03 (m, 1H), 2.78 (d, J = 6.8 Hz, 2H), 2.54–2.62 (m, 6H), 2.46 (t, J = 7.2 Hz, 4H), 2.29–2.36 (m, 4H), 1.56–1.69 (m, 11H), 0.89 (t, J =6.8 Hz, 9H).

[0188] Compound 2: 8-[(6-(2,3-bis(heptylthio)propoxy)-6-oxohexyl)(2-hydroxyethyl)amino]nonyl octanoate

[0189] Synthesis of nonyl 8-bromooctanoate

[0190]

[0191] Nonan-1-ol (5 g, 34.7 mmol, 1.0 equivalent) was dissolved in DCM (35 mL), and 8-bromooctanoic acid (9.28 g, 41.6 mmol, 1.2 equivalent), EDCI (9.97 g, 52.0 mmol, 1.5 equivalent), and DMAP (847 mg, 6.93 mmol, 0.2 equivalent) were added at 0 °C. The mixture was then stirred at 25 °C for 4 hours. TLC (petroleum ether / ethyl acetate = 5 / 1, product R) f = 0.60) indicates that the reaction is complete. The reaction mixture was poured into water (50 mL), extracted with EtOAc (50 mL, 30 mL, 20 mL), the combined organic phases were washed with brine (30 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 20 / 1) to give nonyl 8-bromooctanoate (11 g, 31.4 mmol, 90.8% yield) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ 4.06 (t, J = 6.8 Hz, 2H), 3.41 (t, J = 6.8 Hz, 2H), 2.30 (t, J = 7.6 Hz, 2H), 1.83–1.90 (m, 2H), 1.59–1.67 (m, 4H), 1.25–1.46 (m, 19H), 0.89 (t, J = 6.4 Hz, 3H).

[0192] Synthesis of Compound 2

[0193]

[0194] 2,3-bis(heptylthio)propyl 6-[(2-hydroxyethyl)amino]hexanoic acid (1 g, 2.09 mmol, 1.0 equivalent) and nonyl 8-bromooctanoate (877 mg, 2.51 mmol, 43.0 μL, 1.2 equivalent) were dissolved in EtOH (7 mL), and DIEA (541 mg, 4.19 mmol, 729 μL, 2.0 equivalent) was added at 25 °C. The mixture was then stirred at 90 °C for 12 hours. TLC (dichloromethane / methanol = 10 / 1, product R) f= 0.40) indicates that the reaction is complete. The reaction mixture was poured into water (5 mL), extracted with EtOAc (5 mL, 3 mL, 2 mL), the combined organic phases were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to THF / EtOH = 5 / 1) to give compound 2 (700 mg, 938 μmol, 44.8% yield) as a yellow oil. 1HNMR (400MHz, CDCl3) δ 4.35 (dd, J = 4.8, 11.2 Hz, 1H), 4.25 (dd, J = 6.4, 11.6 Hz, 1H), 4.05 (t, J = 6.8 Hz, 2H), 3.53 (t, J = 5.2 Hz, 2H), 2.97–3.03 (m, 1H), 2.78 (d, J = 6.8 Hz, 2H), 2.54–2.62 (m, 6H), 2.43–2.48 (m, 4H), 2.27–2.36 (m, 4H), 1.55–1.69 (m, 11H), 1.28–1.51 (m, 41H), 0.89 (t, J = 6.8 Hz, 9H).

[0195] Compound 3: 2,3-bis(heptylthio)propyl 6-[(3-hydroxypropyl)(6-oxo-6-(undecyloxy)hexyl)amino]hexanoic acid

[0196] Synthesis of 2,3-bis(heptylthio)propyl 6-[(3-hydroxypropyl)amino]hexanoic acid

[0197] ,

[0198] 3-Aminopropane-1-ol (3.14 g, 41.8 mmol, 3.22 mL, 8.0 equivalent) and 2,3-bis(heptylthio)propyl 6-bromohexanoate (2.6 g, 5.22 mmol, 1.0 equivalent) were dissolved in EtOH (10 mL) and MeCN (10 mL) at 25°C, followed by stirring the mixture at 60°C for 4 hours. TLC (dichloromethane / methanol = 7 / 1, product R) was performed. f= 0.20) indicates that the reaction is complete. The reaction mixture was poured into water (30 mL), extracted with EtOAc (50 mL, 30 mL, 20 mL), the combined organic phases were washed with brine (20 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to DCM / MeOH = 5 / 1) to give 2,3-bis(heptylthio)propyl 6-[(3-hydroxypropyl)amino]hexanoic acid (1.8 g, 3.66 mmol, 70.0% yield) as a yellow oil.

[0199] Synthesis of Compound 3

[0200]

[0201] 2,3-bis(heptylthio)propyl 6-[(3-hydroxypropyl)amino]hexanoic acid (1.8 g, 3.66 mmol, 1.0 equivalent) and undecyl 6-bromohexanoate (1.28 g, 3.66 mmol, 1.0 equivalent) were dissolved in MeCN (10 mL) and EtOH (10 mL). DIEA (946 mg, 7.32 mmol, 1.27 mL, 2.0 equivalent) was added at 25 °C, and the mixture was stirred at 90 °C for 12 hours. TLC (dichloromethane / methanol = 10 / 1, product R) was performed. f = 0.40) indicates that the reaction was complete. The reaction mixture was poured into water (20 mL), extracted with EtOAc (20 mL, 10 mL, 5 mL), the combined organic phases were washed with brine (5 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to EtOAc / MeOH = 5 / 1) to give compound 3 (1.4 g, 1.84 mmol, 50.3% yield) as a yellow oil.

[0202] Compound 4: 2,3-bis(heptylthio)propyl 6-[[3-(dimethylamino)propyl][6-oxo-6-(undecyloxy)hexyl]amino]hexanoic acid. Synthesis of 2,3-bis(heptylthio)propyl 6-[(3-chloropropyl)(6-oxo-6-(undecyloxy)hexyl)amino]hexanoic acid.

[0203]

[0204] Compound 3 (1.4 g, 1.84 mmol, 1.0 equivalent) was dissolved in DCM (15 mL), and TEA (745 mg, 7.37 mmol, 1.03 mL, 4.0 equivalent) was added at 0 °C. Then, TosCl (702 mg, 3.68 mmol, 2.0 equivalent) was added to the reaction mixture at 0 °C, and the mixture was stirred at 25 °C for 12 hours. LCMS (ET50202-318-P1B, product: RT = 1.236 min) showed that the starting material was completely consumed. The reaction mixture was poured into water (5 mL), extracted with DCM (5 mL, 3 mL, 2 mL), the combined organic phases were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give 2,3-bis(heptylthio)propyl 6-[(3-chloropropyl)(6-oxo-6-(undecyloxy)hexyl)amino]hexanoic acid (1.9 g, crude product), which was a colorless oil.

[0205] Synthesis of Compound 4

[0206]

[0207] To a solution of 2,3-bis(heptylthio)propyl 6-((3-chloropropyl)(6-oxo-6-(undecyloxy)hexyl)amino)hexanoate (1.0 g, 1.28 mmol, 1.0 equivalent) and NaI (96.2 mg, 642 μmol, 0.5 equivalent) in THF (15 mL), N-methylmethylamine (2 M, 3.21 mL, 5 equivalent) was added at 25 °C, and the mixture was then stirred at 75 °C for 12 h. TLC (dichloromethane / methanol = 5 / 1) showed trace amounts of 2,3-bis(heptylthio)propyl 6-((3-chloropropyl)(6-oxo-6-(undecyloxy)hexyl)amino)hexanoate (R f = 0.65) residue, and formed a main spot (target R) f =0.19). The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to THF / MeOH = 5 / 1) to give compound 4 (280 mg, 355 μmol, 27.6% yield) as a brown oil. 1H NMR(400 MHz, CDCl3) δ 4.34 (dd, J = 5.2, 11.2 Hz, 1H), 4.25 (dd, J = 6.4, 11.2 Hz, 1H), 4.05 (t, J = 6.8 Hz, 2H), 3.10 (t, J = 7.2 Hz, 2H), 3.98–3.04 (m, 3H), 2.92 (t, J = 8.0 Hz, 4H), 2.79 (t, J = 6.8 Hz, 2H), 2.66 (s, 5H), 2.54–2.62 (m, 4H), 2.24–2.41 (m, 6H), 1.55–1.78 (m, 15H), 1.26–1.44 (m, 38H), 0.87–0.90 (m, 9H).

[0208] Compound 5: 8-[(6-(2,3-bis(octylthio)propoxy)-6-oxohexyl)(2-hydroxyethyl)amino]nonyl octanoate

[0209] Synthesis of 2,3-bis(octylthio)propyl 6-bromohexanoate

[0210]

[0211] To a solution of propargyl-1-yl 6-bromohexanoate (10.5 g, 45.0 mmol, 1.0 equivalent) in dioxane (70 mL), 1-octylthiol (20.6 g, 141 mmol, 24.5 mL, 3.13 equivalent) was added, and the solution was stirred at 25–100 °C for 1 hour. AIBN (740 mg, 4.50 mmol, 0.1 equivalent) was then added, and the mixture was stirred at 100 °C for 12 hours. TLC (petroleum ether / ethyl acetate = 10 / 1, target R) was performed. f = 0.35) indicates that the reaction has been completed. The reaction mixture was concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 50 / 1) to give 2,3-bis(octylthio)propyl 6-bromohexanoate (20.5 g, 39.0 mmol, 86.5% yield) as a yellow oil. 1H NMR(400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.2 Hz, 1H), 4.25 (dd, J = 6.4, 11.6 Hz, 1H), 3.42 (t, J = 6.8 Hz, 2H), 2.97–3.03 (m, 1H), 2.78 (d, J = 6.8 Hz, 2H), 2.54–2.62 (m, 4H), 2.36 (t, J = 7.2 Hz, 2H), 1.85–1.93 (m, 2H), 1.46–1.72 (m, 9H), 1.25–1.40 (m, 21H), 0.89 (t, J = 6.8 Hz, 6H).

[0212] Synthesis of 2,3-bis(octylthio)propyl 6-[(2-hydroxyethyl)amino]hexanoic acid

[0213]

[0214] 2-Aminoethanol-1-ol (1.74 g, 28.5 mmol, 1.73 mL, 3.0 equivalent) and 2,3-bis(octylthio)propyl 6-bromohexanoate (5.0 g, 9.51 mmol, 1.0 equivalent) were dissolved in MeCN (35 mL) at 25 °C, and the mixture was then stirred at 90 °C for 12 hours. TLC (dichloromethane / methanol = 7 / 1, target R) was performed. f = 0.20) indicates that the reaction is complete. The reaction mixture was poured into water (50 mL) and extracted with EtOAc (50 mL, 30 mL, 20 mL). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to dichloromethane / methanol = 5 / 1) to give 2,3-bis(octylthio)propyl 6-[(2-hydroxyethyl)amino]hexanoic acid (2.6 g, 5.14 mmol, 54.0% yield) as a yellow oil. 1H NMR (400MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.2 Hz, 1H), 4.25 (dd, J = 6.4, 11.6 Hz, 1H), 3.68 (t, J = 5.2 Hz, 2H), 2.97–3.03 (m, 1H), 2.68 (t, J = 7.2 Hz, 2H), 2.53–2.62 (m, 6H), 2.35 (t, J = 7.2 Hz, 2H), 1.53–1.70 (m, 8H), 1.29–1.44 (m, 23H), 0.89 (t, J = 6.4 Hz, 6H).

[0215] Synthesis of Compound 5

[0216]

[0217] To a solution of 2,3-bis(octylthio)propyl 6-[(2-hydroxyethyl)amino]hexanoate (1.0 g, 1.98 mmol, 1.0 equivalent) and nonyl 8-bromooctanoate (829 mg, 2.37 mmol, 43.0 μL, 1.2 equivalent) in EtOH (5 mL), DIEA (511 mg, 3.95 mmol, 689 μL, 2.0 equivalent) was added at 25°C, and the mixture was then stirred at 90°C for 12 hours. TLC (dichloromethane / methanol = 10 / 1, product R) was performed. f = 0.40) indicates that the reaction is complete. The reaction mixture was poured into water (5 mL) and extracted with EtOAc (5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to THF / EtOH = 5 / 1). Compound 5 (570 mg, 736 μmol, 37.2% yield) was a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.2 Hz, 1H), 4.25 (dd, J = 6.4, 11.6 Hz, 1H), 3.53 (t, J = 5.2 Hz, 2H), 2.78 (d, J = 6.8 Hz, 2H), 2.54–2.62 (m, 6H), 2.43–2.48 (m, 4H), 2.28–2.36 (m, 4H), 1.56–1.69 (m, 11H), 1.28–1.47 (m, 46H), 0.89 (t, J = 6.4 Hz, 9H).

[0218] Compound 6: (9Z,12Z)-octadec-9,12-dienoic acid 2-[[6-[2,3-bis(octylthio)propoxy]-6-oxohexyl][3-(dimethylamino)propyl]amino]ethyl ester

[0219] Synthesis of 2-((tert-butyldimethylsilyl)oxy)acetaldehyde

[0220]

[0221] IBX (23.8 g, 85.0 mmol, 1.50 equivalent) was added to a solution of 2-((tert-butyldimethylsilyl)oxy)ethanol-1-ol (10.0 g, 56.7 mmol, 1.00 equivalent) in ACN (160 mL). The mixture was stirred at 85 °C for 5 hours. TLC (petroleum ether: ethyl acetate = 3:1, product R) f = 0.6) indicates that reactant 1 has been completely consumed and a new spot has formed. TLC showed that the reaction was clean. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure to give 2-((tert-butyldimethylsilyl)oxy)acetaldehyde (5.00 g, 28.6 mmol, 50.5% yield) as a yellow oil.

[0222] Synthesis of 2,3-bis(octylthio)propyl 6-[[3-(dimethylamino)propyl]amino]hexanoic acid

[0223]

[0224] To 2,3-bis(octylthio)propyl 6-bromohexanoate (5 g, 9.51 mmol, 1.0 equivalent) and N 1 N 1 1,3-Dimethylpropane-1,3-diamine (4.86 g, 47.6 mmol, 5.95 mL, 5.0 equivalents) was in solution in MeCN (35 mL) at 25 °C, and the mixture was then stirred at 90 °C for 40 min. TLC (dichloromethane / methanol = 7 / 1, product R) f = 0.20) indicates that the reaction is complete. The reaction mixture was poured into water (50 mL) and extracted with EtOAc (50 mL, 30 mL, 20 mL). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to dichloromethane / methanol = 5 / 1) to give 2,3-bis(octylthio)propyl 6-[[3-(dimethylamino)propyl]amino]hexanoic acid (1.7 g, 3.11 mmol, 32.6% yield) as a yellow oil. 1H NMR(400 MHz, CDCl3) δ 4.34 (dd, J = 5.2, 11.2 Hz, 1H), 4.25 (dd, J = 6.4, 11.2 Hz, 1H), 2.96–3.03 (m, 3H), 2.78–2.84 (m, 4H), 2.53–2.62 (m, 6H), 2.33–2.38 (m, 8H), 1.91–1.96 (m, 2H), 1.55–1.76 (m, 8H), 1.28–1.44 (m, 23H), 0.89 (t, J = 6.8 Hz, 6H).

[0225] Synthesis of 2,3-bis(octylthio)propyl 6-[(3-(dimethylamino)propyl)(2-hydroxyethyl)amino]hexanoic acid

[0226]

[0227] 2,3-bis(octylthio)propyl 6-[[3-(dimethylamino)propyl]amino]hexanoic acid (0.5 g, 914 μmol, 1.0 equivalent) and 2-((tert-butyldimethylsilyl)oxy)acetaldehyde (191 mg, 1.10 mmol, 209 μL, 1.2 equivalent) were added to a solution in DCM (5 mL) at 0 °C. The mixture was stirred for 10 min, and NaBH(OAc)3 (387 mg, 1.83 mmol, 2.0 equivalent) was added. The mixture was stirred at 25 °C for 5 h. LCMS (ET50202-178-P1A, product: RT = 0.758 min) showed that the starting material was completely consumed. The reaction mixture was poured into water (5 mL) and extracted with EtOAc (5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give 2,3-bis(octylthio)propyl 6-[[2-[(tert-butyldimethylsilyl)oxy]ethyl][3-(dimethylamino)propyl]amino]hexanoic acid (0.67 g, crude product), which was a colorless oil. 1H NMR(400 MHz, CDCl3) δ 4.33 (dd, J = 5.2, 11.2 Hz, 1H), 4.25 (dd, J = 6.4, 11.2 Hz, 1H), 4.05 (t, J = 4.4 Hz, 2H), 3.18–3.27 (m, 6H), 3.10–3.14 (m, 2H), 2.96–3.02 (m, 1H), 2.83 (s, 6H), 2.77 (d, J = 6.8 Hz, 2H), 2.53–2.61 (m, 4H), 2.43–2.50 (m, 2H), 2.35 (t, J = 7.2 Hz, 2H), 2.07 (s, 3H), 1.79–1.87 (m, 2H), 1.64–1.72 (m, 2H), 1.55–1.62 (m, 5H), 1.24–1.43 (m, 27H), 0.86–0.91 (m, 18H), 0.10 (s, 6H).

[0228] 2,3-bis(octylthio)propyl 6-ethyl][3-(dimethylamino)propyl]amino]hexanoic acid (0.67 g, 950 μmol, 1.0 equivalent) was added to a solution in TBAF (13 mL) at 25 °C, and the mixture was stirred at 25 °C for 12 h. LCMS (ET50202-182-P1A, product: RT = 0.673 min) showed that the starting material was completely consumed. The reaction mixture was poured into water (10 mL) and extracted with EtOAc (5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give 2,3-bis(octylthio)propyl 6-hexanoic acid (1.34 g, 680 μmol, 71.6% yield, 30% purity), a colorless oil.

[0229] Synthesis of Compound 6

[0230]

[0231] To a solution of 2,3-bis(octylthio)propyl 6-[(3-(dimethylamino)propyl)(2-hydroxyethyl)amino]hexanoic acid (1.34 g, 680 μmol, 30% purity, 1.0 equivalent) in DCM (5 mL), (9Z,12Z)-octadec-9,12-dienoic acid (286 mg, 1.02 mmol, 286 μL, 1.5 equivalent), EDCI (196 mg, 1.02 mmol, 1.5 equivalent), and DMAP (16.6 mg, 136 μmol, 0.2 equivalent) were added at 0 °C, and the mixture was then stirred at 25 °C for 1.5 h. TLC (dichloromethane / methanol = 5 / 1, product R) was performed. f = 0.05) indicates that the reaction was complete. The reaction mixture was poured into water (10 mL) and extracted with EtOAc (5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to dichloromethane / methanol = 10 / 1) to give compound 6 (120 mg, 140 μmol, 20.6% yield) as a yellow oil. 1H NMR (400MHz, CDCl3) δ 2.30–5.42 (m, 3H), 4.32–4.38 (m, 1H), 4.22–4.27 (m, 1H), 4.11 (t, J = 6.0Hz, 1H), 3.31–3.34 (m, 1H), 3.00–3.03 (m, 1H), 2.76–2.80 (m, 3H), 2.68 (t, J = 6.4 Hz, 1H), 2.44–2.62 (m, 7H), 2.26–2.35 (m, 7H), 2.03–2.08 (m, 4H), 1.53–1.68 (m, 8H), 1.28–1.46 (m, 35H), 0.87–0.90 (m, 9H).

