Methods and systems for therapeutic delivery of human GBAl gene

Abstract

Developing vehicles that efficiently deliver genes throughout the central nervous system (CNS) would expand the range of genetic diseases that can be treated. Applicants engineered an AAV capsid, BI-hTFR1, that binds to the human transferrin receptor (TfR1), a transporter protein expressed on the blood-brain barrier (BBB). BI-hTFR1 is actively transported across the human brain endothelial cell layer and provides 40-50-fold higher reporter expression in the CNS of human TFRC knock-in mice relative to AAV9. The enhanced tropism is CNS-specific and does not exist in wild-type mice. When used to deliver GBA1, whose mutation causes Gaucher disease and is associated with Parkinson's disease, BI-hTFR1 significantly increased brain and cerebrospinal fluid glucocerebrosidase activity compared to AAV9. Our work identifies BI-hTFR1 as a promising vector for human CNS gene therapy.

Description

Cross-references to related applications

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 612,232, filed December 19, 2023. The entire contents of the above-identified applications are incorporated herein by reference.

[0002] Statement on Federally Funded Research This invention was made with government funding granted by the National Institutes of Health (NIH) under approval numbers NS111689 and MH120096. The government holds certain rights to this invention.

[0003] Reference to electronic sequence listing The electronic sequence list (“BROD-5990WP ST26.xml”, 28,896,584 bytes in size, created on December 11, 2024) is incorporated herein by reference in its entirety. Technical Field

[0004] The main topic of this article is the treatment of lysosomal storage diseases by delivering GBA1 to the central nervous system (CNS). Background Technology

[0005] The development of gene therapies for neurodevelopmental and neurological disorders has been limited by the inability to efficiently deliver genes throughout the central nervous system (CNS). Several studies have reported engineered AAV9 capsids, most notably the AAV-PHP.B family, which enable highly efficient gene transfer throughout the CNS following intravenous administration in adult mice. However, to date, no engineered AAV capsid capable of crossing the blood-brain barrier (BBB) ​​and being efficiently transduced into the mouse brain has demonstrated enhanced CNS tropism in primates. In this work, the applicant employs a mechanism-first approach and engineered an AAV capsid that interacts with the transferrin receptor (TFR C).

[0006] The reference to or identification of any document in this application does not imply that such document is prior art to this invention. Summary of the Invention

[0007] In some aspects, the technology described herein relates to an engineered recombinant adeno-associated virus (AAV) particle comprising an engineered AAV capsid polypeptide including a transferrin receptor (TfR1) binding moiety and a recombinant AAV genome side-linked with an AAV ITR sequence, the recombinant AAV genome including a polynucleotide encoding GBA1 operatively linked to a regulatory element that promotes the expression of GBA1 in the central nervous system (CNS) of the subject.

[0008] In some respects, the techniques described herein relate to an engineered recombinant AAV particle in which the TfR1 binding portion is inserted into or substituted within loop IV, loop VIII, or both of the AAV capsid protein.

[0009] In some aspects, the techniques described herein relate to an engineered recombinant AAV particle, wherein the AAV capsid polypeptide is VP1, VP2, VP3, or a combination thereof.

[0010] In some aspects, the technology described herein relates to an engineered recombinant AAV particle in which the TfR1 binding portion is inserted between amino acids 588 and 589 of the capsid protein of AAV9, or at a similar position in the capsid protein of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV rh.74, or AAV rh.10.

[0011] In some aspects, the technology described herein relates to an engineered recombinant AAV particle in which the TfR1 binding portion is inserted between two consecutive amino acids within amino acid 451-460 of the capsid protein of AAV9, or at a similar position in the capsid protein of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV rh.74, or AAV rh.10.

[0012] In some aspects, the technology described herein relates to an engineered recombinant AAV particle, wherein the TfR1 binding portion comprises a 7-mer, said 7-mer comprising LHRLGPN (SEQ ID NO: 36834), YSRIGPN (SEQ ID NO: 42487), LHRLGPD (SEQ ID NO: 36413), LHRAGPD (SEQ ID NO: 36894), YSRIGPD (SEQ ID NO: 38223), LSRIGPD (SEQ ID NO: 36274), LARSGPD (SEQ ID NO: 18035), YSRNSDN (SEQ ID NO: 42488), LHKAGPN (SEQ ID NO: 36305), LSRIGPN (SEQ ID NO: 36347), LAKSGPN (SEQ ID NO: 36287), YARNGPN (SEQ ID NO: 14048), FRSTNGV (SEQ ID NO: 16070), VESTNGR (SEQ ID NO: 14048), LHRLGPN (SEQ ID NO: 36834), YSRIGPN (SEQ ID NO: 36287), YARNGPN (SEQ ID NO: 14048), FRSTNGV (SEQ ID NO: 16070), VESTNGR (SEQ ID NO: 36834), LHRLGPN (SEQ ID NO: 36834), LHRLGPD (SEQ ID NO: 36413), LHRAGPD (SEQ ID NO: 36894), YSRIGPD (SEQ ID NO: 38223), LSRIGPD (SEQ ID NO: 36274), LARSGPD (SEQ ID NO: 18035), YSRNSDN (SEQ ID NO: 42488), LHKAGPN (SEQ ID NO: 36305), LSRIGPN (SEQ ID NO: 36347), LAKSGPN (SEQ ID NO: 36287), YARNG NO: 36431), VDSTNGV (SEQ ID NO: 12206), VQSTNGV (SEQ ID NO: 36423), VSSTNGV (SEQ ID NO: 12333), TESTNGR (SEQ ID NO: 17558), VQSTNGI (SEQ ID NO: 11292), FVSTNGV (SEQ ID NO: 42491), RGEDVYP (SEQ ID NO: 36864), RLEDVFP (SEQ ID NO: 36264), RTYDSYP (SEQ ID NO: 37938), RTYDAYP (SEQ ID NO: 38571), RTYDSFP (SEQ ID NO: 37806), RTETVYP (SEQ ID NO: 36486), RTETVFP (SEQ ID NO: 36389), RTEHVFP (SEQ ID NO: 36603), LCKPCLD (SEQ ID NO: 36437), LCKPCPT (SEQ ID NO: 36438), KDEFTTF (SEQ ID NO: 36308), KDDFTTY (SEQ ID NO: 36336), RDEFTTY (SEQ ID NO: 36615), KDEFSTY (SEQ ID NO: 36390), RDEFTSF (SEQ ID NO: 36701), REDHVSW (SEQ ID NO: 37067), IALKGWD (SEQ ID NO: 36248), NALEGRD (SEQ IDNO: 36407), VALEGRD (SEQ ID NO: 36604), VALKGWD (SEQ ID NO: 17701), YSRLNMN (SEQ ID NO: 14301), YSRLNKD (SEQ ID NO: 16577), YHRLSNN (SEQ ID NO: 16636), VHRLQDK (SEQ ID NO: 16602) LHALSHN (SEQ ID NO: 16608), PSATNGV (SEQ ID NO: 20486), QVSTNGI (SEQ ID NO: 16021), SYSSNGV (SEQ ID NO: 16234), HQSSNGV (SEQ ID NO: 15978), VGSINGI (SEQ ID NO: 16199), AMSTNGR (SEQ ID NO: 16000), SASTNGV (SEQ ID NO: 16127), YMSTNGV (SEQ ID NO: 16042), YYSSNGV (SEQ ID NO: 16206), VHSTNGI (SEQ ID NO: 16134), PLSTNGV (SEQ ID NO: 16233), VYSTNGI (SEQ ID NO: 16059), IISTNGV (SEQ ID NO: 16054), RSVSSNGV (SEQ ID NO: 20502), YKSSNGV (SEQ ID NO: 16123).

[0013] In some aspects, the technology described herein relates to an engineered recombinant AAV particle, wherein the heptamer comprises YSRIGPN (SEQ ID NO: 42487).

[0014] In some respects, the technology described herein relates to an engineered recombinant AAV particle, wherein the TfR1 binding portion is selected from any of SEQ ID NO: 42513-43842.

[0015] In some aspects, the techniques described herein relate to a pharmaceutical composition comprising any of the engineered recombinant AAV particles described herein and an acceptable carrier.

[0016] One method of delivering GBA1 to the central nervous system (CNS) includes administering any of the pharmaceutical compositions described herein.

[0017] In some aspects, the techniques described herein relate to a method in which a pharmaceutical composition is prepared in the form of 0.1 x 10⁻⁶ tablets. 12 vg / kg to 1x10 14Dosage between vg / kg.

[0018] In some aspects, the techniques described herein relate to a method in which a pharmaceutical composition is prepared in the form of 0.1 x 10⁻⁶ tablets. 12 vg / kg up to 100x10 12 Administer at a dose of vg / kg.