[0232] Compound 7: (9Z,12Z)-octadec-9,12-dienoic acid 2-[(6-(2,3-bis(octylthio)propoxy)-6-oxohexyl)(2-hydroxyethyl)amino]ethyl ester

[0233] Synthesis of 2,3-bis(octylthio)propyl 6-[bis(2-hydroxyethyl)amino]hexanoic acid

[0234]

[0235] To a solution of 2,3-bis(octylthio)propyl 6-((2-hydroxyethyl)amino)hexanoate (1 g, 1.98 mmol, 1.0 equivalent) and 2-bromoethanol (371 mg, 2.97 mmol, 211 μL, 1.5 equivalent) in MeCN (10 mL), K₂CO₃ (410 mg, 2.97 mmol, 1.5 equivalent) was added at 25°C, and the mixture was then stirred at 90°C for 12 hours. LCMS (ET50202-192-P1A, product: RT = 0.687 min) showed that the starting material was completely consumed. The reaction mixture was poured into water (10 mL) and extracted with EtOAc (10 mL, 5 mL, 3 mL). The combined organic layers were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give 2,3-bis(octylthio)propyl 6-[bis(2-hydroxyethyl)amino]hexanoic acid (1 g, crude product), which was a yellow oil.

[0236] Synthesis of Compound 7

[0237]

[0238] To a solution of 2,3-bis(octylthio)propyl 6-[bis(2-hydroxyethyl)amino]hexanoic acid (0.9 g, 1.64 mmol, 1.0 equivalent) and (9Z,12Z)-octadec-9,12-dienoic acid (459 mg, 1.64 mmol, 459 μL, 1.0 equivalent) in DCM (8 mL), DMAP (40.0 mg, 327 μmol, 0.2 equivalent) and EDCI (471 mg, 2.45 mmol, 1.5 equivalent) were added at 0°C, and the mixture was then stirred at 25°C for 3 hours. LCMS (ET50202-205-P1A1, product RT = 2.437) showed that the starting materials were completely consumed. The reaction mixture was poured into water (5 mL) and extracted with EtOAc (5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by preparative HPLC (column: Welch Xtimate C1 100 x 30 mm x 5 μm; mobile phase: [water (TFA) - ACN]; B%: 65% - 95%, 8 min) to give compound 7 (250 mg) as a colorless oil. The pH of the reaction was adjusted to approximately 8–9 with aq. Na2CO3 at 0 °C. The mixture was extracted with EtOAc (5 mL × 4), the combined organic layers were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give compound 7 (145 mg, 178 μmol, 10.9% yield) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ 5.30–5.42 (m, 4H), 4.36 (dd, J =5.2, 11.2 Hz, 1H), 4.25 (dd, J = 6.4, 11.6 Hz, 1H), 4.14 (t, J = 6.0 Hz, 2H), 3.54 (t, J =5.2 Hz, 2H), 2.97–3.03 (m, 1H), 2.76–2.97 (m, 6H), 2.52–2.66 (m, 8H), 2.29–2.36 (m, 4 H), 2.03–2.08 (m, 4H), 1.55–1.67 (m, 9H), 1.28–1.50 (m, 39H), 0.87–0.91 (m, 9H).

[0239] Compound 8: 2,3-bis(heptylthio)propyl 7-[(2-hydroxyethyl)((9Z,12Z)-octadec-9,12-dien-1-yl)amino]heptanoic acid

[0240] Synthesis of 2,3-bis(heptylthio)propyl 7-bromoheptanoic acid

[0241]

[0242] To a solution of 7-bromoheptanoic acid (15.0 g, 71.7 mmol, 3.40 mL, 1.0 equivalent) and propargyl-1-ol (4.77 g, 85.1 mmol, 5.03 mL, 1.19 equivalent) in DCM (90.0 mL), EDCI (20.6 g, 108 mmol, 1.5 equivalent) and DMAP (1.75 g, 14.4 mmol, 0.2 equivalent) were added at 0 °C. The reaction was stirred at 20 °C for 3 hours. TLC (petroleum ether: ethyl acetate = 10:1, R f = 0.50) indicates that 7-bromoheptanoic acid has been completely consumed. The residue was diluted with water (100 mL) and extracted with EtOAc (100 mL × 3). The combined organic layers were washed with brine (50.0 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 60 / 1 to 50 / 1). Prop-2-yn-1-yl 7-bromoheptanoate (28.0 g, 113 mmol, 79.0% yield) was given as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.68 (d, J = 2.4 Hz, 2 H), 3.40 (t, J = 6.8 Hz, 2 H), 2.47 (t, J = 2.8 Hz, 1 H), 2.37 (t, J = 7.6 Hz, 2 H), 2.04 (s, 1 H), 1.83–1.90 (m, 2 H), 1.63–1.70 (m, 2 H), 1.34–1.50 (m, 4 H).

[0243] To a solution of propargyl-1-yl 7-bromoheptanoate (15.0 g, 60.7 mmol, 1.0 equivalent) in dioxane (90.0 mL), 1-heptathiol (24.1 g, 182 mmol, 28.5 mL, 3.0 equivalent) was added, and the solution was stirred at 25–100 °C for 1 hour. AIBN (1.99 g, 12.1 mmol, 0.2 equivalent) was then added, and the mixture was stirred at 100 °C for 12 hours. TLC (petroleum ether: ethyl acetate = 10:1, starting materials: R) f = 0.51; Product: R f= 0.57) indicates that prop-2-yn-1-yl 7-bromoheptanoate has been completely consumed. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 1 to 60 / 1). 2,3-bis(heptylthio)propyl 7-bromoheptanoate (25.0 g, 48.9 mmol, 80.5% yield) was given as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.34 (dd, J = 4.8 Hz, J = 5.2 Hz, 1 H), 4.26 (dd, J = 4.8 Hz, J = 5.2 Hz, 1 H), 3.41 (t, J = 6.8 Hz, 2 H), 2.97–3.03 (m, 1 H), 2.79 (d, J = 6.8 Hz, 2 H), 2.53–2.62 (m, 4 H), 2.35 (t, J = 7.2 Hz, 2 H), 1.85–1.89 (m, 2 H), 1.56–1.68 (m, 7 H), 1.45–1.47 (m, 2 H), 1.28–1.38 (m, 17 H), 0.89 (t, J = 6.8 Hz, 6 H).

[0244] Synthesis of 2,3-bis(heptylthio)propyl 7-[(2-hydroxyethyl)amino]heptanoic acid

[0245]

[0246] 2,3-bis(heptylthio)propyl 7-bromoheptanoate (3.00 g, 5.86 mmol, 1.0 equivalent) and 2-aminoethanol (1.07 g, 17.6 mmol, 1.06 mL, 3.0 equivalent) were dissolved in MeCN (15.0 mL) at 25°C, and the mixture was then stirred at 90°C for 40 minutes. TLC (petroleum ether: ethyl acetate = 10:1, starting materials: R) f = 0.51; Product: R f =0.1) indicates that 2,3-bis(heptylthio)propyl 7-bromoheptanoic acid has been completely consumed. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was purified by column chromatography (SiO2, DCM: MeOH = 10:1). 2,3-bis(heptylthio)propyl 7-[(2-hydroxyethyl)amino]heptanoic acid (1.60 g, crude) was given as a yellow oil.

[0247] Synthesis of (6Z,9Z)-18-bromooctadec-6,9-diene

[0248]

[0249] To a suspension of LAH (2.71 g, 71.3 mmol, 1.00 equivalent) in THF (50.0 mL), a solution of (9Z,12Z)-octadecano-9,12-dienoic acid (20.0 g, 71.3 mmol, 20.0 mL, 1.00 equivalent) in THF (70.0 mL) was added dropwise at 0 °C. The mixture was stirred at 25 °C for 2 hours. TLC (petroleum ether: ethyl acetate = 10:1, R f =0.3) indicates that (9Z,12Z)-octadec-9,12-dienoic acid has been completely consumed, forming a new spot. The reaction mixture was quenched at 0°C by adding H2O (3.00 mL), and then filtered, with the filtrate concentrated. Unpurified, it yielded (9Z,12Z)-octadec-9,12-dien-1-ol (14.7 g, 55.2 mmol, 77.4% yield) as a yellow oil. 1H NMR (400MHz, CDCl3) δ 5.29–5.49 (m, 4H), 3.66 (t, J = 6.8 Hz, 2H), 2.80 (t, J = 6.4 Hz, 2H), 2.01–2.15 (m, 5H), 1.55–1.62 (m, 3H), 1.22–1.45 (m, 19H), 0.91 (t, J = 6.4 Hz, 3H)

[0250] PPh3 (23.2 g, 88.3 mmol, 1.60 equivalent) was added to a solution of (9Z,12Z)-octadec-9,12-dien-1-ol (14.7 g, 55.2 mmol, 1.00 equivalent) in DCM (90.0 mL), followed by the addition of CBr4 (29.3 g, 88.3 mmol, 1.60 equivalent) in portions at 0 °C. The mixture was stirred at 25 °C for 12 hours. TLC (petroleum ether:ethyl acetate = 10:1, R f = 0.7) indicates that (9Z,12Z)-octadec-9,12-dien-1-ol has been completely consumed, and two new spots have formed. The reaction mixture was poured into H2O (100 mL) and extracted with DCM (200 mL, 100 mL). The combined organic layers were washed with brine (100 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 0 / 1 to 5 / 1). (6Z,9Z)-18-bromooctadec-6,9-diene (25.0 g, crude) was obtained as a colorless oil. 1H NMR (400 MHz, CDCl3) δ 5.23 - 5.54 (m, 4H), 3.43 (t, J = 6.8 Hz, 2H), 2.80 (t, J = 6.8 Hz, 2H), 2.07 (q, J = 6.8 Hz, 4H), 1.88 (quin, J = 7.2Hz, 2H), 1.24 - 1.51 (m, 17H), 0.91 (t, J = 6.8 Hz, 3H)

[0251] Synthesis of Compound 8

[0252]

[0253] To a solution of 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate (1.00 g, 2.03 mmol, 1.0 eq) and (6Z,9Z)-18-bromooctadec-6,9-diene (804 mg, 2.44 mmol, 1.2 eq) in EtOH (10.0 mL), DIEA (420 mg, 3.25 mmol, 566 μL, 1.6 eq) was added at 25°C, and the mixture was stirred at 90°C for 12 h. LCMS (ET49878-166-p1a, product: RT = 0.855 min; starting material: RT = 0.710 min) showed that the starting material was completely consumed. The residue was diluted with water (20.0 mL) and extracted with EtOAc (10.0 mL × 2). The combined organic layers were washed with brine (10.0 mL), dried, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 5 / 1 to 2 / 1). Compound 8 (200 mg, 262 μmol, 12.9% yield, 97.1% purity) was obtained as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 5.32 - 5.42 (m, 4 H), 4.33 - 4.37 (m, 1 H), 4.22 - 4.25 (m, 1 H), 3.52 (t, J = 5.2 Hz, 2 H), 2.98 - 3.01 (m, 1H), 2.76 - 2.80 (m, 4 H), 2.53 - 2.62 (m, 6 H), 2.42 - 2.46 (m, 4 H), 2.33 (t, J = 7.6Hz, 3 H), 2.03 - 2.08 (m, 4 H), 1.55 - 1.66 (m, 9 H), 1.28 - 1.45 (m, 43 H), 0.87 - 0.91 (m, 9 H).

[0254] Compound 9: 2,3-bis(heptylthio)propyl 7-[(2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino]heptanoic acid

[0255] Synthesis of Compound 9

[0256]

[0257] To a solution of 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate (1.00 g, 2.03 mmol, 1.0 eq) and undecyl 6-bromohexanoate (852 mg, 2.44 mmol, 1.2 eq) in EtOH (20.0 mL), DIEA (525 mg, 4.07 mmol, 708 μL, 2.0 eq) was added at 25°C, and the mixture was stirred at 90°C for 12 h. LCMS (ET49878-167-p1a, product: RT = 0.839 min; starting material: RT = 0.707 min) showed that the starting material was completely consumed. The residue was diluted with water (20.0 mL) and extracted with EtOAc (10.0 mL × 2). The combined organic layers were washed with brine (10.0 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 2 / 1 to 1 / 1). Compound 9 (500 mg, 658 μmol, 32.4% yield, 100% purity) was obtained as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.33 - 4.36 (m, 1 H), 4.25 -4.26 (m, 1 H), 4.06 (t, J = 6.4 Hz, 2 H), 3.52 (t, J = 5.6 Hz, 2 H), 2.80 - 3.10 (m, 2 H), 2.57 - 2.58 (m, 2 H), 2.55 - 2.57 (m, 6 H), 2.41 - 2.50 (m, 4 H), 2.30 - 2.33 (m, 4 H), 1.59 - 1.66 (m, 11 H), 1.27 - 1.38 (m, 43 H), 0.89 (t, J = 6.8 Hz, 9 H).

[0258] Compound 10: 8-[(7-(2,3-bis(heptylthio)propoxy)-7-oxoheptyl)(2-hydroxyethyl)amino]nonyl octanoate

[0259] Synthesis of Compound 10

[0260]

[0261] DIEA (420 mg, 3.25 mmol, 567 μL, 1.6 eq) was added to a solution of 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate (1.00 g, 2.03 mmol, 1.0 eq) and nonyl 8-bromooctanoate (852 mg, 2.44 mmol, 1.2 eq) in EtOH (20.0 mL). The reaction was stirred at 90 °C for 12 h. LCMS (ET49878-166-p1a, product: RT = 0.855 min; starting material: RT = 0.710 min) showed that the starting material was completely consumed. The residue was diluted with water (20.0 mL) and extracted with EtOAc (10.0 mL × 2). The combined organic layers were washed with brine (10.0 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 2 / 1 to 1 / 1). Compound 10 (400 mg, 526 μmol, 25.9% yield) was obtained as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.33 - 4.37 (m, 1 H), 4.23 - 4.26 (m, 1 H), 4.06 (t, J = 6.4 Hz, 2H), 3.52 (t, J = 5.2 Hz, 2 H), 2.98 - 3.01 (m, 1 H), 2.77 - 2.79 (m, 2 H), 2.53 - 2.62 (m, 6 H), 2.41 - 2.45 (m, 4 H), 2.27 - 2.35 (m, 4 H), 1.55 - 1.67 (m, 11 H), 1.23 - 1.47 (m, 44 H), 0.88 (t, J = 6.8 Hz, 9 H).

[0262] Compound 11: 2,3-bis(heptylthio)propyl 7-[(3-hydroxypropyl)(6-oxo-6-(undecyloxy)hexyl)amino]heptanoic acid

[0263] Synthesis of 2,3-bis(heptylthio)propyl 7-[(3-hydroxypropyl)amino]heptanoic acid

[0264]

[0265] A solution of 2,3-bis(heptylthio)propyl 7-bromoheptanoate (1.00 g, 1.95 mmol, 1.0 eq) and 3-aminoprop-1-ol (1.47 g, 19.5 mmol, 1.51 mL, 10 eq) in EtOH (28.0 mL) was stirred at 50 °C for 8 hours. TLC (petroleum ether:ethyl acetate = 10:1, starting materials: R) f = 0.51; Product: R f = 0.07) indicates that 2,3-bis(heptylthio)propyl 7-bromoheptanoate was completely consumed. The residue was diluted with water (40.0 mL) and extracted with dimethyltetrahydrofuran (20.0 mL × 3). The combined organic layers were washed with brine (30.0 mL × 2), dried, filtered, and concentrated under reduced pressure to give the residue. 2,3-bis(heptylthio)propyl 7-[(3-hydroxypropyl)amino]heptanoate (500 mg, 988 μmol, 50.6% yield) was given as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.32 - 4.37 (m, 1 H), 4.21 - 4.26 (m, 1 H), 3.81 - 3.83 (m, 2 H), 2.98 - 3.03 (m, 1 H), 2.92 (t, J = 5.6 Hz, 2 H), 2.78 (d, J = 6.8 Hz, 2 H), 2.53 - 2.67 (m, 5 H), 2.33 (t, J = 7.6 Hz, 2 H), 1.71 - 1.77 (m, 2 H), 1.51 - 1.65 (m, 8 H), 1.27 - 1.39 (m, 19 H), 0.88 (t, J = 6.4 Hz, 5 H).

[0266] Synthesis of Compound 11

[0267]

[0268] DIEA (255 mg, 1.98 mmol, 344 μL, 2.0 eq) was added to a solution of 2,3-bis(heptylthio)propyl 7-[(3-hydroxypropyl)amino]heptanoic acid (500 mg, 988 μmol, 1.0 eq) and undecyl 6-bromohexanoate (518 mg, 1.48 mmol, 1.5 eq) in EtOH (10.0 mL). The reaction was stirred at 90 °C for 12 h. LCMS (ET49878-223-p1a2, product: RT = 1.25 min; starting material: RT = 0.866 min) showed that the starting material was completely consumed. The residue was diluted with water (10.0 mL) and extracted with EtOAc (10.0 mL × 3). The combined organic layers were washed with brine (10.0 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, DCM:MeOH = 40 / 1 to 30 / 1). Compound 11 (300 mg, 387 μmol, 39.2% yield) was obtained as a yellow oil, of which 100 mg was delivered with the purity tested as shown on pages et 49878-239. 1H NMR (400 MHz, CDCl3) δ 4.33 - 4.37 (m, 1H), 4.23 - 4.27 (m, 1 H), 4.06 (t, J = 6.4 Hz, 2 H), 3.83 (t, J = 4.8 Hz, 2 H), 2.89 -3.10 (m, 5 H), 2.78 - 2.88 (m, 2 H), 2.54 - 2.63 (m, 4 H), 2.29 - 2.36 (m, 4 H), 1.88 -1.94 (m, 1 H), 1.52 - 1.74 (m, 13 H), 1.27 - 1.48 (m, 36 H), 1.18 - 1.21 (m, 1 H), 0.84 -0.90 (m, 9 H).