[0019] In some aspects, the techniques described herein relate to a method in which a pharmaceutical composition is prepared in 1x10 12 vg / kg up to 10x10 12 Administer at a dose of vg / kg.

[0020] In some aspects, the techniques described herein relate to a method in which a pharmaceutical composition is in 5x10 12 Administer at a dose of vg / kg.

[0021] In some respects, the techniques described herein relate to a method in which the subject suffers from Gaucher's disease.

[0022] In some respects, the techniques described herein relate to a method in which the subject suffers from Parkinson's disease.

[0023] These and other aspects, objectives, features, and advantages of the exemplary embodiments will become apparent to those skilled in the art after considering the specific implementation of the following exemplary embodiments. Attached Figure Description

[0024] The features and advantages of the invention will be understood by referring to the following detailed description of illustrative embodiments in which the principles of the invention can be used, and the accompanying drawings, wherein: Figures 1A to 1F-AAV9 can be programmed to bind human TfR1. (1A) Screening of an AAV9-based NNK capsid library of variants with randomly inserted 7-mers between VP1 residues 588-589 was performed to target selective binding to human TfR1 in pull-down or cell binding assays. Individually generated human TfR1-binding variants carrying the CAG-NLS-mScarlet-P2A-luciferase-WPRE-SV40pA construct exhibited enhanced species-specific (1B) association with stable TFR C-expressing CHO cells and (1C) transduction (luciferase activity) in said CHO cells. Reported values ​​were normalized to AAV9 in each cell line. Two-factor ANOVA was performed to determine significant differences in transduction among the five AAV variants in the five CHO cell lines, using AAV9 as the primary comparison group for each cell line and employing Bonferroni multiple comparison correction: **** and *** indicate p ≤ 0.0001 and ≤ 0.001, respectively; n = 3 replicates, error bars indicate ± SEM. The TfR1-binding variants exhibited enhanced (1D) association with human brain microvascular endothelial cells (hBMVEC) and hCMEC / D3 cells, as well as (1E) transduction (luciferase activity) in these cells. Values ​​were normalized against AAV9 in each cell line. One-way ANOVA was performed to determine significant differences among the five AAV variants, using AAV9 as the comparison group for each cell line and Dunnett's multiple comparison correction was used: ****, ***, and * indicate p ≤ 0.0001, ≤ 0.001, and ≤ 0.05, respectively; n = 4 replicates, error bars indicate ± SEM. (1F) Binding kinetics between each capsid and full-length human TfR1 were evaluated by BLI. Capsids were loaded onto AAVx probes and human TfR1 was used as the analyte. Sensor plot curve fitting (black dotted line) was generated by applying a global 2:1 exponential association and decay model.

[0025] Figures 2A to 2D - The capsid targeting human TfR1 transduces into human brain endothelial cells via interaction with the apical domain of human TfR1. (2A) The drawing illustrates the effect with 3x10 8Transduction of hCMEC / D3 cells incubated with the indicated AAV at vg / mL and with specified concentrations of OKT9 or AF2474 antibody (luciferase, normalized RLU). Two-factor ANOVA was performed to determine significant differences in transduction with AAV9 or BI-hTFR1 and with different concentrations of either antibody, using an antibody-free control as the primary comparison group under each condition and corrected using Bonfrani multiple comparisons: **** indicates p ≤ 0.0001; n = 3 replicates, error bars indicate ± SEM. (2B) The effect of Tf on the binding of BI-hTFR1 to full-length human TfR1 was assessed by BLI. AAV9 or BI-hTFR1 was loaded onto the AAVx probe. Human TfR1, either pre-incubated with or not pre-incubated with 300 nM holo-Tf, was used as the analyte. A 2:1 binding model curve fit is shown (black dashed line). (2C) Biotinylated holo-Tf was immobilized on a streptavidin-coated BLI probe (SA probe), first introduced into human TfR1, then into buffer with or without OKT9 antibody, and finally into BI-hTFR1 viral particles. The gray shading highlights the association steps shown. (2D) BI-hTFR1 or AAV2 was incubated with hCMEC / D3 cells at 50,000 vg per cell for one hour at 4°C with or without OKT9 (1 μg / mL) or Tf (1 μg / mL), and immunostaining was performed against AAV and TfR1. Scale bar = 15 μm. AAV9 binding to hCMEC / D3 cells was rarely detected, therefore AAV2 was used as a control (Fig. 9).

[0026] Figures 3A to 3C -BI-hTFR1 is efficiently endocytotic and actively transported across human brain endothelial cells. (3A) Schematic diagram illustrates the pooled transwell BBB model experimental design. (3B) Quantification of the vector genome in the bottom chamber by qPCR. Two-way ANOVA with Bonfrani multiple comparison correction was performed: **** and *** indicate p ≤ 0.0001 and ≤ 0.001, respectively; n = 3 transwell replicates, error bars indicate ± SEM. (3C) BI-hTFR1 or AAV2 was incubated with hCMEC / D3 cells at 25,000 vg per cell at 37°C for one hour and stained against endosome markers Rab5 and Rab7, as well as AAV. Scale bar = 15 μm.

[0027] Figures 4A to 4D-BI-hTFR1 efficiently delivers the gene to the CNS of TFR CKI mice. (4A) In TFR CKI mice, mouse Tfrc exons 4-19 encoding the extracellular region of TfR1 have been replaced with human TFR C. (4B) BI-hTFR1 or AAV9 encoding CAG-NLS-mScarlet-P2A-luciferase-WPRE-SV40pA is delivered at 5 x 10⁻⁶ per mouse. 11 vg was administered intravenously to adult female C57BL / 6J or TFR CKI mice. AAV9 in C57BL / 6J and BI-hTFR1 in TFR CKI mice had n=4 mice per group. AAV9 in TFR CKI and BI-hTFR1 in C57BL / 6J had n=3 mice per group. Biodistribution (4C) and luciferase activity in different organs are shown at three weeks post-injection (4D), reported as vector genome number per mouse genome. Two-way ANOVA was performed to determine significant differences in organs among the four groups, using BI-hTFR1 in TFR CKI mice as the primary comparison group and Bonfrani multiple comparison correction: ****, ***, **, and * indicate p ≤ 0.0001, ≤ 0.001, ≤ 0.01, and ≤ 0.05, respectively; each data point represents an individual mouse, and error bars indicate ± SEM.

[0028] Figures 5A to 5F -BI-hTFR1 effectively transduces neurons and astrocytes throughout the CNS. Representative (5A) whole brain and (5B) spinal cord images of mice from each group are shown three weeks after injection. Representative figures show (5C) NeuN in the cortex, thalamus, and striatum of mice treated with TFR CKI. + Or (5E)SOX9 + Stained cell stacks of BI-hTFR1 transduced cells. (5D)NeuN cells expressing mScarlet are shown in the cortex, striatum, and thalamus. + Neuron or (5F)SOX9 + Percentage of astrocytes. Two-factor ANOVA was performed to determine significant differences in transduction in specific brain regions among the four groups of mice, using BI-hTFR1 in TFR CKI mice as the primary comparison group and Bonfrann multiple comparison correction was used: **** indicates p≤0.0001; each data point represents an individual mouse, and error bars indicate ±SEM.

[0029] Figures 6A to 6D-BI-hTFR1 effectively delivers GBA1 and increases GC enzyme activity in the brains of TFR CKI mice. A schematic diagram of the (6A) experiment shows an ssDNA AAV genome expressing human glucocerebrosidase, which is packaged into AAV9 or BI-hTFR1 and packaged at 1x10⁻¹. 14 vg / kg or 5x10 12 TFR CKI transgenic mice were administered vg / kg. (6B) The biodistribution of the AAV genome relative to AAV9 in brain and liver tissues is shown (n = 4 mice per condition). One-way ANOVA and Sidak's multiple comparison post-hoctest were performed using AAV9 as a control: **** and *** indicate p ≤ 0.0001 and ≤ 0.001, respectively; each data point represents an individual mouse, and the error bar indicates ± SEM. (6C) Sagittal brain sections (top) of mice in each group show GBA-HA in whole-brain sagittal sections. Scale bar = 1 mm. Immunostained images (bottom) show neurons (NeuN) and GBA-HA in the substantia nigra pars compacta. Scale bar = 25 μm. (6D) Enzymatic activity levels of GC enzymes in brain and liver tissue homogenates, CSF, and serum are shown. Post-hoc tests were performed using one-way ANOVA and multiple comparisons with Sidak, with AAV9 as the control group: **** indicates p≤0.0001; each data point represents an individual mouse, and the error bar indicates ±SEM.

[0030] Figures 7A to 7B - Validation assays confirmed the expression of TfR1 from the species shown in stable CHO cell lines. (7A) TFR C or TfrcmRNA expression levels were assessed by RT-qPCR using species-specific primers (Table S1). Each species primer set is shown in the indicated color (legend, top). The diagram shows the qPCR cycle threshold (Ct) values, which indicate selective early cycle number amplification of the target species sequence. Lines indicate the mean Ct values ​​(n = 3 replicates per cell line). (7B) Images show the immunofluorescence of TfR1. Each cell line was fixed, permeabilized, and stained with the indicated anti-TfR1 antibody to assess exogenous TfR1 expression.

[0031] Figures 8A to 8D- The binding between BI-hTFR1 and human TfR1 is inhibited by the apical domain binding antibody OKT9, but not holo-Tf. (8A) To evaluate the binding between each AAV capsid and full-length human TfR1, capsids were loaded onto AAVx probes and TfR1 was used as the analyte. Mean kinetic constants and standard errors were calculated from triplicate experiments; *Indication values ​​were calculated from capsids using only two experiments. (8B) Sensor plots illustrate the association and dissociation of BI-hTFR1 with HFCII probes loaded with Fc-hTfR1 in the presence of the indicated concentration of OKT9. Gray curves show the binding of OKT9 with Fc in the absence of BI-hTFR1. - Binding of hTfR1. (8C) The binding kinetics between full-length human TfR1 and human holo-Tf were assessed by BLI. Anti-transferrin antibody 12A6 was loaded onto a mouse Fc (MFC) probe. holo-Tf was loaded onto the probe and associated with serially diluted TfR1 analytes. (8D) The effect of Tf on the binding of BI-hTFR1 to full-length human TfR1 was assessed by BLI. AAV9 or BI-hTFR1 was loaded onto an AAVx probe. Human TfR1, whether pre-incubated with 300 nM holo-Tf or not, was used as the analyte. Mean kinetic constants and standard errors were calculated from triplicate experiments.

[0032] Figures 9A to 9C -AAV co-localizes with TfR1 and Tf in brain endothelial cells. (9A) The AAV shown was incubated with hCMEC / D3 cells at 25,000 vg per cell at 37°C for one hour. The cells were then fixed, permeabilized, and stained for AAV and nuclei. AAV2 was chosen as a control for subsequent experiments because AAV9 immunostaining was almost undetectable. (9B) BI-hTFR1 or AAV2 was incubated with hCMEC / D3 cells at 30,000 vg per cell at 37°C for one hour. The cells were then fixed, permeabilized, and stained for AAV and TfR1. (9C) BI-hTFR1 or AAV2 was incubated with hCMEC / D3 cells at 25,000 vg per cell in pre-chilled medium containing Tf-647 (1 μg / mL) at 4°C for one hour. The cells were then fixed and stained for AAV, Tf, and nuclei. All scales = 15μm.

[0033] Figure 10- Co-localization of AAV with subcellular compartment markers. BI-hTFR1 or AAV2 were incubated with hCMEC / D3 cells at 25,000 vg per cell at 37°C for one hour. Cells were then fixed, permeabilized, and stained for AAV, endosomes (Rab5 and Rab7), cis-Golgi apparatus (RCAS1), trans-Golgi network (TGN46) or endoplasmic reticulum (KDEL), and nuclei. All scale bars = 15 μm.

[0034] Figures 11A to 11B TfR1 levels in TFR CKI mice were matched in WT mice. (11A) RT-qPCR was performed using primers spanning exons 1 and 2 of the mouse Tfrc gene (Table S1) to assess mRNA levels in TFR CKI mice treated with AAV9 or BI-hTFR1 or in C57BL / 6J controls (n = 3 or 4 animals per group; error bars indicate ± SEM). No significant difference in TfR1 mRNA was detected in the cortex or spinal cord between C57BL / 6J and TFR CKI mice (two-way ANOVA). (11B) Western blots of proteins from brain tissue of C57BL / 6J and TFR CKI homozygous mice injected with AAV9 or BI-hTFR1, as well as purified full-length human or mouse TfR1 Fc fusion proteins with N-terminal flag tags, were stained with polyclonal anti-human TfR1 antibody AF2474 (R&D systems) or monoclonal antibody H68.4 (Thermofisher, catalog number 13-6890) that recognizes mouse and human TfR1.

[0035] Figures 12A to 12C -BI-hTFR1 exhibits enhanced CNS-specific tropism in TFR CKI mice and similar transduction to AAV9 in the liver and dorsal root ganglia. BI-hTFR1 or AAV9:CAG-NLS-mScarlet-P2A-luciferase-WPRE-SV40pA was administered at 5 x 10⁻⁶ pA per mouse. 11 The dose of vg was intravenously administered to adult female C57BL / 6J or TFR CKI mice. The levels of mScarlet transcripts relative to AAV9 in (12A) C57BL / 6J mice and native fluorescence in the liver (12B) and dorsal root ganglia (12C) are shown three weeks post-injection. In (12A), a two-way ANOVA was performed to determine significant differences in organs among the four groups of mice, using BI-hTFR1 in TFR CKI mice as the primary comparison group and Bonfrani multiple comparison correction was used: ****, ***, **, and * indicate p ≤ 0.0001, ≤ 0.001, ≤ 0.01, and ≤ 0.05, respectively; each data point represents an individual mouse, and error bars indicate ± SEM.

[0036] Figures 13A to 13C -GBA-HA expression in the liver and brain regions of mice injected with AAV9 or BI-hTFR1:GBA1. (13A) Image shows immunostaining of NeuN and HA in the deep cerebellar nuclei and brainstem of TFR CKI mice under the treatment conditions shown. Scale bar = 25 μm. (13B) Image shows the expression of -GBA-HA in the liver and brain regions of mice injected with 1x10⁻¹⁰ AAV9 or BI-hTFR1:GBA1. 14 vg / kg BI-hTFR1: Cell counts of GBA-HA-expressing NeuN+ cells transduced in the cortex, striatum, and thalamus of GBA1-TFR CKI mice. Each data point represents one mouse (n=4). Error bars indicate ±SEM. (13C) shows a representative map of transduced hepatocytes stained against HA under the conditions shown. Scale bar = 50 μm.

[0037] Figure 14 -AAV9 capsid residues 539-605 were aligned with other previously described capsids. (SEQ ID NO: 43879-43898) shows the heptamer insertion site between AAV9 residues 588 and 589. The black line above the alignment highlights the surrounding residues modified in this study. Corresponding residues in other exemplary capsid sequences are outlined, and residues different from AAV9 are shown in gray. Sequence alignment was performed using MUSCLE (SnapGene).

[0038] Figure 15 -TfR1 binding modification (SEQ ID NO: 43899-43911) -Exemplary insertion between residues 558 and 559 of AAV9 VP1.

[0039] Figures 16A to 16E - A partial view of an exemplary serotype sequence alignment (SEQ ID NO: 43912-43924).

[0040] Figure 17 -TfR1 binding portion insertion site in the AAV9 VP1 capsid (SEQ ID NO: 43925-43928).

[0041] The diagrams in this article are for illustrative purposes only and need not be drawn to scale.

[0042] Detailed Implementation of the Exemplary Scheme General definition Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of commonly used terms and techniques in molecular biology can be found in the following references: Molecular Cloning: A Laboratory Manual, 2nd Edition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4th Edition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (edited by F.M.A. Susubel et al.); the series Methods in Enzymology (Academic Press, Inc.); PCR 2: A Practical Approach (1995) (edited by M.J. MacPherson, B.D. Hames, and G.G. Taylor); Antibodies, A Laboratory Manual (1988) (edited by Harlow and Lane); Antibodies A Laboratory Manual, 2nd Edition, 2013 (edited by E.A. Greenfield); Animal Cell Culture (1987) (edited by R.R. Freshney); Benjamin Lewin, Genes IX, Jones and Bartlet, 2008 (ISBN). 0763752223); Kendrew et al. (Ed.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (Ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCHPublishers, Inc., 1995 (ISBN 9780471185710); Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd Edition, J. Wiley & Sons (New York, NY(1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure, 4th Edition, John Wiley & Sons (New York, NY 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2nd Edition (2011).

[0043] Unless the context clearly indicates otherwise, as used herein, the singular forms “a,” “an,” and “the” include both singular and plural indicators.

[0044] The terms “optional” or “optionally” mean that the event, situation, or alternative described below may or may not occur, and the description includes instances where the event or situation occurs and instances where it does not occur.

[0045] The range of values ​​listed by endpoints includes all numbers and fractions contained within the corresponding range, as well as the listed endpoints.

[0046] When referring to measurable values ​​such as parameters, quantities, or durations, the terms “about” or “approximately” as used herein are intended to cover deviations from the specified value, such as deviations of + / -10% or less, + / -5% or less, + / -1% or less, + / -0.1% or less, provided that such deviations are suitable for implementation in the disclosed invention. It should be understood that the values ​​referred to by the modifier “about” or “approximately” are also specifically and preferably disclosed.