[0269] Compound 12: 2,3-bis(heptylthio)propyl 7-[[3-(dimethylamino)propyl][6-oxo-6-(undecyloxy)hexyl]amino]heptanoic acid

[0270] Synthesis of Compound 12

[0271]

[0272] TEA (784 mg, 7.75 mmol, 1.0 mL, 4.0 eq) was added to a solution of compound 11 (1.50 g, 1.94 mmol, 1.0 eq) in DCM (15.0 mL). TosCl (739 mg, 3.87 mmol, 2.0 eq) was then added at 0 °C. The reaction was stirred at 20 °C for 12 hours. TLC (petroleum ether:ethyl acetate = 10:1, starting material: R) was used. f = 0.37; Product: R f = 0.65) indicates that compound 67-5-3 was completely consumed. The reaction of et49878-256 was combined with that of et49878-263 for post-processing. The residue was diluted with water (30.0 mL) and extracted with DCM (20.0 mL × 3). The combined organic layers were washed with brine (20.0 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, DCM:MeOH = 80 / 1 to 60 / 1). The product of et49878-256 was combined with that of et49878-263. 2,3-bis(heptylthio)propyl 7-[(6-oxo-6-(undecyloxy)hexyl)(3-(p-toluenesulfonyloxy)propyl)amino]heptanoic acid (2.1 g, crude) was given as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.33 - 4.37 (m, 1 H), 4.22 - 4.26 (m, 1 H), 4.06 (t, J = 6.8 Hz, 2 H), 3.61 (br s, 2 H), 2.98 - 3.01 (m, 2 H), 2.78 - 2.79 (m, 2 H), 2.53 - 2.62 (m, 5 H), 2.28 - 2.43 (m, 9 H), 1.86 (br s, 2 H), 1.55 - 1.65 (m, 12H), 1.27 - 1.39 (m, 42 H), 0.89 (t, J = 6.4 Hz, 9 H).

[0273] To a solution of N-methylmethylamine (2 M, 1.26 mL, 5.0 eq) in THF (8.00 mL), NaI (37.8 mg, 252 μmol, 0.5 eq) and 2,3-bis(heptylthio)propyl7-((6-oxo-6-(undecyloxy)hexyl)(3-(p-toluenesulfonyloxy)propyl)amino)heptanoate (400 mg, 504 μmol, 1.0 eq) were added. The mixture was stirred at 80 °C for 48 h. LCMS (ET49878-274-p1a1, product: RT = 0.781 min; starting material: RT = 0.87 min) showed that the starting material was completely consumed. The four reactions were combined for post-processing / purification. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was purified by preparative TLC (SiO2, DCM:MeOH = 3:1 to 1:1). Compound 12 (300 mg, 374 μmol, 18.6% yield) was obtained as a brown oil. 1H NMR (400 MHz, CDCl3) δ 4.33 - 4.37 (m, 1 H), 4.24 - 4.27 (m, 1 H), 4.05 (t, J = 6.8 Hz, 2 H), 2.92 - 3.01 (m, 3 H), 2.78 - 2.85 (m, 6H), 2.70 - 2.73 (m, 2 H), 2.54 - 2.62 (m, 4 H), 2.46 (s, 6 H), 2.30 - 2.36 (m, 5 H), 2.00 - 2.03 (m, 2 H), 1.55 - 1.70 (m, 14 H), 1.27 - 1.41 (m, 39 H), 0.88 (t, J = 6.4 Hz, 9 H).

[0274] Compound 13: (9Z,12Z)-octadec-9,12-dienoic acid 2-[(7-(2,3-bis(heptylthio)propoxy)-7-oxoheptyl)(2-hydroxyethyl)amino]ethyl ester

[0275]

[0276] Compound 13 was prepared using a similar procedure to that of Compound 7, starting with 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate. Briefly, K₂CO₃ (562 mg, 4.07 mmol, 2.0 eq) was added to a solution of 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate (1.00 g, 2.0 mmol, 1.0 eq) and 2-bromoethanol (508 mg, 4.07 mmol, 289 μL, 2.0 eq) in ACN (6.00 mL). The reaction was stirred at 90 °C for 6 h. LCMS (ET49878-195-P1A1, product: RT = 0.724 min;) showed that the starting material was completely consumed. The residue was diluted with water (10.0 mL) and extracted with EtOAc (10.0 mL × 3). The combined organic layers were washed with brine (10.0 mL × 2), dried, filtered, and concentrated under reduced pressure to give the residue. 2,3-bis(heptylthio)propyl 7-(bis(2-hydroxyethyl)amino)heptanoate (1.0 g, crude) was obtained as a yellow oil. EDCI (536 mg, 2.80 mmol, 1.0 eq) and DMAP (45.6 mg, 373 μmol, 0.2 eq) were added to a solution of 2,3-bis(heptylthio)propyl 7-(bis(2-hydroxyethyl)amino)heptanoate (1.00 g, 1.87 mmol, 1.0 eq) and (9Z,12Z)-heptadec-9,12-dienoic acid (596 mg, 2.24 mmol, 1.2 eq) in DCM (7.80 mL) at 0 °C. The reaction was stirred at 20 °C for 4 h. LCMS (ET49878-198-p1a1, product: RT = 0.890 min) showed that the starting material was completely consumed. The residue was diluted with water (10.0 mL) and extracted with EtOAc (20.0 mL × 3). The combined organic layers were washed with brine (10.0 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 5 / 1 to 3 / 1). Compound 13 (700 mg, 833 μmol, 44.6% yield, 95.0% purity) was given as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 5.32 - 5.39 (m, 4 H), 4.33 - 4.36 (m, 1 H), 4.25 - 4.26 (m, 1H), 4.12 - 4.15 (m, 2 H), 3.53 - 3.55 (m, 2 H), 2.98 - 3.00 (m, 1 H), 2.77 - 2.79 (m, 6H), 2.53 - 2.57 (m, 7 H), 2.31 - 2.33 (m, 4 H), 2.04 - 2.06 (m, 4 H), 1.59 - 1.61 (m, 9H), 1.28 - 1.37 (m, 37 H), 0.87 - 0.90 (m, 9 H).

[0277] Compound 14: 2,3-bis(heptylthio)propyl 7-[(5-(dodecyloxy)-5-oxopentyl)(2-hydroxyethyl)amino]heptanoic acid

[0278] Synthesis of Compound 14

[0279]

[0280] To a solution of 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate (0.6 g, 1.22 mmol, 1.0 eq) in EtOH (12.0 mL), DIEA (315 mg, 2.44 mmol, 425 μL, 2.0 eq) and dodecyl 5-bromopentanoate (511 mg, 1.46 mmol, 1.2 eq) were added. The mixture was stirred at 90 °C for 12 h. The residue was diluted with water (10.0 mL) and extracted with EtOAc (20.0 mL × 2). The combined organic layers were washed with brine (10.0 mL), dried, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, DCM:MeOH = 60 / 1 to 40 / 1). Compound 14 (300 mg, 395 μmol, 32.4% yield, 100% purity) was obtained as a yellow oil. 1H NMR(400 MHz, CDCl3) δ 4.33 - 4.37 (m, 1 H), 4.22 - 4.26 (m, 1 H), 4.06 (t, J = 6.8Hz, 2 H), 3.56 (s, 2 H), 2.98 - 3.01 (m, 1 H), 2.78 - 2.80 (m, 2 H), 2.48 - 2.62 (m, 10H), 2.30 - 2.35 (m, 4H), 1.57 - 1.65 (m, 12H), 1.26 - 1.39 (m, 40H), 0.89 (t, J = 6.8Hz, 9H).

[0281] Compound 15: 8-[(7-(2,3-bis[(3-butylheptyl)thio]propoxy)-7-oxoheptyl)(2-hydroxyethyl)amino]nonyl octanoate

[0282] Synthesis of nonyl octanoate of 8-[(2-hydroxyethyl)amino]octanoate

[0283]

[0284] A solution of nonyl 8-bromooctanoate (3.00 g, 8.59 mmol) and 2-aminoethanol (15.2 g, 249 mmol) in EtOH (30 mL) was stirred at 85 °C for 3 h. TLC (petroleum ether:ethyl acetate = 10:1) showed that the starting material was completely consumed and a new spot was formed. The reaction solution was diluted with EtOAc (100 mL), washed with water, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 20+12 g SepaFlash® silica gel column, eluent gradient of 0–15% MeOH / CH2Cl2, flow rate 30 mL / min) to give nonyl 8-[(2-hydroxyethyl)amino]octanoate (1.30 g, 3.95 mmol, 45.9% yield) as a white solid. 1H NMR (400 MHz, CDCl3). δ 4.05 (t, J = 6.4 Hz, 2H), 3.61–3.68 (m, 2H), 2.75–2.82 (m, 2H), 2.62 (t, J = 7.2 Hz, 2H), 2.29 (t, J = 7.2 Hz, 2H), 2.19 (br s, 2H), 1.56–1.68 (m, 4H), 1.44–1.54(m, 2H), 1.20–1.39 (m, 18H), 0.88 (t, J = 6.8 Hz, 3H).

[0285] Synthesis of 3-Butylheptane-1-thiol

[0286]

[0287] To a solution of 3-butylheptane-1-ol (5.00 g, 20.0 mmol) in CH₂Cl₂ (50.0 mL), p-toluenesulfonyl chloride (TsCl, 6.09 g, 31.9 mmol), 4-dimethylaminopyridine (DMAP, 354 mg, 2.90 mmol), and triethylamine (TEA, 5.87 g, 58.0 mmol) were added. The mixture was stirred at 25 °C for 16 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the reaction was complete. The reaction mixture was diluted with CH₂Cl₂ (100 mL), washed with aqueous citric acid solution (50 mL), dried over Na₂SO₄, filtered, and concentrated under reduced pressure to give 3-butylheptane-4-methylbenzenesulfonate (9.00 g, crude product) as a dark brown oil. 1H NMR (400 MHz, CDCl3). δ 7.80 (d, J = 8.4 Hz, 2H), 7.35 (d, J =8.0 Hz, 2H), 4.06 (t, J = 7.2 Hz, 2H), 2.46 (s, 3H), 1.51–1.63 (m, 3H), 1.11–1.27 (m, 12H), 0.82–0.90 (m, 6H).

[0288] Potassium thioacetate (3.78 g, 33.1 mmol) was added to an acetone (90 mL) solution of 3-butylheptyl-4-methylbenzenesulfonate (9.00 g, 27.6 mmol). The mixture was stirred at 20 °C for 12 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the reaction was complete. The reaction mixture was diluted with water (300 mL) and extracted with CH2Cl2 (100 mL × 3). The combined organic phases were dried over Na2SO4, filtered, and concentrated under reduced pressure to give a dark brown oil (6.00 g). This dark oil (6.00 g) was dissolved in MeOH (30 mL) and an aqueous solution of NaOH (3.0 mL, 20% purity) was added. The mixture was stirred at 20 °C for 2 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the reaction was complete. The reaction mixture was diluted with water (100 mL) and extracted with CH2Cl2 (30 mL × 3). The combined organic phases were dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain a residue, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 20 / 1) to give 3-butylheptane-1-thiol (3.30 g, 17.5 mmol, 6.34% yield) as a pale yellow oil. 1H NMR： (400 MHz, CDCl3). δ 2.45–2.57 (m, 2H), 1.52–1.61 (m, 2H), 1.44 (s, 1H), 1.19–1.33 (m, 12H), 0.87–0.93 (m, 6H).

[0289] Synthesis of 2,3-bis[(3-butylheptyl)thio]propyl 7-bromoheptanoic acid

[0290]

[0291] To a solution of 3-butylheptane-1-thiol (0.60 g, 2.43 mmol) and prop-2-yn-1-yl 7-bromoheptanoate (1.37 g, 7.28 mmol) in 1,4-dioxane (10 mL), azobisisobutyronitrile (AIBN, 79.7 mg, 486 μmol, 0.2 equivalents) was added at 25 °C. The mixture was stirred at 100 °C for 13 h. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the reaction was complete. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 20 / 1) to give (E)-3-((3-butylheptyl)thio)allyl 7-bromoheptanoate (1.00 g, 2.30 mmol, 94.7% yield) as a yellow oil.1H NMR (400 MHz, CDCl3) δ 6.17–6.44(m, 1H), 5.53–5.74 (m, 1H), 4.53–4.73 (m, 2H), 3.36–3.46 (m, 2H), 2.65–2.73(m, 2H), 2.29–2.36 (m, 2H), 1.82–1.92 (m, 2H), 1.58–1.72 (m, 4H), 1.20–1.30 (m, 17H), 0.89–0.92 (m, 6H).

[0292] A mixture of (E)-3-((3-butylheptyl)thio)allyl 7-bromoheptanoate (842 mg, 1.93 mmol) and 3-butylheptane-1-thiol (728 mg, 3.86 mmol) in 1,4-dioxane (6.0 mL) was added to azobisisobutyronitrile (AIBN, 70.0 mg, 426 μmol), and the mixture was stirred at 100 °C for 12 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 20:1) showed that the starting material had been completely consumed and a new spot had formed. The reaction was concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 12 g SepaFlash® silica gel column, eluent 0-2% ethyl acetate / petroleum ether gradient, flow rate 20 mL / min) to give 2,3-bis[(3-butylheptyl)thio]propyl 7-bromoheptanoic acid (1.00 g, 1.60 mmol, 82.9% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.34–4.41 (m, 1H), 4.24–4.31 (m,1H), 3.42 (d, J = 6.8 Hz, 2H), 2.98–3.07 (m, 1H), 2.81 (d, J = 6.4 Hz, 2H),2.54–2.63 (m, 3H), 2.37 (t, J = 7.2 Hz, 2H), 1.80–1.93 (m, 2H), 1.60–1.70 (m,2H), 1.52–1.60 (m, 5H), 1.36–1.51 (m, 6H), 1.23–1.34 (m, 24H), 0.87–0.95 (m,12H).

[0293] Synthesis of Compound 15

[0294]

[0295] A mixture of nonyl 8-((2-hydroxyethyl)amino)octanoate (200 mg, 607 μmol), 2,3-bis[(3-butylheptyl)thio]propyl 7-bromoheptanoate (450 mg, 721 μmol), and DIEA (163 mg, 1.26 mmol) in EtOH (2.00 mL) was stirred at 90 °C for 12 h. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed a new spot. The mixture was diluted with EtOAc (20 mL), washed with water, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 4 g SepaFlash® silica gel column, eluent gradient of 0–3% MeOH / CH2Cl2, flow rate 20 mL / min) to give target compound 15 (243 mg, purity 98.7%, yield 45.9%) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.30–4.39 (m, 1H), 4.21–4.29 (m, 1H), 4.05 (t, J = 6.8 Hz, 2H), 3.56 (br s, 2H), 2.94–3.05 (m, 1H), 2.79 (d, J = 6.8 Hz,2H), 2.40–2.67 (m, 10H), 2.26–2.36 (m, 4H), 1.58–1.66 (m, 6H), 1.39–1.56 (m,10H), 1.20–1.36 (m, 47H), 0.81–0.95 (m, 15H).

[0296] Compound 16: 3-Butylheptyl octanoate of 8-[7-(2,3-bis[(3-butylheptyl)thio]propoxy)-7-oxoheptyl)(2-hydroxyethyl)amino]octanoate

[0297] Synthesis of 3-butylheptyl 8-bromooctanoate

[0298]

[0299] To a solution of 8-bromooctanoic acid (1.00 g, 4.48 mmol) and 3-butylheptane-1-ol (772 mg, 4.48 mmol) in DCM (6.00 mL), EDCI (1.29 g, 6.72 mmol) and DMAP (109 mg, 896 μmol) were added. The mixture was stirred at 20°C for 3 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the reaction was complete. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 20 / 1) to give 3-butylheptyl 8-bromooctanoic acid (1.30 g, 3.44 mmol, 76.8% yield) as a colorless oil. 1H NMR (400MHz, CDCl3): δ 4.09 (t, J = 7.2 Hz, 2H), 3.41 (t, J = 7.2 Hz, 2H), 2.30 (t, J =7.2 Hz, 2H), 1.81–1.91 (m, 2H), 1.53–1.66 (m, 5H), 1.18–1.48 (m, 19H), 0.85–0.94 (m, 6H).

[0300] Synthesis of 3-butylheptyl ester of 8-[(2-hydroxyethyl)amino]octanoic acid

[0301]

[0302] A solution of 3-butylheptyl 8-bromooctanoate (2.50 g, 6.62 mmol) and 2-aminoethanol-1-ol (4.05 g, 66.2 mmol) in EtOH (25.0 mL) was stirred at 75 °C for 2 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the starting material was completely consumed and a new spot was formed. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (SiO2, dichloromethane:methanol = 1 / 0 to 100 / 15) to give 3-butylheptyl 8-[(2-hydroxyethyl)amino]octanoate (1.20 g, 3.36 mmol, 50.6% yield) as a colorless oil. 1H NMR(400 MHzCDCl3)δ 4.09 (t, J = 7.2 Hz, 2H), 3.65 (t, J = 5.2 Hz, 2H), 2.75–2.83 (m,2H), 2.62 (t, J = 7.2 Hz, 2H), 2.29 (t, J = 7.2 Hz, 2H), 1.55–1.68 (m, 4H), 1.45–1.54 (m, 2H), 1.18–1.39 (m, 19H), 0.90 (t, J = 6.8 Hz, 6H).

[0303] Synthesis of Compound 16

[0304]

[0305] 3-Butylheptyl 8-[(2-hydroxyethyl)amino]octanoic acid (280 mg, 783 μmol), 2,3-bis[(3-butylheptyl)thio]propyl 7-bromoheptanoic acid (550 mg, 882 μmol), and DIEA (0.3 mL, 1.72 mmol) were added to a mixture in EtOH (3.00 mL), and the mixture was stirred at 90 °C for 12 hours. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed the formation of a new spot. The mixture was diluted with EtOAc (20 mL), washed with water, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 4 g SepaFlash® silica gel rapid column, eluent 0-3% MeOH / CH2Cl2 gradient, flow rate 20 mL / min) to give target compound 16 as a light yellow oil (236 mg, 259 μmol, 33.0% yield, purity 98.67%). 1H NMR (400 MHz, CDCl3): δ 4.30–4.39 (m, 1H), 4.20–4.29 (m, 1H), 4.08 (t, J = 7.2 Hz, 2H), 3.71 (br s, 2H), 2.94–3.06 (m,1H), 2.75–2.88 (m, 4H), 2.62–2.74 (m, 3H), 2.46–2.58 (m, 4H), 2.25–2.36 (m,4H), 1.48–1.69 (m, 15H), 1.20–1.42 (m, 50H), 0.89 (t, J = 6.4 Hz, 18H).