[0047] As used herein, a “biological sample” may contain intact cells and / or live cells and / or cell debris. A biological sample may contain (or be derived from) “body fluids.” This invention covers embodiments in which body fluids are selected from amniotic fluid, aqueous humor, vitreous humor, bile, serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudate, feces, female ejaculation, gastric acid, gastric juice, lymph, mucus (including nasal drainage and sputum), pericardial fluid, peritoneal fluid, pleural fluid, pus, inflammatory secretions (rheum), saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretions, vomitus, and mixtures thereof. Biological samples include cell cultures, body fluids, and body fluid cell cultures. Body fluids may be obtained from mammalian organisms, for example, through puncture or other collection or sampling procedures.

[0048] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to vertebrates, preferably mammals, and more preferably humans. Mammals include, but are not limited to, rats, monkeys, humans, farm animals, sporting animals, and pets. It also encompasses tissues, cells, and their progeny from biological entities obtained in vivo or cultured in vitro.

[0049] Various embodiments are described below. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation on the broader aspects discussed herein. An aspect described in connection with a particular embodiment is not necessarily limited to that embodiment and can be practiced using any one or more other embodiments. References to “one embodiment” or “an embodiment” in this specification mean that at least one embodiment of the invention includes a particular feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases “in one embodiment” or “in an embodiment” appearing in various places in this specification do not necessarily refer to the same embodiment, but may refer to the same embodiment. Furthermore, as will be apparent to those skilled in the art from this disclosure, particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. Moreover, while some embodiments described herein include some features included in other embodiments but not others, combinations of features from different embodiments are intended to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments may be used in any combination.

[0050] Unless otherwise indicated, the terms “polypeptide” and “protein” are used interchangeably in this document to refer to the viral capsid.

[0051] See PCT / US2023 / 070285, which is incorporated herein by reference.

[0052] All publications, published patent documents and patent applications cited herein are incorporated herein by reference to the extent that each individual publication, published patent document or patent application is specifically and individually indicated to be incorporated by reference.

[0053] Overview In some aspects, the technology described herein relates to an engineered recombinant adeno-associated virus (AAV) particle comprising an engineered AAV capsid polypeptide containing a transferrin receptor (TfR1) binding moiety and a recombinant AAV genome containing a polynucleotide encoding GBA1 operatively linked to a regulatory element that promotes the expression of GBA1 in the central nervous system (CNS).

[0054] TFR C (i.e., the TfR1 protein encoded by the TFR C gene, or CD71) contains two types of receptors: TFR C1 (or differentiation cluster 71 (CD71)) and TFR C2. TFR C1 binds to transferrin (TF) with high affinity and is widely expressed. TFRC1 is a type II transmembrane glycoprotein of approximately 90 kDa and contains approximately 760 amino acids. TFR C1 is normally present on the cell surface as a dimer linked by disulfide bonds, see Figure 4. The TFR C1 domain contains an extracellular C-terminal domain (approximately 671 amino acids) and includes a TF binding site. The extracellular C-terminal domain contains three subdomains: a apical domain, a helical domain, and a protease-like domain, see Figure 4. In addition, the extracellular C-terminal domain contains three N-linked glycosylation sites at asparagine residues 251, 317, and 727 and one O-linked glycosylation site at threonine 104, which enables the receptor to function fully. TFR C1 also contains a transmembrane domain (approximately 29 amino acids) and an intracellular N-terminal domain (approximately 61 amino acids). In addition to iron delivery via TF-TFR C1, iron uptake also occurs through H-ferritin binding via the apical domain. See also Candelaria, PV, et al. Antibodies Targeting the Transferrin Receptor 1 (TfR1) as Direct Anti-Cancer Agents. Frontiers in Immunology, 2021, 12, which is incorporated herein by reference.

[0055] In one exemplary embodiment, the TfR1 binding portion binds to the extracellular domain of TFR C. In one exemplary embodiment, the TfR1 binding portion binds to one or more of a apical domain, a helical domain, and / or a protease-like domain. In one exemplary embodiment, the TfR1 binding portion binds to the apical domain.

[0056] Engineered viral particles used to deliver GBA1 This document describes various embodiments of engineered recombinant viral particles, such as adeno-associated virus (AAV) particles, which may be engineered to confer cell-selective tropism, such as CNS tissue and cell-specific tropism. The engineered recombinant AAV (rAAV) may comprise a capsid polypeptide engineered to include a targeting portion displayed on the outer surface of the assembled rAAV capsid and confer cell-specific tropism, such as CNS tissue-specific tropism; and a recombinant AAV genome containing a polynucleotide encoding GBA1. In one embodiment, the targeting portion binds to human transferrin receptor (TfR1), a transporter protein expressed at the blood-brain barrier (BBB).

[0057] Engineered viral capsid peptides The TfR1 binding portion is part of the viral capsid protein. The engineered viral capsid may be a variant of the wild-type viral capsid. In one embodiment, the engineered viral capsid polypeptide is an engineered AAV capsid polypeptide. For example, the engineered AAV capsid may be a variant of the wild-type AAV capsid. In one embodiment, the wild-type AAV capsid may consist of VP1, VP2, and VP3 capsid proteins or combinations thereof. In other words, the engineered AAV capsid may include one or more variants of wild-type VP1, wild-type VP2, and / or wild-type VP3 capsid proteins. In one embodiment, the serotype of the reference wild-type AAV capsid may be AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-8, AAV-9, or any combination thereof. In one embodiment, the serotype of the wild-type AAV capsid may be AAV-9. The engineered AAV capsid may have a different tropism than the reference wild-type AAV capsid.

[0058] The TfR1 binding portion may insert between two amino acids of the viral polypeptide, such that the TfR1 binding portion is external to the assembled rAAV particle (i.e., exposed on its surface). In one exemplary embodiment, the TfR1 binding portion disclosed herein may insert between two amino acids in the wild-type viral protein (VP) (or capsid protein), including the region of the surface exposed when incorporated into the viral capsid.

[0059] In one embodiment, the TfR1 binding moiety may be inserted between two amino acids in a variable amino acid region of the AAV capsid polypeptide. The core of each wild-type AAV viral protein contains an eight-chain β-barrel motif (βB to βI) and an α-helix (αA), which are conserved in autonomous parvovirus capsids (see, for example, DiMattia et al. 2012. J. Virol. 86(12): 6947-6958). Structural variable regions (VRs) (also known as “loops”) appear in surface loops connecting the β chains, and these VRs aggregate to create localized variations on the capsid surface. AAV has 12 variable regions (also known as hypervariable regions) (see, for example, Weitzman and Linden. 2011. “Adeno-Associated Virus Biology.” Snyder, RO, Moullier, P. (ed.) Totowa, NJ: Humana Press). In one embodiment, one or more TfR1 binding moieties may be inserted between two amino acids in one or more of the 12 variable regions in the wild-type AVV capsid protein. In one embodiment, one or more TfR1 binding moieties may each be inserted between two amino acids in VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-III, VR-IX, VR-X, VR-XI, VR-XII, or combinations thereof. In an exemplary embodiment, the TfR1 binding moieties are inserted into or substituted within rings IV and / or VIII.

[0060] In one embodiment, the TfR1 binding motif is inserted between amino acids 588 and 589 of the AAV9 capsid protein or at a similar position to the capsid proteins of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh.74, or AAVrh.10. In one embodiment, the engineered capsid is a modified AAV1 capsid. It may have a TfR1 binding motif inserted after or adjacent to amino acid 590 (i.e., between amino acids 590 and 591). In one embodiment, the engineered capsid is a modified AAV3 capsid and may have a TfR1 binding motif inserted after or adjacent to amino acid 586. In one embodiment, the engineered capsid is a modified AAV4 capsid and may have a TfR1 binding motif inserted after or adjacent to amino acid 586. In one embodiment, the engineered capsid is a modified AAV5 capsid and may have a TfR1 binding motif inserted after or near amino acid 575. In one embodiment, the engineered capsid is a modified AAV6 capsid and may have a TfR1 binding motif inserted at or near amino acid 585 and optionally Y705-731, T492V, K531E. In one embodiment, the engineered capsid is a modified AAV8 capsid and may have a TfR1 binding motif inserted after or near amino acids 585 and 590. In one embodiment, the engineered capsid is a modified AAV9 capsid and may have a TfR1 binding motif inserted between amino acids 588 and 589. (Büning, H.; Srivastava, A. Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors. Molecular Therapy-Methods & Clinical Development 2019, 12, 248-265). In one embodiment, the engineered capsid may have a TfR1 binding portion inserted between amino acids 588 and 589 of the AAV9 viral protein. SEQ ID NO: 20506 is a reference sequence for the AAV9 capsid, referring at least to the insertion site discussed above. In one embodiment, the engineered capsid may have a TfR1 binding portion inserted between two consecutive amino acids within amino acids 451-460 of the capsid protein of the AAV9 viral protein. It should be understood that the TfR1 binding portion may be inserted at a similar location in other serotypes of AAV viral proteins, such as, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.74, and AAVrh.10 capsid polypeptides.

[0061] In one embodiment, the first 1, 2, 3, or 4 amino acids of the TfR1 binding moiety may replace 1, 2, 3, or 4 amino acids of the polypeptide into which it is inserted and preceding the insertion site. Using AAV as another non-limiting example, one or more of the TfR1 binding moiety may be inserted between amino acids 588 and 589 of, for example, the AAV9 capsid polypeptide, and the insert may replace amino acids 586, 587, and 588 such that the amino acid immediately following the insertion site preceding the TfR1 binding moiety is residue 585. It should be understood that this principle can be applied to any other insertion background and is not necessarily limited to insertion between residues 588 and 589 of the AAV9 capsid or an equivalent position in another AAV capsid. It should also be understood that in one embodiment, no amino acids in the polypeptide into which the TfR1 binding moiety is inserted are replaced by the TfR1 binding moiety. In an exemplary embodiment, the AAV capsid protein is selected from SEQ ID NO: 20506.

[0062] In one exemplary embodiment, the TfR1 binding portion is inserted into or substituted within loop IV, loop VIII, or both of the AAV capsid protein.

[0063] In one exemplary embodiment, the TfR1 binding portion includes a heptamer. In one exemplary embodiment, the heptamer comprises LHRLGPN (SEQ ID NO: 36834), YSRIGPN (SEQ ID NO: 42487), LHRLGPD (SEQ ID NO: 36413), LHRAGPD (SEQ ID NO: 36894), YSRIGPD (SEQ ID NO: 38223), LSRIGPD (SEQ ID NO: 36274), LARSGPD (SEQ ID NO: 18035), YSRNSDN (SEQ ID NO: 42488), LHKAGPN (SEQ ID NO: 36305), LSRIGPN (SEQ ID NO: 36347), LAKSGPN (SEQ ID NO: 36287), YARNGPN (SEQ ID NO: 14048), FRSTNGV (SEQ ID NO: 16070), VESTNGR (SEQ ID NO: 36431), VDSTNGV (SEQ ID NO: 12206), and VQSTNGV (SEQ ID NO: 16070). NO: 36423), VSSTNGV (SEQ ID NO: 12333), TESTNGR (SEQ ID NO: 17558), VQSTNGI (SEQ ID NO: 11292), FVSTNGV (SEQ ID NO: 42491), RGEDVYP (SEQ ID NO: 36864), RLEDVFP (SEQ ID NO: 36264), RTYDSYP (SEQ ID NO: 37938), RTYDAYP (SEQ ID NO: 38571), RTYDSFP (SEQ ID NO: 37806), RTETVYP (SEQ ID NO: 36486), RTETVFP (SEQ ID NO: 36389), RTEHVFP (SEQ ID NO: 36603), LCKPCLD (SEQ ID NO: 36437), LCKPCPT (SEQ ID NO: 36438), KDEFTTF (SEQ ID NO: 36308), KDDFTTY (SEQ ID NO: 36336), RDEFTTY (SEQ ID NO: 36615), KDEFSTY (SEQ ID NO: 36390), RDEFTSF (SEQ ID NO: 36701), REDHVSW (SEQ ID NO: 37067), IALKGWD (SEQ ID NO: 36248), NALEGRD (SEQ IDNO: 36407), VALEGRD (SEQ ID NO: 36604), VALKGWD (SEQ ID NO: 17701), YSRLNMN (SEQ ID NO: 14301), YSRLNKD (SEQ ID NO: 16577), YHRLSNN (SEQ ID NO: 16636), VHRLQDK (SEQ ID NO: 16602) LHALSHN (SEQ ID NO: 16608), PSATNGV (SEQ ID NO: 20486), QVSTNGI (SEQ ID NO: 16021), SYSSNGV (SEQ ID NO: 16234), HQSSNGV (SEQ ID NO: 15978), VGSINGI (SEQ ID NO: 16199), AMSTNGR (SEQ ID NO: 16000), SASTNGV (SEQ ID NO: 16127), YMSTNGV (SEQ ID (SEQ ID NO: 16042), YYSSNGV (SEQ ID NO: 16206), VHSTNGI (SEQ ID NO: 16134), PLSTNGV (SEQ ID NO: 16233), VYSTNGI (SEQ ID NO: 16059), IISTNGV (SEQ ID NO: 16054), RSVSSNGV (SEQ ID NO: 20502), YKSSNGV (SEQ ID NO: 16123). In one embodiment, the 7-mer comprises YSRIGPN (SEQ ID NO: 42487).

[0064] In one embodiment, the target binding portion may be defined by formula X1-X2-X3-[7-mer]-X4-X5-X6-X7 (Formula I), wherein the 7-mer is inserted between amino acids 588 and 589 of the AAV9 capsid polypeptide, or at a similar position of the capsid polypeptide of another AAV serotype, and wherein X1, X2, X3, X4, X5, X6, and X7 indicate one or more modifications to the amino acid position of the inserted 7-mer in the capsid polypeptide. In one embodiment, the TfR1 binding portion according to Formula I is selected from any of SEQ ID NO: 42513-43842.

[0065] Other garment decorations In one embodiment, the viral capsid protein may contain one or more mutations relative to the wild type. In one exemplary embodiment, the one or more mutations comprise a K449R substitution in the capsid polypeptide of AAV 920507 or a substitution at a similar position in the capsid polypeptides of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV rh.74, or AAV rh.10. In one exemplary embodiment, the K449R-substituted AAV capsid is selected from SEQ ID NO: 20507.

[0066] In exemplary embodiments, in addition to the n-mer motif of this disclosure, viral capsid proteins may also contain other targeting motifs. Without being bound by theory, other TfR1 binding motifs may be antibodies or fragments thereof. In one embodiment, other TfR1 binding motifs may be any molecule or composition capable of recognizing, binding to, attaching to, or otherwise interacting with a binding partner that may be present on the surface of a target cell. Binding partners include, but are not limited to, nucleic acids, proteins, peptides, sugars, lipids, or any combination thereof, or any one or more other molecules present on the surface of the target cell. In one embodiment, the binding partner is unique to a cell type, cell state, or associated set of cell types or states. In one embodiment, the binding partner is a receptor, channel, or other complex present on the surface of the target cell. These other TfR1 binding motifs may target a specific cell type or cell state within a set of target cells, such as those targeted by the n-mer motif. As used herein, “cell state” describes a transient element of cell identity. A cell state can be considered a transient characteristic morphology or phenotype of a cell. Cell states arise transiently in time-dependent processes, either as a unidirectional temporal progression (e.g., during differentiation or after environmental stimuli) or as state fluctuations, which are not necessarily unidirectional and in which cells may return to their initial state. These fluctuations can be oscillatory (e.g., cell cycle or circadian rhythms) or involve transitions between states without a predetermined order (e.g., due to random or environmentally controlled molecular events). These time-dependent processes may occur transiently in stable cell types (e.g., in transient environmental responses) or produce new, unique types (e.g., during differentiation). See, for example, Wagner et al., 2016. Nat Biotechnol. 34(11): 1145-1160.

[0067] In one embodiment, the additional TfR1 binding portion is or includes a peptide or polypeptide. In one embodiment, the additional TfR1 binding portion is or includes an antibody or a fragment thereof. Exemplary antibodies and fragments are described in more detail elsewhere herein, such as in the discussion of exemplary payloads. In one embodiment, the additional TfR1 binding portion is or includes an aptamer. In one embodiment, the additional TfR1 binding portion is or includes a small molecule. In one embodiment, the additional TfR1 binding portion is or includes a nucleic acid (e.g., DNA or RNA). In one embodiment, the additional TfR1 binding portion is or includes a receptor. In one embodiment, the additional TfR1 binding portion is or includes a receptor ligand. In one embodiment, the additional TfR1 binding portion is or includes a carbohydrate (e.g., a sugar). In one embodiment, the additional TfR1 binding portion is or includes a lipid. In one embodiment, the additional TfR1 binding portion is an engineered protein scaffold. In one embodiment, the additional TfR1 binding portion is an affinity compound. In one embodiment, the additional TfR1 binding portion is an antibody mimic. In one embodiment, the other TfR1 binding moiety is an engineered binding protein, such as a designed ankyrin repeat protein (DARPin) (see, for example, Plückthun et al., Annu. Rev. Pharmacol. Toxicol. (2015) 55(1): 489-511), avimer (Silverman et al., Nat. Biotechnol. (2005) 23(12): 1556-1561 and Jeong et al., Nat. Biotechnol. (2005) 23(12): 1493-1494) or an affinity (see, for example, Nord et al., Nat. Biotechnol. (1997) 15(8): 772-777). In an exemplary embodiment, the other TfR1 binding moiety is a receptor ligand or binding protein. In one embodiment, the other TfR1 binding moiety is attached to or otherwise coupled to the capsid surface. In one embodiment, other TfR1 binding portions are encoded by a carrier that produces the capsid of the invention described herein.