[0306] Compound 17: 3-Butylheptyl octanoate of 8-[[7-[2,3-bis[(3-butylheptyl)thio]propoxy]-7-oxoheptyl][3-[[2-(methylamino)-3,4-dioxocyclobut-1-en-1-yl]amino]propyl]amino]octanoate

[0307] Synthesis of (3-aminopropyl)carbamate benzyl ester

[0308]

[0309] A 500 mL three-necked round-bottom flask equipped with a magnetic stirrer, dropping funnel, and thermometer. To a solution of tert-butyl (3-aminopropyl)carbamate (20.0 g, 115 mmol, 20.0 mL, 1.0 equivalent) in THF (120 mL) and H₂O (80.0 mL), K₂CO₃ (23.8 g, 172 mmol, 1.5 equivalent) and Cb₂Cl (29.4 g, 172 mmol, 24.5 mL, 1.5 equivalent) were added at 0 °C. The mixture was stirred at 0–15 °C for 40 min. The residue was diluted with water (100 mL) and extracted with EtOAc (100 mL, 50.0 mL, 25.0 mL). The combined organic phases were washed with brine (20.0 mL), dried, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether: ethyl acetate = 20 / 1 to 10 / 1). This yielded a yellow oily product of benzyl tert-butyl propane-1,3-dimethyldicarbamate (42.0 g, crude). 1H NMR (400 MHz, CDCl3) δ 7.29–7.38 (m, 5 H), 5.26 (s, 1 H), 5.10 (s, 2 H), 4.83 (s, 1 H), 3.17–3.27 (m, 4 H), 1.60–1.66 (m, 4 H), 1.44 (s, 9 H).

[0310] A 100 mL three-necked round-bottom flask equipped with a magnetic stirrer, dropping funnel, and thermometer. A solution of propane-1,3-dimethyldicarbamate benzyl tert-butyl ester (20.0 g, 64.9 mmol, 1.0 equivalent) in DCM (120 mL) was added at 0°C. o TFA (92.4 g, 810.3 mmol, 60.0 mL, 12.5 equivalents) was added at C. The mixture was then heated at 20°C. oThe mixture was stirred at C for 2 hours. The reaction was quenched by the slow addition of approximately 200 mL of saturated sodium bicarbonate aqueous solution at 0˚C, followed by extraction with EtOAc / THF (2 / 1, 100 mL × 5). The organic phase was separated, washed with saturated sodium bicarbonate aqueous solution, adjusted to pH 7–8 with 0.1 N sodium hydroxide solution, washed with brine (20.0 mL), dried, filtered, and concentrated under reduced pressure to obtain the residue. The residue was not purified. A green oily product of (3-aminopropyl)carbamate (11.2 g, crude) was obtained. 1H NMR (400 MHz, CDCl3) δ 7.28–7.41 (m, 5 H), 5.38 (s, 1 H), 5.05–5.13 (m, 2 H), 3.27–3.28 (m, 2 H), 2.92 (s, 2 H), 2.75–2.81 (m, 2 H), 1.63–1.68 (m, 2 H).

[0311] Synthesis of 3-butylheptyl octanoate of 8-[[3-[(benzyloxycarbonyl)amino]propyl]amino]octanoate

[0312]

[0313] To a solution of (3-aminopropyl)carbamate (4.54 g, 18.5 mmol) in EtOH (30 mL), 3-butylheptyl 8-bromooctanoate (1.40 g, 3.71 mmol) and DIEA (2.40 g, 18.5 mmol, 3.23 mL) were added. The mixture was then stirred at 75 °C for 12 hours. Thin-layer chromatography (CH2Cl2: MeOH = 10 / 1, R...) was performed. f = 0.13) indicates that the reaction was complete. The residue was diluted with water (20.0 mL) and extracted with EtOAc (20.0 mL × 2). The combined organic phases were washed with brine (30.0 mL), dried, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by rapid silica gel column chromatography (ISCO®; 4 g SepaFlash® silica gel column, eluent 0–2% MeOH:CH2Cl2, flow rate 15 mL / min) to give 3-butylheptyl 8-[[3-[(benzyloxycarbonyl)amino]propyl]amino]octanoic acid (1.10 g, 58.7% yield) as a colorless oil. 1H NMR:(400 MHz, CDCl3) δ 7.29–7.39 (m, 5H), 5.06–5.12 (m, 2H), 4.09 (t, J = 7.2Hz, 2H), 3.30 (d, J = 4.4 Hz, 2H), 2.69 (t, J = 6.4 Hz, 2H), 0.90 (t, J = 6.8 Hz, 6H).

[0314] Synthesis of 3-butylheptyl octanoate of 8-[[3-[(benzyloxycarbonyl)amino]propyl][7-[2,3-bis[(3-butylheptyl)thio]propoxy]-7-oxoheptyl]amino]octanoate

[0315]

[0316] To a solution of 3-butylheptyl octanoate (800 mg, 1.58 mmol) in EtOH (2 mL), 2,3-bis[(3-butylheptyl)thio]propyl 7-bromoheptanoate (915 mg, 1.58 mmol) and DIEA (409 mg, 3.17 mmol, 552 μL) were added. The mixture was then stirred at 90 °C for 12 hours. Thin-layer chromatography (CH2Cl2: MeOH = 10 / 1, R f = 0.43) indicates that the reaction was complete. The residue was diluted with water (20.0 mL) and extracted with CH2Cl2 (20.0 mL × 2). The combined organic phases were washed with brine (30.0 mL), dried, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by rapid silica gel column chromatography (ISCO®; 4 g SepaFlash® silica gel column, eluent 0~20% MeOH:CH2Cl2, flow rate 15 mL / min) to give 3-butylheptyl octanoate (900 mg, 56.7% yield) as a colorless oil. 1H NMR(400 MHz, CDCl3) δ 7.29–7.42 (m, 5H), 6.80 (br s, 1H), 5.06 (s, 2H), 4.30–4.36 (m, 1H), 4.20–4.28 (m, 1H), 4.07 (t, J = 7.2 Hz, 2H),3.10–3.25 (m, 2H), 2.92–3.08 (m, 1H), 2.72–2.86 (m, 4H), 2.46–2.72 (m, 6H),2.24–2.36 (m, 4H), 1.47–1.69 (m, 17H), 1.20–1.43 (m, 50H), 0.88 (t, J = 6.4Hz, 18H).

[0317] Synthesis of 3-butylheptyl octanoate of 8-[(3-aminopropyl)[7-[2,3-bis[(3-butylheptyl)thio]propoxy]-7-oxoheptyl]amino]octanoate

[0318]

[0319] A THF (10 mL) solution of 3-butylheptyl octanoate (1.1 g, 1.10 mmol) of 8-[[3-[(benzyloxycarbonyl)amino]propyl][7-[2,3-bis[(3-butylheptyl)thio]propoxy]-7-oxoheptyl]amino]octanoate was added to Pd / C (0.11 g, 0.13 mmol) under N2 atmosphere. The suspension was evacuated and purged three times with H2. The mixture was stirred at 25 °C for 12 h under H2 (15 Psi) atmosphere. Thin-layer chromatography (CH2Cl2: MeOH = 10 / 1, R f = 0.32) indicates that the reaction is complete. The reaction mixture was filtered, and the filtrate was concentrated to give 3-butylheptyl 8-[(3-aminopropyl)[7-[2,3-bis[(3-butylheptyl)thio]propoxy]-7-oxoheptyl]amino]octanoic acid (900 mg, 94.4% yield) as a colorless oil. 1 H NMR: (400MHz, CDCl3): δ 4.31–4.37 (m, 1H), 4.21–4.29 (m, 1H), 4.08 (t, J = 7.2 Hz, 2H), 2.93–3.06 (m, 1H), 2.73–2.88 (m, 6H), 2.61–2.74 (m, 6H), 2.45–2.59 (m, 4H), 2.23–2.37 (m, 4H), 1.46–1.68 (m, 15H), 1.21–1.42 (m, 50H), 0.88 (t, J = 6.4Hz, 18H).

[0320] Synthesis of Compound 17

[0321]

[0322] A mixture of 3,4-dimethoxycyclobut-3-en-1,2-dione (213 mg, 1.50 mmol) and 8-[(3-aminopropyl)[7-[2,3-bis[(3-butylheptyl)thio]propoxy]-7-oxoheptyl]amino]octanoic acid 3-butylheptyl ester (0.87 g, 1.00 mmol) in THF (9 mL) was stirred at 25 °C for 1 hour. Methylamine (2 M, 5.01 mL) was then added, and the reaction mixture was stirred at 25 °C for 24 hours. Thin-layer chromatography (CH2Cl2: MeOH = 10 / 1, R f = 0.43) indicates that the reaction was complete. The reaction mixture was concentrated under reduced pressure. The residue was purified by rapid silica gel column chromatography (ISCO®; 4 g SepaFlash® silica gel column, eluent gradient of 0–9% MeOH / CH2Cl2, flow rate 15 mL / min) to give compound 17 (400 mg, yield 40.8%) as a yellow oil. 1HNMR (400 MHz, CDCl3): δ 4.31–4.38 (m, 1H), 4.22–4.29 (m, 1H), 4.09 (t, J = 7.2 Hz, 2H), 2.75–3.06 (m, 10H), 2.62–2.75 (m, 3H), 2.44–2.58 (m, 6H), 2.24–2.36 (m, 4H), 1.21–1.69 (m, 66H), 0.89 (t, J = 6.4 Hz, 18H).

[0323] Compound 18: 2,3-bis[(3-butylheptyl)thio]propyl 7-[(6-[(3-butylheptyl)oxy]-6-oxohexyl)(2-hydroxyethyl)amino]heptanoic acid

[0324] Synthesis of 3-butylheptyl ester of 6-[(2-hydroxyethyl)amino]hexanoic acid

[0325]

[0326] EDCI (4.84 g, 25.3 mmol) and DMAP (411 mg, 3.37 mmol) were added to a solution of 3-butylhept-1-ol (2.90 g, 16.8 mmol) and 6-bromohexanoic acid (4.92 g, 25.3 mmol) in CH2Cl2 (18.0 mL). The mixture was stirred at 20 °C for 12 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1, raw material: R) was performed. f =0.18; Product: R f =0.60) indicates that 6-bromohexanoic acid was completely consumed. The residue was diluted with water (20 mL) and extracted with CH2Cl2 (20 mL × 3). The combined organic layers were washed with saturated brine (30 mL × 3), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether:ethyl acetate = 80 / 1 to 60 / 1). 3-Butylheptyl 6-bromohexanoate (4.1 g, 11.7 mmol, yield 69.7%) was given as a colorless oil. 1H NMR (400 MHz, CDCl3) δ 4.10 (t, J = 7.2 Hz, 2H), 3.41 (t, J = 6.8 Hz, 2H), 2.32 (t, J = 7.2 Hz, 2H), 1.89 (m, 2H), 1.63–1.72 (m, 2H), 1.54–1.62 (m, 2H), 1.45–1.53 (m, 2H), 1.36–1.44 (m, 1H), 1.19–1.35 (m, 12H), 0.87–0.93 (m, 6H).

[0327] 2-Aminoethanol (6.61 g, 108 mmol, 6.53 mL) was added to a solution of 3-butylheptyl 6-bromohexanoate (1.26 g, 3.61 mmol) in EtOH (25 mL). The mixture was stirred at 75 °C for 1 hour. The residue was diluted with water (20 mL) and extracted with EtOAc (20 mL × 3 mL). The combined organic layers were washed with saturated brine (20 × 3 mL), dried, filtered, and concentrated under reduced pressure to give the residue. 3-Butylheptyl 6-[(2-hydroxyethyl)amino]hexanoate (1.11 g, crude) was given as a colorless oil.

[0328] Synthesis of Compound 18

[0329]

[0330] Compound 18 was prepared in a similar manner to compound 16, but using 3-butylheptyl 6-[(2-hydroxyethyl)amino]hexanoic acid. 1H NMR (400 MHz, CDCl3) δ 4.31–4.40 (m, 1H), 4.19–4.28 (m, 1H), 4.07 (t, J = 7.2 Hz, 2H), 3.70 (br s, 2H), 2.92–3.05 (m, 1H), 2.72–2.89 (m, 4H), 2.61–2.75 (m, 3H), 2.45–2.58 ( m, 4H), 2.23–2.37 (m, 4H), 1.47–1.68 (m, 15H), 1.21–1.43 (m, 46H), 0.88 (t, J = 6.4 Hz, 18H).

[0331] Compound 19: 3-propylhexyl octanoate of 8-[7-[2,3-bis[(3-butylheptyl)thio]propoxy]-7-oxoheptyl)(2-hydroxyethyl)amino]octanoate

[0332]

[0333] Compound 19 was synthesized using a similar procedure to that of compound 16, but with the use of 2,3-bis((3-butylheptyl)thio)propyl 7-bromoheptanoate and 3-propylhexyl 8-((2-hydroxyethyl)amino)octanoate. Compound 065 was obtained as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.28–4.38 (m, 1H), 4.21–4.26 (m, 1H), 4.05 (t, J = 7.2 Hz, 2H), 3.70 (br s, 2H), 2.92–3.04 (m, 1H), 2.73–2.84 (m, 4H), 2.61–2.71 (m, 3H), 2.45–2.55 ( m, 4H), 2.24–2.33 (m, 4H), 1.44–1.67 (m, 15H), 1.21–1.45 (m, 46H), 0.86 (t, J = 6.4 Hz, 18H).

[0334] Compound 20: 3-propylhexyl octanoate of 8-[7-[2,3-bis[(3-propylhexyl)thio]propoxy]-7-oxohepyl)(2-hydroxyethyl)amino]octanoate

[0335]

[0336] Compound 20 was synthesized using a similar procedure to that of compound 16, with 3-propylhexyl-1-ol used instead of 3-butylheptyl-1-ol as the starting material. Compound 20 was obtained as a yellow oil.1H NMR (400 MHz, CDCl3) δ 4.25–4.37 (m, 1H), 4.22–4.25 (m, 1H), 4.04 (t, J = 7.2 Hz, 2H), 3.72 (br s, 2H), 2.90–3.06 (m, 1H), 2.69–2.85 (m, 4H), 2.63–2.70 (m, 3H), 2.43–2.58 ( m, 4H), 2.23–2.35 (m, 4H), 1.43–1.68 (m, 15H), 1.23–1.48 (m, 38H), 0.88 (t, J = 6.4 Hz, 18H).

[0337] Compound 21: 8-[(7-[2,3-bis[(3,7-dimethyloctyl)thio]propoxy]-7-oxoheptyl)(2-hydroxyethyl)amino]nonyl octanoate

[0338] Synthesis of 3,7-dimethyloctane-1-thiol

[0339]

[0340] Potassium thioacetate (11.4 g, 99.8 mmol) was added to a solution of 1-bromo-3,7-dimethyloctane (20.0 g, 90.4 mmol) in acetone (600 mL), and the mixture was stirred at 20 °C for 12 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 20:1) showed that the starting material was completely consumed. The reaction mixture was diluted with water (200 mL) and then extracted with CH2Cl2 (200 mL × 2). The combined organic phases were washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum to give a colorless oil (19.0 g, 87.8 mmol, yield 97.1%). The colorless oil (19.0 g, 87.8 mmol) was dissolved in MeOH (190 mL), and 20% aqueous NaOH (19.0 mL) was added. The mixture was stirred at 20 °C for 2 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 20:1) showed that the starting material had been completely consumed and a new spot had formed. The pH was adjusted to 6 with HCl (1 N), followed by extraction with CH₂Cl₂ (50 mL × 2). The combined organic phases were washed with saturated brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 80 g SepaFlash® silica gel column, eluent 0–0% ethyl acetate / petroleum ether gradient, flow rate 50 mL / min) to give 3,7-dimethyloctane-1-thiol (17.0 g, 97.5 mmol) as a colorless oil. 1H NMR：(400 MHz, CDCl3). δ2.43–2.64 (m, 2H), 1.44–1.67 (m, 4H), 1.20–1.34 (m, 4H), 1.05–1.18 (m, 3H), 0.87 (d, J =6.8 Hz, 9H).

[0341] Synthesis of 2,3-bis[(3,7-dimethyloctyl)thio]propyl 7-bromoheptanoate

[0342]

[0343] To a solution of 3,7-dimethyloctane-1-thiol (10.0 g, 57.4 mmol) in 1,4-dioxane (30 mL), propan-2-yn-1-yl 7-bromoheptane ester (4.70 g, 19.0 mmol) was added, and the mixture was stirred at 25 °C for 1 hour. AIBN (625 mg, 3.81 mmol) was then added to the mixture, and stirring was continued at 100 °C for 2 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 20:1) showed that the starting material had been completely consumed. The reaction mixture was diluted with CH₂Cl₂ (100 mL), washed with saturated brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 80 g SepaFlash® silica gel column, eluent 0–5% ethyl acetate / petroleum ether gradient, flow rate 55 mL / min) to give 2,3-bis[(3,7-dimethyloctyl)thio]propyl 7-bromoheptanoate (10.0 g, 16.8 mmol, yield 88.1%) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.31–4.39 (m, 1H), 4.21–4.29 (m, 1H), 3.36–3.56 (m, 2H), 2.95–3.05 (m, 1H), 2.79 (d, J = 6.8 Hz, 2H), 2.48–2.69 (m, 4H), 2.34 (t, J = 7.2 Hz, 2H), 1.74–1.91 (m, 2H), 1.57–1.69 (m, 4H), 1.47–1.56 (m, 5H), 1.33– 1.45 (m, 5H), 1.20–1.33 (m, 6H), 1.05–1.19 (m, 6H), 0.83–0.91 (m, 18H).

[0344] Synthesis of Compound 21

[0345]

[0346] A solution of 2,3-bis[(3,7-dimethyloctyl)thio]propyl 7-bromoheptanoate (1.40 g, 2.35 mmol), nonyl-8-((2-hydroxyethyl)amino)octanoate (600 mg, 1.82 mmol), and DIEA (0.64 mL, 3.67 mmol) in EtOH (6.00 mL) was stirred at 90 °C for 12 h. Thin-layer chromatography (CH₂Cl₂: MeOH = 10:1) showed that the starting materials had been completely consumed and a new spot had formed. The reaction solution was diluted with EtOAc (30 mL), washed with water, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica column chromatography (ISCO®; 12 g SepaFlash® silica column, eluent 0–4% MeOH / CH2Cl2 gradient, flow rate 30 mL / min) to give title compound 21 (360 mg, 424 μmol, yield 23.3%, purity 99.37%) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ 4.31–4.40 (m, 1H), 4.20–4.29 (m, 1H), 4.05 (t, J = 6.8 Hz, 2H), 3.56 (t, J = 4.8 Hz, 2H), 2.95–3.04 (m, 1H), 2.78 (d, J = 6.8 Hz, 2H), 2.45–2.68 (m, 11H), 2.26–2.36 (m, 4H), 1.57–1.66 (m, 8H), 1.41– 1.56 (m, 10H), 1.24–1.36 (m, 28H), 1.08–1.17 (m, 6H), 0.84–0.90 (m, 21H).