[0068] Engineered recombinant AAV genome for expressing GBA1 The transgene encoding GBA1 is inserted into a recombinant AAV genome flanked by an AAV ITR sequence and operatively linked to a regulatory element that promotes GBA1 expression in the CNS. In one embodiment, a polynucleotide encoding the engineered AAV capsid is operatively coupled to a polyadenylated tail. In one embodiment, the polyadenylated tail may be an SV40 polyadenylated tail.

[0069] GBA1 GBA1 (also known as glucoceramitinase β1; GBA, GCB; and GLUC) is located at the human 1q22 locus and encodes a lysosomal membrane protein. In one embodiment, the polynucleotide sequence in the recombinant AAV genome is a DNA sequence derived from primary accession number P04062. In another exemplary embodiment, the DNA sequence is P04062. In another exemplary embodiment, the DNA sequence is derived from secondary accession numbers A8K796, B7Z5G2, B7Z6S1, J3KQG4, J3KQ9, Q16545, Q4VX22, Q6I9R6, and Q9UMJ8. In another exemplary embodiment, the DNA sequence is selected from the group consisting of A8K796, B7Z5G2, B7Z6S1, J3KQG4, J3KQK9, Q16545, Q4VX22, Q69R6, and Q9UMJ8.

[0070] In another exemplary embodiment, the polynucleotide sequence included in the vector encodes an RNA sequence derived from the following: NM_000157.4; NM_001005741.3; NM_001005742.3; NM_001171811.2; and NM_001171812.2. In another exemplary embodiment, the polynucleotide sequence included in the vector encodes an RNA sequence selected from the group consisting of: NM_000157.4; NM_001005741.3, NM_001005742.3, NM_001171811.2; and NM_001171812.2. In another exemplary embodiment, the sequence included in the vector is derived from mRNA selected from the group consisting of: AK291911.1, AK298900.1, AK300186.1, AK300829.1, AK300876.1, AK301374.1, AK301879.1, AK302000.1, AK311242.1, AK312502.1, AL547558.3, AU122729.1, AU131071.1, AU140 959.1, AU141794.1, BC003356.1, BI458641.1, BX382279.2, BX477204.1, BX648487.1, D13286.1, DC297079.1, K02920.1, KJ690771.1, KJ690772.1, KJ690773.1, LC050340.1, LC050341.1, LC050342.1, M16328.1 and M19285.1. In another exemplary embodiment, the sequence included in the vector encodes an mRNA sequence selected from the group consisting of: AK291911.1, AK298900.1, AK300186.1, AK300829.1, AK300876.1, AK301374.1, AK301879.1, AK302000.1, AK311242.1, AK312502.1, AL547558.3, AU122729.1, AU131071.1, AU14 0959.1, AU141794.1, BC003356.1, BI458641.1, BX382279.2, BX477204.1, BX648487.1, D13286.1, DC297079.1, K02920.1, KJ690771.1, KJ690772.1, KJ690773.1, LC050340.1, LC050341.1, LC050342.1, M16328.1 and M19285.1.

[0071] All gene name symbols used throughout this specification refer to genes commonly known in the art. The instances of gene names mentioned herein should be understood to encompass genes in humans and any other organism (e.g., homologous, orthologous genes). The term homology may be applied to relationships between genes that diverged due to speciation events (e.g., orthologous genes). Generally, orthologs retain the same function during evolution. Gene symbols may be those mentioned by the HUGO Gene Nomenclature Committee (HGNC) or the National Center for Biotechnology Information (NCBI). Any reference to a gene symbol refers to the entire gene or its variant. Mentions of genes encompass gene products (e.g., proteins encoded by the gene).

[0072] Control element Recombinant expression vectors may contain the nucleic acids of the present invention in a form suitable for expression in host cells. This means that the recombinant expression vector includes one or more regulatory elements selectable according to the host cell to which expression is to be performed, said regulatory elements being operatively linked to the nucleic acid sequence to be expressed. In some cases, “recombinant expression vector” may refer to “recombinant AAV genome.” Within a recombinant expression vector, “operatively linked” is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the nucleotide sequence to be expressed (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell). As used herein, the term “operatively linked” also refers to the functional relationship and position of a promoter sequence relative to the polynucleotide of interest (e.g., if a promoter or enhancer affects the transcription of the sequence, then it is operatively linked to the coding sequence). Typically, an operatively linked promoter is adjacent to the sequence of interest. However, an enhancer does not need to be adjacent to the sequence of interest to control its expression. As used herein, the term "promoter" refers to a nucleic acid fragment used to control the transcription of one or more polynucleotides located upstream of one or more polynucleotide sequences, and is structurally identified by the presence of a DNA-dependent RNA polymerase binding site, a transcription initiation site, and any other DNA sequence (including, but not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequence known in the art to directly or indirectly regulate the amount of transcription of the promoter). "Tissue-specific" promoters are active only in specific types of differentiated cells or tissues.

[0073] In another embodiment, the vector of the present invention further comprises expression control sequences, including but not limited to suitable transcription sequences (i.e., initiation, termination, promoters, and enhancers), effective RNA processing signals (e.g., splicing and polyadenylation (polyA) signals), sequences stabilizing cytoplasmic mRNA, sequences improving translation efficiency (i.e., Kozak concordant sequences), and sequences enhancing protein stability. A large number of expression control sequences (including native, constitutive, inducible, or tissue-specific promoters) are known in the art and can be used according to the present invention.

[0074] In another embodiment, the vector of the present invention further comprises a posttranscriptional regulatory region. In a preferred embodiment, the posttranscriptional regulatory region is a marmot hepatitis virus posttranscriptional region (WPRE) or a functional variant and fragment thereof, and a PPT-CTS or a functional variant and fragment thereof (see, for example, Zufferey R et al., J. Virol. 1999; 73: 2886-2892; and Kappes J et al., WO2001 / 044481). In a particular embodiment, the posttranscriptional regulatory region is a WPRE. As used herein, the terms “marmot hepatitis virus posttranscriptional regulatory element” or “WPRE” refer to a DNA sequence that forms a tertiary structure during transcription that enhances gene expression (see, for example, Lee Y et al., Exp. Physiol. 2005; 90(l): 33-37 and Donello J et al., J. Virol. 1998; 72(6): 5085-5092).

[0075] The term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (such as transcription termination signals, like polyadenylation signals and poly-U sequences). For example, such regulatory elements are described in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).

[0076] Regulatory elements include those that constitutively guide the expression of nucleotide sequences in many types of host cells and those that guide the expression of nucleotide sequences only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters may primarily guide expression in a desired tissue of interest (such as adipose tissue) or a specific cell type (e.g., adipocytes or adipocyte progenitor cells). Regulatory elements may also guide expression in a time-dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell-type specific. In one embodiment, the vector comprises one or more pol III promoters (e.g., 1, 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g., 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g., 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof. The term "regulatory element" also encompasses enhancer elements (e.g., adipose-specific enhancers or marmot hepatitis virus posttranscriptional regulatory elements (WPREs)). Those skilled in the art will understand that the design of expression vectors can depend on factors such as the selection of host cells to be transformed and the desired expression level. Vectors can be introduced into host cells to produce transcripts, proteins, or peptides, including fusion proteins or peptides encoded by nucleic acids (such as GBA1).

[0077] In one implementation, the promoter may be constitutive. Suitable tissue-specific and constitutive promoters are discussed elsewhere herein and are generally known in the art and commercially available. Suitable neuronal tissue / cell-specific promoters include, but are not limited to, the GFAP promoter (astrocytocytes), the SYN1 promoter (neurons), and NSE / RU5' (mature neurons). In one implementation, neuronal tissue / cell-specific promoters include human elongation factor 1a subunit (EF1a), truncated EF1a fragment (EFS), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken p-actin (CBA) and its derivative CAG, glucuronidase promoter (GUSB) or ubiquitin C (UBC), neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), CASI, platelet-derived growth factor B chain (PDGF-P), CK6, TK, tetracycline-responsive promoter (TRE), phosphoglycerate kinase (PGK), telomerase (hTERT), SV40, intercellular adhesion molecule 2 (ICAM-2), synaptokines Syn, methyl CpG-binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabolotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or heavy chain (NFH), small P-globulin gene np2, proenkephalinogen (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), cardiovascular promoters (e.g., αMHC, cTnT, CMV-MLC2k), liver promoters (e.g., hAAT, TBG), skeletal muscle promoters (e.g., desmin, MCK, C512) or fragments thereof (e.g., truncated) or functional variants thereof. See International Patent Application No. WO / 2023 / 081648, which is incorporated herein by reference.