[0347] Compound 22: 2,3-bis[(3,7-dimethyloctyl)thio]propyl 7-[(6-[(3-butylheptyl)oxy]-6-oxohexyl)(2-hydroxyethyl)amino]heptanoic acid

[0348] Synthesis of 3-butylheptyl ester of 6-[(2-hydroxyethyl)amino]hexanoic acid

[0349]

[0350] A mixture of 6-bromohexanoic acid (300 mg, 1.54 mmol) and 3-butylhept-1-ol (292 mg, 1.69 mmol) in CH₂Cl₂ (2 mL) was added with DMAP (38.0 mg, 311 μmol) and EDCI (442 mg, 2.31 mmol) at 0°C, and the mixture was stirred at 20°C for 3 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the starting material was completely consumed and a new spot was formed. The reaction solution was concentrated under vacuum to give a residue, which was purified by rapid silica gel column chromatography (ISCO®; 4+4 g SepaFlash® silica gel column, eluent of 0–10% ethyl acetate / petroleum ether gradient, flow rate 20 mL / min) to give 3-butylheptyl-6-bromohexanoate (467 mg, 1.34 mmol, yield 86.9%) as a colorless oil. 1H NMR (400 MHz, CDCl3). δ 4.09 (t, J = 7.2 Hz, 2H), 3.40 (t, J = 6.8 Hz, 2H), 2.31 (t, J = 7.2 Hz, 2H), 1.83–1.92 (m, 2H), 1.61–1.70 (m, 2H), 1.57 (q, J = 6.8 Hz, 2H), 1.45–1.52 (m, 2H), 1.36–1.43 (m, 1H), 1.21–1.32 (m, 12H), 0.89 (t, J = 6.4 Hz, 6H).

[0351] A solution of 3-butylheptyl 6-bromohexanoate (360 mg, 1.03 mmol, 1 equivalent) and 2-aminoethanol-1-ol (1.82 g, 29.8 mmol, 30 equivalent) in EtOH (4.0 mL) was stirred at 85 °C for 2 h. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the starting material was completely consumed. The reaction solution was diluted with EtOAc (20 mL), washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 4 g SepaFlash® silica gel column, eluent gradient of 0–15% MeOH / CH2Cl2, flow rate 20 mL / min) to give 3-butylheptyl 6-[(2-hydroxyethyl)amino]hexanoate (250 mg, 759 μmol, yield 73.6%) as a yellow oil. 1H NMR(400 MHz, CDCl3). δ 4.08 (t, J = 7.2 Hz, 2H), 3.65 (t, J = 5.2 Hz, 2H), 2.79 (t, J = 5.2Hz, 2H), 2.64 (t, J = 7.2 Hz, 2H), 2.30 (t, J = 7.2 Hz, 2H), 2.09 (br s, 2H), 1.48–1.69 (m, 6H), 1.33–1.43 (m, 3H), 1.20–1.32 (m, 12H), 0.89 (t, J = 6.8 Hz, 6H).

[0352] Synthesis of Compound 22

[0353]

[0354] A solution of 3-butylheptyl 6-[(2-hydroxyethyl)amino]hexanoate (245 mg, 744 μmol), 2,3-bis[(3,7-dimethyloctyl)thio]propyl 7-bromoheptanoate (665 mg, 1.12 mmol), and DIEA (0.26 mL, 1.49 mmol) in EtOH (5.00 mL) was stirred at 90 °C for 12 hours. Thin-layer chromatography (CH₂Cl₂: MeOH = 8:1) showed that the starting materials were completely consumed. The reaction solution was diluted with EtOAc (30 mL), washed with water, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 4 g SepaFlash® silica gel rapid column, eluent 0-5% MeOH / CH2Cl2 gradient, flow rate 20 mL / min) to give title compound 22 (230 mg, 269 μmol, yield 36.2%, purity 98.9%) as a yellow oil. 1H NMR (400 MHz, CDCl3). δ 4.31–4.39 (m, 1H), 4.20–4.28 (m, 1H), 4.08 (t, J = 7.2 Hz, 2H), 3.56 (br s, 2H), 2.95–3.05 (m, 1H), 2.79 (d, J = 6.8 Hz, 2H), 2.42–2.68 (m, 10H), 2.26–2.36 (m, 4H), 1.38–1.68 (m, 20H), 1.20–1.36 (m, 24H), 1.05–1.18 (m, 6H), 0.79–0.96 (m, 24H).

[0355] Compound 23: 2,3-bis(pentylthio)propyl octanoate of 8-[(2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino]octanoate

[0356] Synthesis of 2,3-bis(pentylthio)propyl 8-bromooctanoic acid

[0357]

[0358] To a solution of propargyl-1-ol (3.79 g, 67.6 mmol, 3.99 mL, 1.26 equivalents) in DCM (80 mL), 8-bromooctanoic acid (12 g, 53.8 mmol, 1.0 equivalents), EDCI (15.5 g, 80.7 mmol, 1.5 equivalents), and DMAP (1.31 g, 10.8 mmol, 0.2 equivalents) were added at 0°C, and the mixture was then stirred at 25°C for 1.5 hours. Thin-layer chromatography (petroleum ether / ethyl acetate = 5 / 1, product R) was performed. f = 0.45) indicates that the reaction was complete. The reaction mixture was poured into water (50 mL) and extracted with EtOAc (50 mL, 30 mL, 20 mL). The combined organic layers were washed with saturated brine (30 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 1 to 0 / 1) to give 8-bromooctanoic acid prop-2-yn-1-yl ester (11.5 g, 44.0 mmol, yield 81.8%) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ 4.68 (d, J = 2.8 Hz, 2H), 3.41 (t, J = 6.8 Hz, 2H), 2.47 (t, J = 2.4 Hz, 1H), 2.36 (t, J = 7.2 Hz, 2H), 1.84–1.88 (m, 2H), 1.62–1.67 (m, 2H), 1.41–1.48 (m, 2H), 1.33–1.35 (m, 4H).

[0359] To a solution of 8-bromooctanoic acid prop-2-yn-1-yl ester (6.2 g, 23.7 mmol, 1.0 equivalent) in dioxane (40 mL), pentane-1-thiol (7.42 g, 71.2 mmol, 3.0 equivalent) was added, and the solution was stirred at 25–100 °C for 1 hour. AIBN (390 mg, 2.37 mmol, 0.1 equivalent) was then added, and the mixture was stirred at 100 °C for 12 hours. Thin-layer chromatography (petroleum ether / ethyl acetate = 50 / 1, product R) was performed. f= 0.35) indicates that the reaction has been completed. The reaction mixture was concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 50 / 1) to give 2,3-bis(pentylthio)propyl 8-bromooctanoate (7.7 g, 16.4 mmol, yield 69.0%) as a yellow oil. 1H NMR (400MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.6 Hz, 1H), 4.25 (dd, J = 6.4, 11.2 Hz, 1H), 3.41 (t, J = 6.8 Hz, 2H), 2.97–3.03 (m, 1H), 2.79 (d, J = 7.2 Hz, 2H), 2.54–2.63 (m, 4H), 2.34 (t, J = 7.2 Hz, 2H), 1.84–1.89 (m, 2H), 1.55–1.66 (m, 8H), 1.32–1.39 (m, 15H), 0.91 (t, J = 7.2Hz, 6H).

[0360] Synthesis of 2,3-bis(pentylthio)propyl 8-[(2-hydroxyethyl)amino]octanoic acid

[0361]

[0362] 2,3-bis(pentylthio)propyl 8-bromooctanoate (7.7 g, 16.4 mmol, 1.0 equivalent) and 2-aminoethanol-1-ol (3.0 g, 49.2 mmol, 2.98 mL, 3.0 equivalent) were dissolved in MeCN (50 mL) at 25°C, and the mixture was then stirred at 90°C for 24 hours. Thin-layer chromatography (dichloromethane / methanol = 7 / 1, product R) was performed. f = 0.20) indicates that the reaction is complete. The reaction mixture was poured into water (50 mL) and extracted with EtOAc (50 mL, 30 mL, 20 mL). The combined organic layers were washed with 20 mL of saturated brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative thin-layer chromatography (SiO2, dichloromethane / methanol = 5 / 1) to give 2,3-bis(pentylthio)propyl 8-[(2-hydroxyethyl)amino]octanoic acid (5 g, 11.12 mmol, yield 67.80%) as a yellow oil. 1H NMR(400 MHz, CDCl3) δ 4.35 (dd, J =5.2, 11.2 Hz, 1H), 4.23 (dd, J = 6.4, 11.2 Hz, 1H), 3.64 (t, J = 5.2 Hz, 2H), 2.97–3.03 (m, 1H), 2.77–2.80 (m, 4H), 2.54–2.64 (m, 6H), 2.33 (t, J = 7.6 Hz, 2H), 1.99 (brs, 3H), 1.56–1.65 (m, 6H), 1.48–1.52 (m, 2H), 1.30–1.39 (m, 14H), 0.90 (t, J = 6.8 Hz, 6H).

[0363] Synthesis of Compound 23

[0364]

[0365] To a solution of 2,3-bis(pentylthio)propyl 8-[(2-hydroxyethyl)amino]octanoic acid (500 mg, 1.11 mmol, 1.0 equivalent) and undecyl 6-bromohexanoate (388.38 mg, 1.11 mmol, 1.0 equivalent) in EtOH (5 mL), DIEA (287 mg, 2.22 mmol, 387 μL, 2.0 equivalent) was added at 25°C, and the mixture was then stirred at 90°C for 12 hours. Thin-layer chromatography (dichloromethane / methanol = 10 / 1, product R) was performed. f = 0.40) indicates that the reaction was complete. The reaction mixture was poured into water (5 mL) and extracted with ethyl acetate (EtOAc, 5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to THF / EtOH = 5 / 1) to give compound 23 (270 mg, 375 μmol, 33.8% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.33–4.37 (m, 1H), 4.22–4.26 (m, 1H), 4.06 (t, J = 6.8 Hz, 2H), 3.54 (brs, 2H), 3.00–3.04 (m, 1H), 2.78 (dd, J = 2.0, 6.8 Hz, 2H), 2.54–2.63 (m, 6H), 2.46 (brs, 4H), 2.29–2.33 (m, 4H), 1.58–1.66 (m, 9H), 1.27–1.46 (m, 38H), 0.87–0.92 (m, 9H).

[0366] Compound 24: 2,3-bis(pentathio)propyl octanoic acid 8-[(2-hydroxyethyl)((9Z,12Z)-octadec-9,12-dien-1-yl)amino]octanoic acid

[0367] Synthesis of Compound 24

[0368]

[0369] To a solution of 2,3-bis(pentathio)propyl 8-bromooctanoate (500 mg, 1.11 mmol, 1.0 eq) and (6Z,9Z)-18-bromooctadec-6,9-diene (366 mg, 1.11 mmol, 1.0 eq) in ethanol (EtOH, 5 mL), DIEA (287 mg, 2.22 mmol, 387 μL, 2.0 eq) was added at 25°C, followed by stirring at 90°C for 12 hours. Thin-layer chromatography (TLC, dichloromethane / methanol = 10 / 1, product R) was performed. f = 0.40) indicates that the reaction was complete. The reaction mixture was poured into water (5 mL) and extracted with ethyl acetate (EtOAc, 5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to THF / EtOH = 5 / 1) to give compound 24 (180 mg, 257 μmol, 23.1% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 5.32–5.40 (m, 4H), 4.34–4.39 (m, 1H), 4.22–4.27 (m, 1H), 3.54–3.56 (m, 2H), 2. 97–3.04 (m, 1H), 2.77–2.80 (m, 4H), 2.54–2.63 (m, 5H), 2.46 (brs, 4H), 2.33 (t, J = 7.2 Hz, 2H), 2.06 (q, J = 6.8 Hz, 4H), 1.57–1.65 (m, 6H), 1.29–1.45 (m, 37H), 0.89–0.93 (m, 9H).

[0370] Compound 25: 2,3-bis(heptylthio)propyl octanoate of 8-[(2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino]octanoate

[0371] Synthesis of 2,3-bis(heptylthio)propyl 8-bromooctanoic acid

[0372]

[0373] To a solution of 8-bromooctanoic acid (20.0 g, 89.6 mmol, 1.00 eq) in dichloromethane (DCM, 130 mL), EDCI (25.8 g, 134 mmol, 1.50 eq), DMAP (2.19 g, 17.9 mmol, 0.20 eq), and propargyl-1-ol (6.23 g, 111 mmol, 6.56 mL, 1.24 eq) were added at 0 °C. The mixture was stirred at 25 °C for 1.5 h. Thin-layer chromatography (TLC, petroleum ether / ethyl acetate = 5:1, product R) was performed. f = 0.5) indicates that starting material 1 has reacted completely and a main spot has formed. The reaction mixture was poured into water (50 mL) and extracted with dichloromethane (DCM, 80 mL, 50 mL, 30 mL). The combined organic layers were washed with brine (30 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1:0 to 50:1) to give 8-bromooctanoic acid prop-2-yn-1-yl ester (21.5 g, 82.3 mmol, 91.8% yield) as a clear oil. 1H NMR (400 MHz, CDCl3) δ 4.68 (d, J = 2.4 Hz, 2H), 3.40 (t, J = 6.8 Hz, 2H), 2.47 (t, J = 2.4 Hz, 1H), 2.36 (t, J = 7.6Hz, 2H), 1.82–1.89 (m, 2H), 1.61–1.69 (m, 2H), 1.40–1.47 (m, 2H), 1.32–1.35 (m, 4H).

[0374] To a solution of 8-bromooctanoic acid prop-2-yn-1-yl ester (10.0 g, 38.2 mmol, 1.00 eq) in dioxane (70 mL), heptane-1-thiol (15.9 g, 119 mmol, 18.8 mL, 3.13 eq) was added at 25 °C, followed by stirring at 100 °C for 1 h; AIBN (629 mg, 3.83 mmol, 0.10 eq) was then added, and stirring continued at 100 °C for 12 h. Thin-layer chromatography (TLC, petroleum ether: ethyl acetate = 5:1, product R) was performed. f= 0.6) indicates that reactant 1 has reacted completely and a main spot has formed. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 10:1) to give 2,3-bis(heptylthio)propyl 8-bromooctanoate (18.0 g, 34.2 mmol, 89.4% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.28 (dd, J = 5.2, 11.2 Hz, 1H), 4.17 (dd, J = 6.4, 11.6 Hz, 1H), 3.33 (t, J = 6.8 Hz, 2H), 2.89–2.96 (m, 1H), 2.71 (d, J = 6.8 Hz, 2H), 2.46–2.56 (m, 4H), 2.26 (t, J = 7.6 Hz, 2H), 1.75–1.82 (m, 2H), 1.48–1.61 (m, 9H), 1.17–1.41 (m, 24H), 0.82 (t, J = 6.4 Hz, 6H).

[0375] Synthesis of 2,3-bis(heptylthio)propyl 8-[(2-hydroxyethyl)amino]octanoic acid

[0376]

[0377] 2-Aminoethanol (2.79 g, 45.6 mmol, 2.76 mL, 3.00 eq) was added to a solution of 2,3-bis(heptylthio)propyl 8-bromooctanoate (8.00 g, 15.2 mmol, 1.00 eq) in acetonitrile (MeCN, 56 mL). The mixture was stirred at 85°C for 12 hours. Thin-layer chromatography (TLC, dichloromethane:methanol = 5:1, product R) was performed. f (P1) = 0.1, product R f (P2) = 0.39) indicates that 10% of starting material 1 remains, and a new main spot with greater polarity was detected. The reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (EtOAc, 300 mL, 200 mL, 100 mL). The combined organic layers were washed with brine (30 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate to dichloromethane: methanol = 20 / 1 to 1 / 1) to give 2,3-bis(heptylthio)propyl 8-[(2-hydroxyethyl)amino]octanoic acid (3.5 g, 6.92 mmol, 45.4% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.2 Hz, 1H), 4.24 (dd, J = 6.4, 11.2 Hz, 1H), 3.65 (t, J = 5.2 Hz, 2H), 2.97–3.03 (m, 1H), 2.76–2.83 (m, 4H), 2.54–2.65 (m, 6H), 2.33 (t, J = 7.6 Hz, 2H), 2.24 (s, 2H), 1.56–1.65 (m, 6H), 1.45–1.51 (m, 2H), 1.28–1.43 (m, 23H), 0.89 (t, J = 6.4 Hz, 6H).

[0378] Synthesis of Compound 25

[0379]

[0380] To a solution of 2,3-bis(heptylthio)propyl 8-[(2-hydroxyethyl)amino]octanoic acid (600 mg, 1.19 mmol, 1.00 eq) in ethanol (EtOH, 6 mL), undecyl 6-bromohexanoate (497 mg, 1.42 mmol, 1.20 eq) and DIEA (307 mg, 2.37 mmol, 413 μL, 2.00 eq) were added. The mixture was stirred at 85°C for 12 hours. Liquid chromatography-mass spectrometry (LC-MS) was performed on the product R... t = 0.752, MS+1 = 774.6) showed that starting material 1 was completely consumed and a main peak with the target molecular weight was detected. The reaction mixture was poured into water (20 mL) and extracted with ethyl acetate (EtOAc, 50 mL, 30 mL, 20 mL). The combined organic layers were washed with brine (15 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 20 / 1 to 0 / 1) to give compound 25 (180 mg, 232 μmol, 19.6% yield) as a yellow oil. 1H NMR(400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.2 Hz, 1H), 4.24 (dd, J = 6.4, 11.2 Hz, 1H), 4.06 (t, J = 6.8 Hz, 2H), 3.53 (t, J = 4.8 Hz, 2H), 2.97–3.04 (m, 1H), 2.76–2.84 (m, 2H), 2.54–2.64 (m, 6H), 2.44–2.51 (m, 4H), 2.29–2.35 (m, 4H), 1.56–1.68 (m, 10H), 1.21–1.51 (m, 44H), 0.89 (t, J =6.4 Hz, 9H).

[0381] Compound 26: (9Z,12Z)-octadec-9,12-dienoic acid 2-[[8-[2,3-bis(heptylthio)propoxy]-8-oxooctyl][3-(dimethylamino)propyl]amino]ethyl ester

[0382] Synthesis of 2,3-bis(heptylthio)propyl 8-[(3-(dimethylamino)propyl)(2-hydroxyethyl)amino]octanoic acid

[0383]

[0384] N',N'-dimethylpropane-1,3-diamine (1.17 g, 11.4 mmol, 1.43 mL, 3.00 eq) was added to a solution of 2,3-bis(heptylthio)propyl 8-bromooctanoate (2.00 g, 3.80 mmol, 1.00 eq) in acetonitrile (MeCN, 14 mL). The mixture was stirred at 90 °C for 1 hour. Water (30 mL) was added to the reaction mixture, and the mixture was extracted with dichloromethane (DCM, 50 mL, 30 mL). The organic phase was separated, washed with brine (15 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give 2,3-bis(heptylthio)propyl 8-((3-(dimethylamino)propyl)amino)octanoate (1.5 g, crude), as a yellow oil.

[0385] A solution of 2-((tert-butyldimethylsilyl)oxy)acetaldehyde (191 mg, 1.10 mmol, 209 μL, 1.20 eq) and 2,3-bis(heptylthio)propyl-8-((3-(dimethylamino)propyl)amino)octanoate (500 mg, 914 μmol, 1.00 eq) in dichloromethane (DCM, 5 mL) was added. The mixture was stirred at 25 °C for 30 min, followed by the addition of (CH3COO)3BHNa (387 mg, 1.83 mmol, 2.00 eq). The mixture was stirred at 25 °C for 12 h. Water (10 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate (EtOAc, 50 mL, 30 mL). The organic phase was separated, washed with brine (5 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give 2,3-bis(heptylthio)propyl 8-((2-((tert-butyldimethylsilyl)oxy)ethyl)(3-(dimethylamino)propyl)amino)octanoate (800 mg, crude product), which is a yellow oil.

[0386] 2,3-bis(heptylthio)propyl 8-((2-((tert-butyldimethylsilyl)oxy)ethyl)(3-(dimethylamino)propyl)amino)octanoate (800 mg, 1.13 mmol, 1.00 eq) was added to a solution of tetrabutylammonium fluoride (TBAF, 1.00 M, 4.54 mL, 4.00 eq). The mixture was stirred at 25 °C for 12 hours. The reaction mixture was poured into water (20 mL) and extracted with ethyl acetate (EtOAc, 50 mL, 30 mL, 15 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give 2,3-bis(heptylthio)propyl 8-[(3-(dimethylamino)propyl)(2-hydroxyethyl)amino]octanoate (900 mg, crude), as a yellow oil.

[0387] Synthesis of Compound 26

[0388]

[0389] To a solution of compound 77-4-3 (900 mg, 1.52 mmol, 1.00 eq) in dichloromethane (DCM, 9 mL), (9Z,12Z)-octadecanoic acid (512 mg, 1.83 mmol, 512 μL, 1.20 eq), EDCI (438 mg, 2.28 mmol, 1.50 eq), and DMAP (37.2 mg, 304 μmol, 0.20 eq) were added at 0 °C. The mixture was stirred at 25 °C for 3 hours. Liquid chromatography-mass spectrometry (LC-MS) was used to analyze the product R... t = 0.692, MS+1 = 853.7) showed multiple new peaks on the LC-MS chromatogram, and approximately 10% of the target compound was detected. Water (10 mL) was added to the reaction mixture, and it was extracted with ethyl acetate (EtOAc, 50 mL, 30 mL). The organic phase was separated, washed with brine (5 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate to dichloromethane: methanol = 0 / 1 to 0 / 1) to obtain the residue. The residue was purified by preparative high performance liquid chromatography (prep-HPLC) (column: Welch Xtimate C1 100*30mm*5um; mobile phase: [water (TFA)-acetonitrile]; B%: 65%-85%, 8 min) to obtain compound 26 (TFA salt). The pH of the aqueous phase was adjusted to approximately 8–9 with sodium bicarbonate (NaHCO3). The reaction solution was extracted with ethyl acetate (EtOAc, 50 mL, 30 mL), the organic phase was separated, washed with brine (5 mL), dried with anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give compound 26 (70 mg, 83.2 μmol, 5.46% yield), which was a yellow oil. 1H NMR (400 MHz, CDCl3) δ 5.30–5.41 (m, 4H), 4.35 (dd, J = 5.2, 11.2 Hz, 1H), 4.24 (dd, J = 6.4, 11.2 Hz, 1H), 4.12 (t, J = 6.4 Hz, 2H), 2.97–3.04 (m, 1H), 2.76–2.80 (m, 4H), 2.68 (t, J = 6.0 Hz, 2H), 2.43–2.63 (m, 9H), 2.25–2.35 (m, 11H), 2.03–2.08 (m, 4H), 1.56–1.63 (m, 11H), 1.29–1.46 (m, 40H), 0.88–0.90 (m, 9H).

[0390] Compound 27: (9Z,12Z)-octadec-9,12-dienoic acid 2-[(8-(2,3-bis(heptylthio)propoxy)-8-oxooctyl)(2-hydroxyethyl)amino]ethyl ester

[0391] Synthesis of 2,3-bis(heptylthio)propyl 8-[bis(2-hydroxyethyl)amino]octanoic acid

[0392]

[0393] Potassium carbonate (K₂CO₃, 546 mg, 3.95 mmol, 2.00 eq) and 2-bromoethanol (741 mg, 5.93 mmol, 421 μL, 3.00 eq) were added to a solution of 2,3-bis(heptylthio)propyl 8-((2-hydroxyethyl)amino)octanoate (1.00 g, 1.98 mmol, 1.00 eq) in acetonitrile (MeCN, 7 mL). The mixture was stirred at 90 °C for 12 hours. Liquid chromatography-mass spectrometry (LC-MS) was used to analyze the product R... t = 0.486, MS+1 = 550.5) indicates that starting material 1 has been completely consumed, and a main peak with the target molecular weight was detected. The reaction mixture was poured into water (20 mL) and extracted with ethyl acetate (EtOAc, 50 mL, 30 mL, 15 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give 2,3-bis(heptylthio)propyl 8-[bis(2-hydroxyethyl)amino]octanoic acid (1.20 g, crude) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.53 (s, 2H), 4.35 (dd, J = 5.2, 11.2 Hz, 1H), 4.24 (dd, J = 6.4, 11.2 Hz, 1H), 3.63 (t, J = 6.0 Hz, 3H), 2.97–3.03 (m, 1H), 2.79 (dd, J = 1.6, 6.8Hz, 2H), 2.67 (t, J = 5.6 Hz, 3H), 2.52–2.62 (m, 6H), 2.33 (t, J = 7.6 Hz, 2H), 1.56–1.65 (m, 7H), 1.28–1.49 (m, 25H), 0.89 (t, J = 7.2 Hz, 6H).

[0394] Synthesis of Compound 27

[0395]

[0396] To a solution of 2,3-bis(heptylthio)propyl 8-[bis(2-hydroxyethyl)amino]octanoic acid (600 mg, 1.09 mmol, 1.00 eq) in dichloromethane (DCM, 6 mL), (9Z,12Z)-octadec-9,12-dienoic acid (367 mg, 1.31 mmol, 367 μL, 1.20 eq), EDCI (314 mg, 1.64 mmol, 1.50 eq), and DMAP (26.7 mg, 218 μmol, 0.20 eq) were added. The mixture was stirred at 25 °C for 3 hours. Liquid chromatography-mass spectrometry (LC-MS, ET49811-212-P1A1, product Rt = 0.790, MS+1 = 812.6) showed that starter 1 was completely consumed and a main peak with the target molecular weight was detected. The reaction mixture was poured into water (30 mL) and extracted with ethyl acetate (EtOAc, 50 mL, 30 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate (Na₂SO₄), filtered, and concentrated under reduced pressure to give a residue. This residue was purified by column chromatography (SiO₂, petroleum ether / ethyl acetate = 20 / 1 to 0 / 1) to give compound 27 (200 mg, 246 μmol, 22.5% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 5.30–5.42 (m, 4H), 4.35 (dd, J = 5.2, 11.2 Hz, 1H), 4.24 (dd, J = 6.4, 11.2 Hz, 1H), 4.14 (t, J = 6.0 Hz, 2H), 3.55 (t, J = 4.4 Hz, 2H), 2.97–3.03 (m, 1H), 2.76–2.84 (m, 6H), 2.50–2.66 (m, 8), 2.30–2.35 (m, 4H), 2.03–2.08 (m, 4H), 1.56–1.63 (m, 10H), 1.27–1.45 (m, 41H), 0.89 (t, J = 3.6 Hz, 9H).

[0397] Compound 28: 6,6′-[(2-hydroxyethyl)azinediyl]dihexanoate bis[2,3-bis(heptylthio)propyl] ester

[0398] Synthesis of Compound 28

[0399]

[0400] A solution of 2-aminoethanol-1-ol (1.84 g, 30.2 mmol, 1.82 mL, 3.0 eq) and 2,3-bis(heptylthio)propyl 6-bromohexanoate (5 g, 10.1 mmol, 1.0 eq) in acetonitrile (MeCN, 35 mL) was mixed at 25 °C, followed by stirring at 90 °C for 12 hours. Thin-layer chromatography (TLC, dichloromethane / methanol = 7 / 1, product R) was performed. f = 0.20) indicates that the reaction was complete. The reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (EtOAc, 50 mL, 30 mL, 20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to dichloromethane / methanol = 5 / 1) to give 2,3-bis(heptylthio)propyl 6-[(2-hydroxyethyl)amino]hexanoic acid (2.6 g, 5.44 mmol, 54.1% yield) as a yellow oil, and compound 28 (0.51 g, 570 μmol, 5.67% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.34 (dd, J = 4.8, 11.2 Hz, 1H), 4.24 (dd, J = 6.4, 11.2Hz, 1H), 3.69 (t, J = 4.4 Hz, 2H), 2.96–3.03 (m, 2H), 2.77–2.84 (m, 4H), 2.69 (t, J = 7.2Hz, 2H), 2.53–2.62 (m, 4H), 2.34 (t, J = 7.2 Hz, 2H), 1.54–1.70 (m, 8H), 1.27–1.43 (m, 19H), 0.88 (t, J = 6.4 Hz, 6H).

[0401] Compound 29: 6,6′-[(3-hydroxypropyl)azonyl]diahexanoate bis[2,3-bis(heptylthio)propyl] ester

[0402] Synthesis of Compound 29

[0403]

[0404] A solution of (4 g, 8.04 mmol, 1.0 eq) in ethanol (EtOH, 20 mL) and acetonitrile (MeCN, 20 mL) was mixed at 25°C, followed by stirring at 60°C for 4 hours. Thin-layer chromatography (TLC, dichloromethane / methanol = 7 / 1, product R) was performed. f1 = 0.20, Rf2 = 0.52) indicates that the reaction was complete. The reaction mixture was poured into water (30 mL) and extracted with ethyl acetate (EtOAc, 50 mL, 30 mL, 20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to dichloromethane / methanol = 5 / 1) to give compound 29 (0.17 g, 187 μmol, 2.33% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.35 (dd, J = 4.8, 11.2 Hz, 2H), 4.24 (dd, J = 5.4, 11.2 Hz, 2H), 3.79 (t, J = 5.2 Hz, 2H), 2.97–3.03 (m, 2H), 2.78 (d, J = 6.8 Hz, 4H), 2.54–2.67 (m, 10H), 2.33–2.44 (m, 6H), 1.46–1.70 (m, 20H), 1.28–1.39 (m, 38H), 0.90 (t, J = 6.4 Hz, 9H).

[0405] Compound 30: 6,6′-[[3-(dimethylamino)propyl]azinediyl]dihexanoate bis[2,3-bis(heptylthio)propyl] ester

[0406] Synthesis of Compound 30

[0407]

[0408] Triethylamine (TEA, 66.8 mg, 660 μmol, 91.9 μL, 4.0 eq) was added to a solution of compound 29 (150 mg, 165 μmol, 1.0 eq) in dichloromethane (DCM, 5 mL) at 0°C, followed by the addition of p-toluenesulfonyl chloride (TosCl, 62.9 mg, 330 μmol, 2.0 eq) at 0°C. The mixture was stirred at 25°C for 12 hours. Liquid chromatography-mass spectrometry (LCMS, ET50202-252-P1A, product: RT = 0.891 min) showed complete consumption of the starting material. The reaction mixture was poured into water (5 mL) and extracted with dichloromethane (DCM, 5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over anhydrous sodium sulfate (Na2SO4), filtered, and concentrated under reduced pressure to give 6,6′-[(3-chloropropyl)azonyl]dihexanoic acid bis[2,3-bis(heptylthio)propyl] ester (240 mg, crude product), a colorless oil.

[0409] To a solution of bis[2,3-bis(heptylthio)propyl]dihexanoate (240 mg, 259 μmol, 1.0 eq) and sodium iodide (NaI, 19.4 mg, 129 μmol, 0.5 eq) in tetrahydrofuran (THF, 5 mL), N-methylmethylamine (2 M, 647 μL, 5 eq) was added at 25°C, followed by stirring at 80°C for 36 hours. Thin-layer chromatography (TLC, dichloromethane / methanol = 5 / 1) showed trace amounts of bis[2,3-bis(heptylthio)propyl]dihexanoate (R... f = 0.65) residue, and formed a main spot (target R) f = 0.19). The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to THF / methanol = 5 / 1) to give compound 30 (180 mg, 192 μmol, 74.3% yield) as a yellow oil. 1HNMR (400 MHz, CDCl3) δ 4.34 (dd, J = 5.2, 11.6 Hz, 2H), 4.25 (dd, J = 6.4, 11.2 Hz, 2H), 2.97–2.79 (m, 2H), 2.78 (d, J = 6.8 Hz, 6H), 2.54–2.66 (m, 13H), 2.43 (s, 4H), 2.36 (t, J = 7.6 Hz, 4H), 1.89 (brs, 3H), 1.55–1.71 (m, 16H), 1.28–1.40 (m, 37H), 0.86–0.91 (m, 12H).

[0410] Compound 31: 6,6′-[(2-hydroxyethyl)azinediyl]dihexanoate bis[2,3-bis(octylthio)propyl] ester

[0411]

[0412] 2-Aminoethanol-1-ol (1.74 g, 28.5 mmol, 1.73 mL, 3.0 equivalent) and 2,3-bis(octylthio)propyl 6-bromohexanoate (5.0 g, 9.51 mmol, 1.0 equivalent) were dissolved in methanol (35 mL) at 25 °C, and the mixture was then stirred at 90 °C for 12 hours. Thin-layer chromatography (dichloromethane / methanol = 7 / 1, target R) was performed. f = 0.20) indicates that the reaction is complete. The reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (50 mL, 30 mL, 20 mL). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to dichloromethane / methanol = 5 / 1) to give 2,3-bis(octylthio)propyl 6-((2-hydroxyethyl)amino)hexanoate (2.6 g, 5.14 mmol, 54.0% yield) as a yellow oil and compound 31 (0.49 g, 515 μmol, 5.42% yield) as a yellow oil. 1H NMR(400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.2 Hz, 2H), 4.25 (dd, J = 6.4, 11.6 Hz, 2H), 3.53 (t, J = 5.6 Hz, 2H), 2.97–3.03 (m, 2H), 2.78 (d, J = 6.8 Hz, 4H), 2.54–2.62 (m, 10H), 2.45 (t, J = 7.2 Hz, 4H), 2.34 (t, J = 7.6 Hz, 4H), 1.55–1.69 (m, 14H), 1.28–1.50 (m, 51H), 0.89 (t, J = 7.2 Hz, 12H).

[0413] Compound 32: 6,6′-[(2-hydroxyethyl)azinediyl]diahexanoic acid bis{2,3-bis[((2E,6Z)-non-2,6-dien-1-yl)thio]propyl} ester

[0414]

[0415] Compound 32 was prepared using a similar method to compound 28, with (2E,6Z)-non-2,6-diene-1-thiol as the starting material. 1H NMR (400 MHz, CDCl3) δ 5.40–5.78 (m, 16H), 4.34 (dd, J = 5.0, 11.6 Hz, 2H), 4.25 (dd, J = 6.4, 11.6 Hz, 2H), 3.57 (t, J = 5.6 Hz, 2H), 3.10–3.45 (m, 8H), 2.95–3.04 (m, 2H), 2.78–2.88 (m, 4H), 2.51–2.63 (m, 5H), 2.34 (t, J = 7.2 Hz, 4H), 1.55–1.69 (m, 26H), 1.28–1.50 (m, 12H), 0.89 (t, J = 7.2 Hz, 12H).

[0416] Compound 33: 7,7′-[(2-hydroxyethyl)azonyl]diheptanoic acid bis[2,3-bis(heptylthio)propyl] ester

[0417]

[0418] Add 2,3-bis(heptylthio)propyl 7-bromoheptanoate (5.0 g, 9.77 mmol, 1.0 equivalent) and 2-aminoethanol (1.79 g, 29.3 mmol, 1.77 mL, 3.0 equivalent) to a solution of acetonitrile (32.5 mL) at 25°C, then stir the mixture at 90°C for 4 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1, starting material: Rf = 0.51; dichloromethane:methanol = 10:1, product: R) f = 0.05) indicates that 2,3-bis(heptylthio)propyl 7-bromoheptanoate was completely consumed. The residue was diluted with water (50.0 mL) and extracted with ethyl acetate (30.0 mL). The combined organic layers were washed with brine (20.0 x 2 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, DCM:MeOH = 60:1 to DCM:MeOH = 10:1). Compound 33 (500 mg, 542 μmol, 5.55% yield, 100% purity) and 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate (1.20 g, 2.44 mmol, 25.0% yield) were both yellow oils. 1H NMR (400 MHz, CDCl3) δ 4.35 (m, 2 H), 4.24 (m, 2 H), 3.52 (t, J = 5.2 Hz, 2 H), 2.98–3.01 (m, 2 H), 2.76–2.81 (m, 4 H), 2.53–2.62 (m, 10 H), 2.42–2.46 (m, 4 H), 2.33 (t, J = 7.6 Hz, 4 H), 1.55–1.67 (m, 13 H), 1.28–1.48 (m, 45 H), 0.89 (t, J = 6.4 Hz, 12 H).

[0419] Compound 34: 7,7′-[(3-hydroxypropyl)azonyl]diheptanoic acid bis[2,3-bis(heptylthio)propyl] ester

[0420] Synthesis of Compound 34

[0421]

[0422] To a solution of 2,3-bis(heptylthio)propyl 7-bromoheptanoate (3.00 g, 5.86 mmol, 1.0 equivalent) in ethanol (30.0 mL), 3-aminoprop-1-ol (4.40 g, 58.6 mmol, 4.52 mL, 10 equivalent) was added. The reaction was stirred at 50 °C for 2.5 h. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1, starting material: Rf = 0.51; dichloromethane:methanol, product: R) was performed. f = 0.07) indicates that 2,3-bis(heptylthio)propyl 7-bromoheptanoate was completely consumed. The residue was diluted with water (100 mL) and extracted with ethyl acetate (20.0 mL * 2). The combined organic layers were washed with brine (10.0 mL * 2), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, DCM:MeOH = 15:1 to 1 / 1). Compound 34 (0.2 g, 214 μmol, 3.64% yield) and 2,3-bis(heptylthio)propyl 7-((3-hydroxypropyl)amino)heptanoate (2.0 g, 3.95 mmol, 67.4% yield) were given, both as yellow oils. 1H NMR (400 MHz, CDCl3) δ 4.33–4.37 (m, 2H), 4.22–4.26 (m, 2 H), 3.80 (br t, J = 5.2 Hz, 2 H), 2.97–3.02 (m, 2 H), 2.76–2.83 (m, 5H), 2.54–2.69 (m, 10 H), 2.32–2.50 (m, 7 H), 1.43–1.69 (m, 22 H), 1.28–1.39 (m, 42 H), 0.89 (t, J = 6.4 Hz, 12 H).