[0078] Polynucleotide constructs for generating rAAV particles The engineered viral capsid and / or capsid protein may be encoded by one or more engineered viral capsid polynucleotides. In one embodiment, the engineered viral capsid polynucleotide is an engineered AAV capsid polynucleotide or an engineered adenovirus capsid polynucleotide. In one embodiment, the engineered viral capsid polynucleotide (e.g., an engineered AAV capsid polynucleotide or an engineered adenovirus capsid polynucleotide) may include a 3′ polyadenylation signal. The polyadenylation signal may be an SV40 polyadenylation signal.

[0079] In one embodiment, the engineered polynucleotide may be included in a polynucleotide configured to express an engineered capsid in a host cell system for generating viral particles. The host cell system may also include a construct expressing a recombinant viral genome containing a transgene encoding a polypeptide or nucleic acid operatively linked to one or more regulatory sequences that promote transgene expression in target cells, including a recombinant AAV genome wherein an AAV ITR sequence is side-mounted to both the transgene and the regulatory sequence.

[0080] In one embodiment, the polynucleotide encoding the engineered AAV capsid may be included in the polynucleotide configured to express the engineered capsid in a host cell system for generating AAV viral particles. The host cell system may also include a construct expressing a recombinant AAV viral genome containing a transgene encoding a polypeptide or nucleic acid operatively linked to one or more regulatory sequences, said one or more regulatory sequences promoting transgene expression in target cells, including recombinant AAV genes wherein an AAV ITR sequence is flanked by the transgene and the regulatory sequence.

[0081] pharmaceutical preparations In some aspects, the technology described herein relates to a pharmaceutical composition comprising engineered recombinant AAV particles as described herein and an acceptable carrier. As used herein, a “pharmaceutical formulation” means the combination of an active agent, compound, or ingredient with a pharmaceutically acceptable carrier or excipient such that the composition is suitable for diagnostic, therapeutic, or prophylactic use in vitro, in vivo, or ex vivo. As used herein, a “pharmaceutically acceptable carrier or excipient” means a carrier or excipient that can be used to prepare a pharmaceutical formulation that is generally safe, non-toxic, and not biologically or otherwise undesirable, and includes carriers or excipients suitable for veterinary use as well as for human pharmaceutical use. As used in this specification and claims, a “pharmaceutically acceptable carrier or excipient” includes one or more such carriers or excipients. The compound may optionally be present in the pharmaceutical formulation in the form of a pharmaceutically acceptable salt.

[0082] Suitable pharmaceutically acceptable carriers include, but are not limited to, phosphate-buffered saline (PBS) or tris(hydroxymethyl)aminomethane hydrochloride (tris), surfactants (such as Pluronic F-68 or Poloxamer 188), sodium chloride, magnesium chloride, and / or glycerol.

[0083] In addition, suitable pharmaceutically acceptable carriers may include water, salt solutions, alcohols, gum arabic, vegetable oils, benzyl alcohol, polyethylene glycol, gelatin, carbohydrates (such as lactose, amylose, or starch), magnesium stearate, talc, silica, viscous paraffin, aromatic oils, fatty acid esters, hydroxymethylcellulose, and polyvinylpyrrolidone, which do not react adversely with the active composition.

[0084] Pharmaceutical formulations may be sterile and, if necessary, mixed with agents such as preservatives, stabilizers, salts for influencing osmotic pressure, buffers, and / or surfactants, which do not react harmfully with the active compound.

[0085] In one embodiment, the pharmaceutical formulation may further include an effective amount of a second active agent, including but not limited to biological agents or molecules, but not limited to, for example, polynucleotides, amino acids, peptides, polypeptides, antibodies, aptamers, ribozymes, hormones, immunomodulators, antipyretics, anxiolytics, antipsychotics, analgesics, antispasmodics, anti-inflammatory agents, antihistamines, anti-infectives, chemotherapeutic agents, and combinations thereof.

[0086] Methods for delivering GBA1 to CNS A method of delivering GBA1 to the CNS may include administering the rAAV particles or pharmaceutical formulation described herein to a subject in need. An engineered capsid may deliver a polynucleotide encoding a therapeutic protein or nucleic acid to the CNS, where the protein or nucleic acid is expressed. In one embodiment, the subject has Gaucher disease. In another embodiment, the subject has Parkinson's disease or is at risk of developing Parkinson's disease. In one embodiment, the Gaucher disease is type 2 or type 3. Type 2 and type 3 Gaucher disease are neuronal forms of the disease and affect the central nervous system.

[0087] The compositions of the present invention can be formulated for delivery to human subjects and to animals (e.g., livestock (cattle, pigs, others)) and other non-human mammal subjects for veterinary purposes. The dosage of the formulation can be measured or calculated by viral particles or genome copies (“GC”) / viral genome (“vg”). The number of genome copies (GC) of the viral compositions of the present invention can be determined using any method known in the art. In one embodiment, the viral composition can be formulated in dose units, thereby containing approximately 1.0 x 10⁻⁶ ppm. 9 GC to approximately 1.0x 10 15 GC (for treating ordinary subjects weighing 70 kg) and preferably 1.0 x 10 for human patients. 12 GC to 1.0x 10 14 A viral vector in a GC range. Preferably, the viral dose in the formulation is 1.0 x 10⁻⁶. 9 GC, 5.0X 109 GC, 1.0X 10 10 GC, 5.0X 10 10 GC, 1.0X 10 11 GC, 5.0X10 11 GC, 1.0X10 12 GC, 5.0X 10 12 GC or 1.0x 10 13 GC, 5.0X 10 13 GC, 1.0X 10 14 GC, 5.0X 10 14 GC or 1.0x10 15 GC.

[0088] In an exemplary implementation, the dose is 0.1 x 10⁻⁶. 12 vg / kg to 1x 10 14 Between vg / kg. In an exemplary embodiment, the therapeutically effective dose is 0.1 x 10⁻⁶. 1 2vg / kg to 100x 10 12 Any amount between vg / kg. In an exemplary embodiment, the therapeutically effective dose is 1 x 10⁻⁶. 12 Any amount between vg / kg and 10 x 10¹² vg / kg. In an exemplary embodiment, the therapeutically effective amount is 5 x 10¹² vg / kg. 12 vg / kg.

[0089] In one embodiment, the dose may be per pL, nL, μL, mL, or L1 x 10. 1 Particles per pL, nL, μL, mL, or L1 x 10⁻⁶ 20 One or more particles, such as approximately 1 x 10^10 particles per pL, nL, μL, mL, or L. 1 1X10 2 1X10 3 1X10 4 1X10 5 1X10 6 1X10 7 1X10 8 1X10 9 1X10 10 1X10 11 1X10 12 1X10 13 1X10 14 1X10 15 1X10 16 1X10 17 1X10 18 1X10 19Up to / or about 1 x 10 20 Each particle. In one embodiment, the effective titer may be approximately 1 x 10⁻⁶ per pL, nL, μL, mL, or L. 1 One conversion unit to per pL, nL, μL, mL or L1 x 10 20 One conversion unit or more, such as approximately 1 x 10^10 per pL, nL, μL, mL, or L. 1 1X10 2 1X10 3 1X10 4 1X10 5 1X10 6 1X10 7 1X10 8 1X10 9 1X10 10 1X10 11 1X10 12 1X10 13 1X10 14 1X10 15 1X10 16 1X10 17 1X10 18 1X10 19 Up to / or about 1 x 10 20 One conversion unit. In one embodiment, the MOI of the pharmaceutical formulation may be in the range of about 0.1 to 10 or more, such as 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4. 6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10 or more.

[0090] Viral vectors can be routinely formulated using one or more physiologically acceptable carriers or excipients. Viral vectors can be formulated for parenteral administration via injection (e.g., by rapid injection or continuous infusion). Injectable formulations may be present in unit dosage forms with added preservatives (e.g., in ampoules or multi-dose containers). Viral compositions may be in the form of suspensions, solutions, or emulsions in oily or aqueous media and may contain formulations such as suspending agents, stabilizers, or dispersants. Liquid formulations of viral vector preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives, or hydrogenated edible fats), emulsifiers (e.g., lecithin or gum arabic), non-aqueous media (e.g., almond oil, oily esters, ethanol, or fractionated vegetable oils), and preservatives (e.g., methyl or propylparaben or sorbic acid). Formulations may also contain buffers. Alternatively, the composition may be in powder form for preparation with a suitable media (e.g., sterile, pyrogen-free water) prior to use.