[0423] Compound 35: 7,7′-[[3-(dimethylamino)propyl]azinediyl]diheptanoic acid bis[2,3-bis(heptylthio)propyl] ester

[0424]

[0425] Triethylamine (TEA, 216 mg, 2.14 mmol, 297 μL, 4.0 equivalents) was added to a solution of compound 34 (500 mg, 533 μmol, 1.0 equivalents) in dichloromethane (5.0 mL). Then, p-toluenesulfonyl chloride (TosCl, 203 mg, 1.07 mmol, 2.0 equivalents) was added at 0 °C. The reaction was stirred at 20 °C for 12 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1, starting material: R) was performed. f =0.37; Product: R f=0.65) indicates that compound 34 was completely consumed. The residue was diluted with water (10.0 mL) and extracted with dichloromethane (20.0 mL * 2). The combined organic layers were washed with brine (10.0 mL), dried, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, DCM:MeOH = 80 / 1 to 60 / 1). Bis(2,3-bis(heptylthio)propyl)7,7'-((3-chloropropyl)azanidinediyl)diheptanoate (0.40 g, 419 μmol, 78.4% yield) was given as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.33–4.37 (m, 2 H), 4.22–4.26 (m, 2H), 3.60 (t, J = 6.4 Hz, 2 H), 2.98–3.01 (m, 2 H), 2.78–2.80 (m, 4 H), 2.52–2.62 (m, 10H), 2.32–2.38 (m, 8 H), 1.77–1.96 (s, 4 H), 1.55–1.67 (m, 21 H), 1.28–1.39 (m, 47 H), 0.87–0.90 (m, 12 H).

[0426] Sodium iodide (NaI, 15.7 mg, 105 μmol, 0.5 equivalent) and N-methylmethylamine (2 M, 524 μL, 5.0 equivalent) were added to a solution of bis(2,3-bis(heptylthio)propyl)7,7'-((3-chloropropyl)azaalkyldiyl)diheptanoate (1.00 mL) in tetrahydrofuran (1.00 mL). The mixture was stirred at 70 °C for 168 h. Liquid chromatography-mass spectrometry (ET49878-321-p1a1, product: RT = 2.694 min) showed that the starting material was completely consumed. The reaction mixture was concentrated under reduced pressure to remove the solvent. The residue was purified by column chromatography (SiO2, DCM:MeOH = 1 / 1 to 60 / 1). Compound 35 (100 mg, 104 μmol, 49.6% yield) was given as a brown oil. 1H NMR (400 MHz, CDCl3) δ 4.32–4.37 (m, 2H), 4.22–4.27 (m, 2 H), 3.33 (s, 1 H), 2.95–3.01 (m, 4 H), 2.74–2.85 (m, 8 H), 2.50–2.63 (m, 11 H), 2.32–2.37 (m, 4 H), 2.0–2.2 (m, 2 H), 1.55–1.69 (m, 15 H), 1.16–1.37 (m, 41 H), 0.83–0.90 (m, 12 H).

[0427] Compound 36: 7,7′-[(2-hydroxyethyl)azonyl]diheptanoic acid bis{2,3-bis[(5-methylhexyl)thio]propyl} ester

[0428] Synthesis of 5-methylhexane-1-thiol

[0429]

[0430] Potassium thioacetate (21.1 g, 185 mmol) was added to a solution of 1-bromo-5-methylhexane (30.0 g, 168 mmol) in acetone (500 mL), and the mixture was stirred at 20 °C for 12 hours. Thin-layer chromatography (petroleum ether: ethyl acetate = 1:0) showed that reactant 1 was completely consumed and a new spot was formed. H₂O (300 mL) was added to the reaction mixture, and the mixture was extracted with CH₂Cl₂ (200 mL × 2). The combined organic phases were washed with brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum to give a yellow oil (30.8 g) for the next step. An aqueous solution of sodium hydroxide (148 mmol, 25 mL, 20% purity) was added to a solution of the yellow oil (25.8 g, 148 mmol, 1 equivalent) in methanol (250 mL), and the mixture was stirred at 20 °C for 2 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 1:0) indicated that the starting material had been completely consumed. The reaction mixture was extracted with petroleum ether (200 mL × 3). The combined organic phases were washed with brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 120 g SepaFlash® silica gel column, eluent 0–0% ethyl acetate / petroleum ether gradient, flow rate 65 mL / min) to give 5-methylhexane-1-thiol (15.8 g, 119 mmol, 80.70% yield) as a colorless oil. 1H NMR (400 MHz, CDCl3). δ 2.53 (q, J = 7.6 Hz, 2H), 1.47–1.67 (m, 3H), 1.28–1.44 (m, 3H), 1.13–1.22 (m, 2H), 0.87 (d, J = 6.4 Hz, 6H)

[0431] Synthesis of 2,3-bis[(5-methylhexyl)thio]propyl 7-bromoheptanoic acid

[0432]

[0433] To a solution of 5-methylhexane-1-thiol (10.0 g, 75.6 mmol) in dioxane (40 mL), propan-2-yn-1-yl 7-bromoheptanoate (6.00 g, 24.3 mmol) was added, and the mixture was stirred at 25 °C for 1 hour. Azobisisobutyronitrile (AIBN, 798 mg, 4.86 mmol) was then added, and the mixture was stirred at 100 °C for another 3 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 20:1) showed that propan-2-yn-1-yl 7-bromoheptanoate was completely consumed. The reaction mixture was diluted with CH₂Cl₂ (50 mL), washed with brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 40+20 g SepaFlash® silica gel column, eluent 0-5% ethyl acetate / petroleum ether gradient, flow rate 45 mL / min) to give 2,3-bis[(5-methylhexyl)thio]propyl 7-bromoheptanoic acid (9.75 g, 19.1 mmol, 78.5% yield), as a yellow oil. 1H NMR (400 MHz, CDCl3). δ 4.31–4.39 (m, 1H), 4.20–4.29 (m, 1H), 3.40 (t, J =6.8 Hz, 2H), 2.94–3.05 (m, 1H), 2.78 (d, J = 6.8 Hz, 2H), 2.51–2.64 (m, 4H), 2.34 (t, J =7.6 Hz, 2H), 1.73–1.92 (m, 2H), 1.61–1.69 (m, 2H), 1.50–1.60 (m, 6H), 1.43–1.50 (m, 2H), 1.33–1.43 (m, 6H), 1.12–1.23 (m, 4H), 0.87 (d, J = 6.4 Hz, 12H).

[0434] Synthesis of 2,3-bis[(5-methylhexyl)thio]propyl 7-[(2-hydroxyethyl)amino]heptanoic acid

[0435]

[0436] A solution of 2,3-bis[(5-methylhexyl)thio]propyl 7-bromoheptanoate (3.00 g, 5.86 mmol) and 2-aminoethanol (10.7 g, 176 mmol) in ethanol (21 mL) was stirred at 75 °C for 2 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that 2,3-bis[(5-methylhexyl)thio]propyl 7-bromoheptanoate was completely consumed. The reaction mixture was diluted with ethyl acetate (30 mL), washed with water (10 mL × 3), dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 20 g SepaFlash® silica gel column, eluent gradient of 0–15% MeOH / CH2Cl2, flow rate 30 mL / min) to give 2,3-bis[(5-methylhexyl)thio]propyl 7-[(2-hydroxyethyl)amino]heptanoic acid (1.50 g, 3.05 mmol, 52.0% yield), as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.30–4.38 (m, 1H), 4.20–4.28 (m, 1H), 3.60–3.68 (m, 2H), 2.94–3.04 (m, 1H), 2.75–2.81 (m, 4H), 2.52–2.66 (m, 6H), 2.33 (t, J = 7.6 Hz, 2H), 2.04 (s, 2H), 1.47–1.68 (m, 10H), 1.32–1.42 (m, 8H), 1.15–1.21 (m, 4H), 0.86 (d, J = 6.4 Hz, 12H).

[0437] Synthesis of Compound 36

[0438]

[0439] A solution of 2,3-bis[(5-methylhexyl)thio]propyl 7-bromoheptanoic acid (700 mg, 1.42 mmol), DIEA (0.5 mL, 2.87 mmol), and 2,3-bis[(5-methylhexyl)thio]propyl 7-bromoheptanoic acid (1.09 g, 2.13 mmol) in ethanol (7 mL) was stirred at 90 °C for 12 h. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed a new spot. The reaction was concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 4 g SepaFlash® silica gel column, eluent 0–5% MeOH / CH2Cl2 gradient, flow rate 18 mL / min) to give compound 36 (550 mg, 575 μmol, 40.4% yield, 96.3% purity) as a yellow oil.1H NMR (400 MHz, CDCl3) δ 4.31–4.39 (m, 2H), 4.19–4.29 (m, 2H), 3.50–3.64 (m, 2H), 2.95–3.04 (m, 2H), 2.75–2.81 (m, 4H), 2.45–2.67 (m, 13H), 2.33 (t, J = 7.6 Hz, 4H), 1.45–1.68 (m, 21H), 1.25–1.42 (m, 17H), 1.14–1.21 (m, 8H), 0.87 (d, J = 6.8 Hz, 24H).

[0440] Compound 37: 2,3-bis[(3-butylheptyl)thio]propoxy]-7-oxoheptyl)(2-hydroxyethyl)amino]octanoic acid propyl ester

[0441]

[0442] Compound 37 was prepared using a similar method to compound 36, but with the use of 3-butylheptane-1-thiol. 1H NMR (400MHz, CDCl3) δ 4.31–4.37 (m, 2H), 4.21–4.26 (m, 2H), 3.70 (br s, 2H), 2.92–3.04 (m, 2H), 2.75–2.81 (m, 4H), 2.45–2.67 (m, 13H), 2.33 (t, J = 7.6 Hz, 4H), 1.22–1.69 (m, 80H), 0.89 (t, J = 6.4 Hz, 24H).

[0443] Compound 38: 7,7′-[(2-hydroxyethyl)azonyl]diheptanoic acid bis{2,3-bis[(3,7-dimethyloctyl)thio]propyl} ester

[0444]

[0445] A mixture of 2,3-bis((3,7-dimethyloctyl)thio)propyl 7-((2-hydroxyethyl)amino)heptanoate (500 mg, 868 μmol), 2,3-bis((3,7-dimethyloctyl)thio)propyl 7-bromoheptanoate (776 mg, 1.30 mmol), and DIEA (225 mg, 1.74 mmol) in ethanol (5 mL) was stirred at 90 °C for 12 hours. Thin-layer chromatography (CH₂Cl₂: MeOH = 10:1) showed the formation of a new spot. The reaction mixture was diluted with ethyl acetate (20 mL), washed with brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 4+4 g SepaFlash® silica gel rapid column, eluent 0~5% MeOH / CH2Cl2 gradient, flow rate 20 mL / min) to give compound 38 (300 mg, 274 μmol, 31.6% yield, 99.6% purity), as a pale yellow oil. 1H NMR (400 MHz, CDCl3) δ4.31–4.39 (m, 2H), 4.20–4.29 (m, 2H), 3.56–3.78 (m, 2H), 2.95–3.04 (m, 2H), 2.43–2.85 (m, 18H), 2.33 (t, J = 7.6 Hz, 4H), 1.48–1.66 (m, 19H), 1.21–1.45 (m, 25H), 1.06–1.17 (m, 12H), 0.82–0.93 (m, 36H).

[0446] Compound 39: 8,8′-[(2-hydroxyethyl)azonyl]dioctanoic acid bis[2,3-bis(pentylthio)propyl] ester

[0447] Synthesis of Compound 39

[0448]

[0449] To a solution of 2,3-bis(pentathio)propyl 8-bromooctanoate (1.2 g, 2.56 mmol, 2.23 equivalents) in ethanol (10 mL) at 25°C, DIEA (296 mg, 2.29 mmol, 399 μL, 2.0 equivalents) and 2-aminoethanol (70 mg, 1.15 mmol, 69.3 μL, 1.0 equivalents) were added, followed by stirring at 90°C for 12 hours. Thin-layer chromatography (dichloromethane / methanol = 10 / 1, product R) was performed. f= 0.40) indicates that the reaction is complete. The reaction mixture was poured into water (5 mL) and extracted with ethyl acetate (5 mL, 3 mL, 2 mL). The combined organic layers were washed with brine (3 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to THF / ethanol = 5 / 1) to give compound 39 (234 mg, 279 μmol, 24.3% yield) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.6 Hz, 2H), 4.24 (dd, J = 6.4, 11.2 Hz, 2H), 3.59 (t, J = 4.8 Hz, 2H), 2.97–3.05 (m, 2H), 2.78–2.80 (m, 4H), 2.50–2.65 (m, 14 H), 2.33 (t, J = 7.2 Hz, 4H), 1.56–1.65 (m, 14H), 1.48 (brs, 5H), 1.32–1.39 (m, 30H), 0.90 (t, J = 7.2 Hz, 12H).

[0450] Compound 40: 8,8′-[(2-hydroxyethyl)azonyl]dioctanoic acid bis[2,3-bis(heptylthio)propyl] ester

[0451] Synthesis of Compound 40

[0452]

[0453] Add 2-aminoethanol (2.79 g, 45.6 mmol, 2.76 mL, 3.00 equivalent) to a solution of 2,3-bis(heptylthio)propyl 8-bromooctanoate (8.00 g, 15.2 mmol, 1.00 equivalent) in acetonitrile (56 mL). Stir the mixture at 85 °C for 12 hours. Thin-layer chromatography (dichloromethane:methanol = 5:1, product R...) f (P1) = 0.1, product R f(P2) = 0.39) indicates that 10% of reactant 1 remains, and a new main spot with greater polarity is detected. The reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (300 mL, 200 mL, 100 mL). The combined organic layers were washed with 30 mL of brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to give the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate to dichloromethane:methanol = 20 / 1 to 1 / 1) to give 2,3-bis(heptylthio)propyl 8-((2-hydroxyethyl)amino)octanoate (3.5 g, 6.92 mmol, 45.4% yield) and compound 40 (520 mg, 547 μmol, 3.59% yield), both as yellow oils. 1H NMR (400 MHz, CDCl3) δ 4.35 (dd, J = 5.2, 11.6 Hz, 2H), 4.24 (dd, J =6.4, 11.6 Hz, 2H), 3.55 (s, 2H), 2.97–3.04 (m, 2H), 2.75–2.83 (m, 4H), 2.54–2.63 (m, 10H), 2.46 (s, 3H), 2.34 (t, J = 7.6 Hz, 4H), 1.56–1.65 (m, 13H), 1.28–1.45 (m, 49H), 0.89 (t, J = 6.8 Hz, 12H).

[0454] Compound 41: 3-Butylheptyl ester of 8-[(7-[2,3-bis(heptylthio)propoxy]-7-oxoheptyl)(2-hydroxyethyl)amino]octanoic acid

[0455]

[0456] 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate (500 mg, 1.02 mmol), 3-butylheptyl 8-bromooctanoate (576 mg, 1.52 mmol), and DIEA (263 mg, 2.03 mmol) were dissolved in EtOH (5.00 mL) and stirred at 75 °C for 16 hours. Thin-layer chromatography (dichloromethane:methanol = 10:1) showed that the starting material was completely consumed. The reaction mixture was concentrated under reduced pressure to give a residue, which was purified by column chromatography (SiO2, dichloromethane:methanol = 1 / 0 to 100 / 15) to give compound 41 (350 mg, yield 42.7%) as a pale yellow oil. 1H NMR(400 MHz, CDCl3) δ4.23–4.36 (m, 2H), 4.09 (t, J = 7.2 Hz, 2H), 3.85 (br s, 2H), 2.65–3.17 (m,9H), 2.54–2.61 (m, 4H), 2.29–2.39 (m, 4H), 1.45–1.78 (m, 13H), 1.26–1.43 (m, 40H), 0.87–0.90 (m, 12H).

[0457] Compound 42: 2,3-bis[(3-butylheptyl)thio]propyl 7-[(7-[2,3-bis(heptylthio)propoxy]-7-oxoheptyl)(2-hydroxyethyl)amino]heptanoic acid

[0458]

[0459] 2,3-bis(heptylthio)propyl 7-((2-hydroxyethyl)amino)heptanoate (400 mg, 813 μmol), 2,3-bis((3-butylheptyl)thio)propyl 7-bromoheptanoate (609 mg, 976 μmol), and DIEA (210 mg, 1.63 mmol) were dissolved in EtOH (10.0 mL) and stirred at 90 °C for 12 hours. Thin-layer chromatography (CH2Cl2: MeOH = 10:1) showed that the starting material was completely consumed. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, CH2Cl2: MeOH = 1 / 0 to 100 / 15) to give title compound 42 (300 mg, yield 34.4%, purity 96.4%) as a light brown oil. 1H NMR (400 MHz, CDCl3) δ 4.23–4.38 (m, 4H), 3.97 (s, 1H), 3.12 (s,2H), 3.00–3.02 (m, 4H), 2.79 (dd, J = 6.4, 3.6 Hz, 4H), 2.53–2.62 (m, 8H), 2.35 (t, J = 7.2 Hz, 4H), 1.81–1.86 (m, 4H), 1.51–1.67 (m, 14H), 1.25–1.40 (m, 52H), 0.87–0.92 (m, 18H).

[0460] Compound 43: 3,3′-[(2-hydroxyethyl)azonyl]dipropionate bis[2,3-bis(heptylthio)propyl] ester

[0461] Synthesis of prop-2-yn-1-yl 3-bromopropionic acid ester

[0462]

[0463] To a mixture of 3-bromopropionic acid (40.0 g, 261 mmol) and propargyl-1-ol (18.5 g, 330 mmol) in CH₂Cl₂ (250 mL), EDCI (60.8 g, 317 mmol) and DMAP (4.80 g, 39.3 mmol) were added at 0 °C, followed by stirring at 20 °C for 3 h under a nitrogen atmosphere. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that the 3-bromopropionic acid was completely consumed. The reaction mixture was washed with H₂O (100 mL × 3), dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 80 g SepaFlash® silica gel column, eluent of 0-10% ethyl acetate / petroleum ether gradient, flow rate 80 mL / min) to give prop-2-yn-1-yl 3-bromopropionic acid (3.66 g, 19.2 mmol, yield 7.33%) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.74 (d, J = 2.4 Hz, 2H), 2.59 (t, J = 6.4 Hz, 2H), 2.98 (t, J = 7.2 Hz, 2H), 2.50 (d, J = 2.4 Hz, 1H).

[0464] Synthesis of 2,3-bis(heptylthio)propyl 3-bromopropionic acid

[0465]

[0466] AIBN (516 mg, 3.14 mmol) was added to a mixture of propionyl 3-bromopropionate (3.00 g, 15.7 mmol) and 1-heptathiol (6.59 g, 49.8 mmol) in 1,4-dioxane (30 mL) at 20 °C, followed by stirring at 100 °C for 13 h under a nitrogen atmosphere. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that propionyl 3-bromopropionate was completely consumed. The reaction mixture was concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 40 g SepaFlash® silica gel column, eluent 0-5% ethyl acetate / petroleum ether gradient, flow rate 30 mL / min) to give 2,3-bis(heptylthio)propyl 3-bromopropionic acid (5.15 g, 11.3 mmol, yield 72.0%) as a yellow oil.1H NMR (400 MHz, CDCl3) δ 4.25–4.45 (m, 2H), 3.54–3.80 (m, 2H), 2.91–3.06(m, 3H), 2.75–2.85 (m, 2H), 2.51–2.64 (m, 4H), 1.53–1.64 (m, 5H), 1.25–1.41(m, 15H), 0.86–0.90 (m, 6H).

[0467] Synthesis of 2,3-bis(heptylthio)propyl 3-[(2-hydroxyethyl)amino]propionic acid

[0468]

[0469] 2,3-bis(heptylthio)propyl 3-bromopropionic acid (2.50 g, 5.49 mmol) and 2-aminoethanol (8.60 g, 141 mmol) were dissolved in EtOH (20 mL) and stirred at 75 °C for 2 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 10:1) showed that 2,3-bis(heptylthio)propyl 3-bromopropionic acid was completely consumed. The reaction solution was diluted with EtOAc (100 mL), washed with brine, dried over anhydrous Na₂SO₄, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 12 g SepaFlash® silica gel column, eluent gradient of 0-10% MeOH / CH2Cl2, flow rate 30 mL / min) to give 2,3-bis(heptylthio)propyl 3-[(2-hydroxyethyl)amino]propionic acid (1.10 g, 2.52 mmol, yield 46.0%) as a yellow oil. 1H NMR (400 MHz, CDCl3) δ 4.24–4.40 (m, 2H), 3.63 (t, J = 5.2 Hz, 2H), 2.96–3.04 (m, 1H), 2.93 (t, J = 6.4 Hz, 2H), 2.74–2.83 (m, 4H), 2.51–2.63 (m, 6H), 1.81–1.91 (m, 2H), 1.53–1.63 (m, 4H), 1.23–1.41 (m, 16H), 0.84–0.93 (m, 6H).

[0470] Synthesis of Compound 43

[0471]

[0472] A mixture of 2,3-bis(heptylthio)propyl 3-[(2-hydroxyethyl)amino]propionic acid (300 mg, 689 μmol), 2,3-bis(heptylthio)propyl 3-bromopropionic acid (470 mg, 1.03 mmol), and DIEA (0.25 mL, 1.44 mmol) in DMF (5 mL) was stirred at 95 °C for 16 hours. Thin-layer chromatography (CH2Cl2: MeOH = 10:1) showed that 2,3-bis(heptylthio)propyl 3-[(2-hydroxyethyl)amino]propionic acid was completely consumed. The reaction mixture was diluted with EtOAc (30 mL), washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by rapid silica gel column chromatography (ISCO®; 4+4 g SepaFlash® silica gel rapid column, eluent 0~3% MeOH / CH2Cl2 gradient, flow rate 20 mL / min) to give title compound 43 (230 mg, 284 μmol, yield 41.2%, purity 99.9%) as a yellow oil. 1H NMR (400 MHz, CDCl3). δ 4.25–4.37 (m, 4H), 3.53–3.64 (m, 2H), 2.75–3.05 (m, 11H), 2.47–2.64(m, 13H), 1.57–1.63 (m, 6H), 1.52–1.55 (m, 3H), 1.23–1.42 (m, 32H), 0.88 (t,J = 6.8 Hz, 12H).

[0473] Example 2. Preparation of Nanoparticle Composition

[0474] This embodiment illustrates the preparation and characterization of lipid nanoparticles comprising the cationic lipids synthesized in Example 1. The nanoparticles were prepared by mixing an aqueous phase containing RNA with an ethanol phase containing the lipid component. The two phases were mixed using a microfluidic mixing process with a standard staggered herringbone mixer.

[0475] The ethanol phase was prepared by adding the following components to ethanol: (1) an ionizable cationic lipid, specifically the cationic lipid prepared in Example 1; (2) a neutral lipid, specifically DSPC; (3) a steroid, specifically cholesterol; and (4) a polyethylene glycol-lipid, specifically DMG-PEG2000. Unless otherwise stated, the lipid components were in the ratio of ionizable cationic lipid:DSPC:cholesterol:PEG-DMG = 50:10:38.5:1.5 mol%.

[0476] RNA was dissolved in 50 mM sodium citrate buffer (pH=4) at a concentration of 0.1 mg / mL. The weight ratio of RNA or DNA molecules to ionizable cationic lipids was maintained at 1:10.

[0477] The lipid solution (ethanol phase) was injected into the mixer at a rate of 1 mL / min, and the aqueous phase was injected into the mixer at a rate of 3 mL / min. The volume ratio of the aqueous phase to the ethanol phase was 3:1.

[0478] After mixing, a solution containing LNP was obtained, followed by dialysis to remove ethanol and achieve buffer replacement. Dialysis was performed twice at 4°C, each time using Tris-HCl solution (20 mM, pH 7.4), approximately 2500 times the volume of the mixed solution, using a Slide-A-Lyzer dialysis cartridge (Thermo Fisher Scientific Inc., Rockford, Ill.), with a molecular weight cutoff of 10 kDa, and each dialysis lasted 2 hours. Subsequently, 40% sucrose solution was added, and the final nanoparticle solution containing 8% sucrose was stored at -80°C.

[0479] The particle size and polydispersity index (PDI) of the nanoparticle compositions in PBS or Tris-HCl were determined using Zetasizer Nano ZS (BeNano, Bettersize).

[0480] The concentration of therapeutic and / or preventive substances (e.g., RNA) in the nanoparticle composition was determined using ultraviolet-visible spectroscopy. The absorption spectrum of the solution was recorded. The concentration of therapeutic and / or preventive substances (e.g., RNA) in the nanoparticle composition was calculated based on the extinction coefficient of the therapeutic and / or preventive substances (e.g., RNA) and the difference between the absorbance at, for example, a wavelength of 260 nm and a baseline value at, for example, a wavelength of 330 nm.

[0481] Using QUANT-IT TMThe RIBOGREEN RNA Detection Kit (Shanghai Nearshore Molecular Biotechnology Co., Ltd.) was used to evaluate the encapsulation of RNA by nanoparticle compositions. Samples were diluted with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.4), and 100 μL of the diluted sample was transferred to a polystyrene 96-well plate. The plate was incubated at 40 °C for 10 min. RIBOGREEN or PICOGREEN reagents were diluted 1:200 with TE buffer, and 100 μL of this solution was added to each well. Fluorescence intensity was measured using a microplate reader (Molecular Devices i3max) at an excitation wavelength of, for example, approximately 488 nm and an emission wavelength of, for example, approximately 525 nm. The fluorescence value of the reagent blank was subtracted from the fluorescence value of each sample, and the percentage of free RNA or DNA was determined by dividing the fluorescence intensity of the intact sample (without Triton X-100) by the fluorescence value of the destroyed sample (caused by the addition of Triton X-100).

[0482] Example 3. Sample formulation induces GFP expression in cells.

[0483] This embodiment demonstrates the transfection and expression efficiency of LNPs containing the lipid compound of this application and GFP mRNA (SEQ ID NO: 1) as a payload in two cell lines (HEK293 and HepG2). The LNP formulation was prepared and characterized according to the method described in Example 2.

[0484] The mRNA sequence encoding EGFP (mGFP) is shown below:

[0485] AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACC CUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUG GUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCC GACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUAA (SEQ ID NO: 1).

[0486] This study also included two FDA-approved cationic lipids, DLin-MC3-DMA (MC3) and SM-102, as controls for comparison. MC3 is currently the standard in the field, and its composition includes approximately 50 mol% MC3, approximately 10 mol% DSPC, approximately 38.5 mol% cholesterol, and approximately 1.5 mol% PEG-DMG. SM-102 is used in COVID-19 mRNA vaccines.

[0487] Table 1 summarizes the results of particle size and PDI values ​​determination for formulations prepared using the lipid compounds of this application and two controls. As shown in Table 1, the compounds selected according to formula (I) significantly affected the particle size (e.g., diameter) and polydispersity index (PDI) of the compositions. The tested LNP particle sizes ranged from about 100 nm to 300 nm, the polydispersity index ranged from 0.1 to 0.6, and the encapsulation efficiency was about 20–85%, which is ideal for RNA delivery.

[0488] Table 1. Properties of nanoparticle compositions encapsulating mGFP

[0489]

[0490]

[0491] HEK293 and HepG2 cells were used at 5 × 10 5 Cells were seeded at a density of 1000 ng, 1000 ng, and 2000 ng of GFP mRNA into 24-well tissue culture plates containing Eagle minimum essential medium. LNPs containing 500 ng, 1000 ng, and 2000 ng of GFP mRNA were added to each well, and the cells were incubated for 6 hours. Cells were analyzed by flow cytometry, and GFP fluorescence intensity was measured to determine expression levels. Data are expressed relative to the expression levels of MC3 LNPs at the same concentration. Results are as follows: Figure 1 (HEK293 cells) and Figure 2 (HepG2 cells) as shown.

[0492] like Figure 1 and Figure 2 As shown, the LNP composed of compounds (35, 26, 14) achieved higher GFP expression than MC3 in both cell types. Compounds (1, 31, 33, 34) also showed comparable GFP expression levels to MC3.

[0493] Example 4. Induction of hEPO expression in mice by the sample formulation

[0494] To evaluate the expression efficacy of the lipids disclosed herein, the expression level of hEPO protein was measured in mice after administration of the nanoparticles disclosed herein.

[0495] A nanoparticle composition comprising cholesterol as a structural lipid, DSPC as an auxiliary lipid, DMP-PEG as a polyethylene glycol-lipid, the compound prepared in Example 1 as a cationic lipid, and EPO mRNA (SEQ ID NO: 2) as a loading was prepared according to or using a method similar to that described in Example 2. The results of particle size, PDI value, and encapsulation efficiency determination are shown in Table 2.

[0496] The mRNA sequence encoding hEPO is as follows: AUGGGCGUGCACGAGUGCCCCGCCUGGCUGUGGCUGCUGCUGAGCCUGCUGAGCCUGCCCCUGGGCCUGCCCGUGCUGGGCGCCCCCCCCCGGCUGAUCUGCGACAGCCGGGUGCUGGAGCGGUACCUGCU GGAGGCCAAGGAGGCCGAGAACAUCACCACCGGCUGCGCCGAGCACUGCAGCCUGAACGAGAACAUCACCGUGCCCGACACCAAGGUGAACUUCUACGCCUGGAAGCGGAUGGAGGUGGGCCAGCAGGCCGUGGAGGUGGCAGGGCCU GGCCCUGCUGAGCGAGGCCGUGCUGCGGGGCCAGGCCCUGCUGGUGAACAGCAGCCAGCCCUGGGAGCCCCUGCAGCUGCACGUGGACAAGGCCGUGAGCGGCCUGCGGAGCCUGACCACCCUGCUGCGGGCCCUGGGCGCCCAGAAGGA GGCCAUCAGCCCCCCCGACGCCGCCAGCGCCGCCCCCCUGCGGACCAUCACCGCCGACACCUUCCGGAAGCUGUUCCGGGGUACAGCAACUUCCUGCGGGGCAAGCUGAAGCUGUACACCGGCGAGGCCUGCCGGACCGGCGACCGGUGA (SEQ ID NO: 2).

[0497] Table 2. Properties of nanoparticle compositions encapsulating hEPO

[0498]

[0499]

[0500] The lipid nanoparticles were administered intravenously to CD-1 mice at a dose of 0.5 mg / kg. Serum hEPO concentrations were measured at 6 and 24 hours post-injection. Table 2 and... Figure 3 The results show the fold increase in hEPO concentration relative to MC3 induced by formulations containing different lipids at 6 hours.

[0501] As shown in Table 2, compounds 8, 22, and 34 achieved EPO expression levels comparable to MC3 in mice after intravenous injection. Based on the EPO expression results of the nanoparticle composition containing compound 43, it can be seen that the relatively shorter expression in formula (II)... and The chain cannot achieve good delivery performance. In the preferred embodiment, the sum of m and p and the sum of n and p must both be selected from 6, 7, 8, and 9.

[0502] Although preferred embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. The invention is not intended to be limited to the specific examples provided in the specification. Although the invention has been described with reference to the foregoing specification, the descriptions and illustrations of embodiments herein should not be construed as limiting. Numerous changes, modifications, and substitutions can be made by those skilled in the art without departing from the invention. Furthermore, it should be understood that various aspects of the invention are not limited to the specific depictions, configurations, or relative proportions set forth herein, as these depend on a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in carrying out the invention. Therefore, it is contemplated that the invention also covers all such alternatives, modifications, variations, or equivalents. The scope of the invention is intended to be defined by the following claims, and all methods and structures within the scope of these claims and their equivalents should be covered therein.

Claims

1. A lipid having formula (I), or a salt, tautomer, or stereoisomer thereof, in: a) m and n are each independently selected from any integer in the range of 3 to 12; b) p is any integer selected from 1, 2 or 3, and the sum of m and p is any integer selected from the range 6 to 9; c) o is any integer selected from the range 1 to 6; d) X1 is a bond, -C(O)O-, -OC(O)-, -OC(O)O- or a biodegradable group; e) R1 is a group containing a hydrogen bond donor or a group containing a hydrogen bond acceptor; f) The two R2 values ​​are identical and are selected from C1-C. 16 Alkyl, substituted C1-C 16 Alkyl, C2-C 16 Alkenyl, substituted C2-C 16 alkenyl, C3-C 12 cycloalkyl, substituted C3-C 12 Cycloalkyl groups and combinations thereof; g) R3 is selected from C4-C 22 Alkyl, substituted C4-C 22 Alkyl, C4-C 22 alkenyl, substituted C4-C 22 alkenyl, C3-C 12 cycloalkyl, substituted C3-C 12 Cycloalkyl groups and combinations thereof; or disulfides in which R3 has the following structure Two of the R4 values ​​are identical and are selected from C1-C. 16 Alkyl, substituted C1-C 16 Alkyl, C2-C 16 Alkenyl, substituted C2-C 16 alkenyl, C3-C 12 cycloalkyl, substituted C3-C 12 Cycloalkyl groups and their combinations.

2. The lipid according to claim 1, having formula (II), or a salt, tautomer, or stereoisomer thereof, The sum of n and p is selected from any integer in the range of 6 to 9.

3. The lipid according to claim 1 or 2, wherein R1 is selected from hydroxyl, carboxyl, C1-C3 alkylamine, C5-C6 alkylamine, C6 ... 12 heteroaryl, C5-C 12 Heteroaryl ketones, C3-C8 heterocyclic alkanes, C3-C8 heterocyclic ketones, and combinations thereof with carbonyl, amide, imide, sulfinyl, sulfonamide, or sulfonamide groups.

4. The lipid according to claim 3, wherein R1 is selected from one of the following formulas: , , , , , , , ,or .

5. The lipid according to claim 1, wherein: a) Each R2 has at least one carbon atom, wherein the hydrogen atoms thereon are replaced by one or two side chains; and / or b) R3 has at least one carbon atom, on which the hydrogen atom is replaced by one or two side chains.

6. The lipid according to claim 2, wherein: a) Each R2 has at least one carbon atom, wherein the hydrogen atoms thereon are replaced by one or two side chains; and / or b) Each R4 has at least one carbon atom, on which the hydrogen atoms are replaced by one or two side chains.

7. The lipid according to claim 5 or 6, wherein the carbon atom whose hydrogen atom is replaced by one or two side chains is the second or more distant carbon atom counted from the junction point.

8. The lipid according to any one of claims 5 to 7, wherein one or both side chains are C1-C4 alkyl.

9. The lipid according to claim 5 or 6, wherein each R2, R3 and / or each R4 is independently selected from one of the following formulas: , , , , , , , , , , , , , , , , , , , , , , ,or .

10. The lipid according to any one of claims 1-9, wherein the lipid is selected from one of the following formulas: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , or .

11. A lipid nanoparticle (LNP) comprising the lipids, neutral lipids, polyethylene glycol-lipids, and steroids as described in claims 1-10.

12. The LNP according to claim 11, wherein the neutral lipid is distearate phosphatidylcholine (DSPC) or dioleoylphosphatidylethanolamine (DOPE).

13. The LNP according to claim 11 or 12, wherein the polyethylene glycol-lipid is polyethylene glycol-dimyristoylglycerol (PEG-DMG).

14. The LNP according to any one of claims 11-13, wherein the steroid is cholesterol, β-sitosterol, or stigmasterol.

15. The LNP according to any one of claims 11-14, wherein the molar ratio of the lipids is from about 40% to about 60%, the molar ratio of the neutral lipids is from about 5% to about 20%, the molar ratio of the polyethylene glycol-lipids is from about 0.5% to about 5%, and the molar ratio of the steroids is from about 25% to about 50%.

16. The LNP of claim 15, wherein the molar ratio of the lipids is about 50%, the molar ratio of the neutral lipids is about 10%, the molar ratio of the polyethylene glycol-lipids is about 1.5%, and the molar ratio of the steroids is about 38.5%.

17. The LNP according to any one of claims 11-16, further comprising a nucleic acid molecule.

18. The LNP according to claim 17, wherein the nucleic acid molecule is DNA or RNA.

19. The LNP according to claim 17 or 18, wherein the nucleic acid molecule is plasmid DNA or closed-terminal DNA (ceDNA).

20. The LNP according to claim 17 or 18, wherein the nucleic acid molecule is selected from the group consisting of messenger RNA (mRNA), guide RNA (gRNA), small interfering RNA (siRNA), RNA interference (RNAi) molecules, microRNA (miRNA), microRNA antagonists, antisense RNA, ribozymes, short hairpin RNA (shRNA), or mixtures thereof.

21. A pharmaceutical composition comprising the LNP of any one of claims 11-20 and a pharmaceutically acceptable carrier.

22. A method of delivering nucleic acid molecules in vivo or in vitro to cells, comprising contacting the cells with the LNP of any one of claims 11-20.

23. A method of treating or preventing a disease in a subject in need, comprising administering to the subject a therapeutically effective amount of any one of claims 11-20, wherein the LNP comprises a nucleic acid molecule having therapeutic activity.

24. The method of claim 23, wherein the LNP is administered by injection.

Images