[0091] The rAAV particles or pharmaceutical formulations described herein may be administered once or more per hour, day, month, or year (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more per hour, day, month, or year). In one embodiment, the pharmaceutical formulations or dosage forms described herein may be administered continuously over a period ranging from minutes to hours to days. Devices and dosage forms known in the art and described herein are available for the efficient delivery of continuous administration of the pharmaceutical formulations described herein. In one embodiment, the first or several initial doses administered may be higher than subsequent doses. These are commonly referred to in the art as one or more loading doses and maintenance doses, respectively. In one embodiment, the administration of the pharmaceutical formulation may cause the dose to change gradually over time (increase or decrease) in order to gradually wean the subject off the pharmaceutical formulation or gradually introduce the subject into the pharmaceutical formulation.

[0092] Other embodiments are illustrated in the following examples. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Example Example 1 - AAV capsid reprogrammed to bind to human transferrin receptor-mediated whole-brain gene delivery Main text: A key challenge in developing more effective gene therapy delivery vectors is engineering vectors with known mechanisms of action (MOAs) in human patients. Conventional approaches for engineering vectors with enhanced tropism, such as adeno-associated virus (AAV), rely heavily on capsid library selection in animals. These selections have been used by numerous teams over the past two decades because they have been successful without prior knowledge of the MOA (1–7). However, most vectors selected in animals have not yet been translated into preclinical models. Despite extensive research, AAV capsids with significant translational potential and MOAs known to enter the CNS have not yet emerged. Here, the applicant addresses this challenge from a different angle, first selecting AAV capsids for specific MOAs that bind to the human transferrin receptor (TfR1), and demonstrating that these capsids cross the blood-brain barrier (BBB) ​​and mediate efficient gene delivery throughout the CNS.

[0093] The applicant chose TfR1 as a target because it is highly expressed on the human BBB; it mediates constitutive, ligand-independent receptor-mediated transcytosis (RMT) across the CNS vascular system (8-12); and it has been documented as a target for increasing the delivery of biologics to the CNS of mice (13-15), non-human primates (NHP) (16-18), and humans as an investigational therapy (19-22) and an approved antibody-based therapeutic for type II mucopolysaccharidosis (23). A heptameric-modified AAV9 capsid library was screened for its ability to bind to human TfR1 in vitro. Selected capsids exhibiting more efficient gene delivery to human brain endothelial cells and improved active transport across the human vascular monolayer were chosen. When a chimeric TfR1 carrying a humanized extracellular domain was introduced... c When the BI-hTFR1 gene was administered systemically to adult TFRC knock-in (KI) mice, it transduced most neurons and astrocytes in multiple brain regions. The enhanced tropism was entirely dependent on the interaction with humanized TfR1, as no enhancement was observed in wild-type (WT) mice. The tropism was also selectively enhanced in the CNS, consistent with the high level of TFRC expression in the CNS vascular system relative to other organs (12).

[0094] To explore its ability to deliver therapeutically relevant payloads, the applicant intravenously injected TFRCKI mice with an exemplary capsid, BI-hTFR1 or AAV9, containing the human glucocerebrosidase β1 (GBA1) gene. GBA1 inactivation mutations are a leading cause of Gaucher disease (a lysosomal storage disorder that often affects the CNS), and GBA1 mutations are a genetic risk factor for Parkinson's disease and dementia with Lewy bodies (24). Systemic delivery of BI-hTFR1 in adult TFRCKI mice resulted in robust expression of GBA1 throughout the brain and increased glucocerebrosidase (GC) activity in the brain and cerebrospinal fluid (CSF), which were not observed in the AAV9 case. By directly binding to TfR1 (a transporter of natural protein ligands and therapeutic biologics in humans), BI-hTFR1 represents a promising vector for developing human gene therapies targeting the CNS.

[0095] result Engineered to incorporate human TfR1 AAV capsid To target TfR1 with AAV capsids, the applicant screened an AAV9-based NNK capsid library of variants with randomly inserted 7-mers between VP1 residues 588-589 for selective binding to human TfR1 using a recently described receptor targeting method (25). Figure 1A Based on the results of in vitro screening, the applicant selected four capsids sharing a common sequence motif for validation: BI-hTFR1, BI-hTFR1-2, BI-hTFR1-3, and BI-hTFR1-4. The applicant individually packaged a single-stranded genome using each capsid, which expressed nuclear mScarlet and luciferase under the control of the ubiquitous CAG promoter (ssAAV-CAG-NLS-mScarlet-P2A-luciferase-WPRE-SV40pA). Association of the four capsids with CHO cells stably expressing human TfR1 and transduction of these cells were elevated, but not with control CHO cells or those expressing TfR1 from rhesus monkeys, marmosets, or mice. Figure 1B , Figure 1C (and Figure 7). The association of the capsid with endogenously TFRC-expressing human brain endothelial cells and the increase in transduction of said cells were tested. Although the degree of association between AAV and primary human brain microvascular endothelial cells (hBMVEC) and the human brain endothelial cell line (hCMEC / D3) differed ( Figure 1D However, compared to AAV9, each of the four TfR1-binding capsids showed significantly enhanced transduction to both types of brain endothelial cells. Figure 1ETo further evaluate the relative binding affinity of the capsid to purified human TfR1, the applicant performed a biolayer interference assay (BLI). Because the monovalent interaction algorithm resulted in poor data fitting, a multi-binding model was used to derive the kinetic constants. Factors that may have contributed to the multi-binding curves are listed in the Materials and Methods sections below. Based on its performance in cell association and transduction assays and its ability to bind to human TfR1 at lower concentrations, the applicant selected BI-hTFR1 as an example of rAAV for further investigation.

[0096] BI-hTFR1 combined with TfR1 top domain To assess whether binding to TfR1 is necessary for increased transduction of BI-hTFR1 in brain endothelial cells, the applicant evaluated hCMEC / D3 transduction in the presence of two anti-TfR1 antibodies: OKT9, a monoclonal antibody that binds to the apical domain of TfR1 (26); or AF2474, a polyclonal antibody that competes with transferrin (Tf) for TfR1 binding. Increased OKT9 concentration significantly inhibited transduction, while AF2474 did not ( Figure 2A This indicates that, in these cells, interaction with the apical domain of human TfR1 is required for enhanced BI-hTFR1-mediated transduction. Consistent with this result, OKT9 directly competes with BI-hTFR1 for binding to purified human TfR1. Figure 8B Significantly, binding to the TfR1 apical domain is a common feature of several antibody-based BBB shuttles that have been tested in humans and may place the binding site remotely from the Tf binding site. This is important because of the typical 10–20 μM blood concentrations (27) of iron-binding holo-Tf and its sub-nanomolar binding affinity to TfR. Figure 8C The surface TfR1 is thought to be predominantly occupied by Tf. Given that BI-hTFR1 has a double-digit nanomolar affinity for human TfR1, Tf is expected to outcompete BI-hTFR1 in competitive binding to TfR1 if their binding epitopes overlap. Using BLI, the applicant found that BI-hTFR1 binds to human TfR1 with similar kinetics, regardless of the presence or absence of receptor saturation concentrations of holo-Tf. Figure 2B and Figure 8D ), and BI-hTFR1 can bind to the preformed complex of human TfR1 and Tf ( Figure 2C Consistent with BLI results, OKT9 (but not Tf) inhibited the association of BI-hTFR1 with hCMEC / D3 cells and its co-localization with human TfR1. Figure 2D (and Figure 9).

[0097] The applicant established a BBBtranswell model using the hCMEC / D3 cell line to test AAV transport across the human endothelial cell barrier. They compared the amount of BI-hTFR1 transported across the endothelial barrier relative to AAV9 and AAV2. To minimize the influence of interwell variations, the applicant mixed BI-hTFR1, AAV9, and AAV2 carrying individually identifiable qPCR-coded genomes (Table S1), added this mixture to the culture medium in the upper chamber, maintained it at 37°C or 4°C, and measured transport to the lower chamber after three hours. Figure 3A At 4 °C, ATP-dependent endocytosis was inhibited, but passive transport, at least in part, occurred via paracellular transwelling, providing a measure of leakage, a known problem when using hCMEC / D3 transwell assays (28). As previously reported, AAV9 crossed the transwell barrier more efficiently than AAV2 at 37 °C, and at 4 °C, the number of vector genomes detected in the basal chamber for both AAVs was significantly reduced, consistent with ATP-dependent endocytosis (29-31). Significantly more BI-hTFR1 was actively transported into the basal chamber compared to either AAV9 or AAV2. Figure 3B Passive transport of BI-hTFR1 and AAV2 was reduced relative to AAV9, likely due to increased association with cells.

[0098] RMT involves endocytosis, vesicle transport, and exocytosis (32). By assessing colocalization with various organelle markers, we explored whether BI-hTFR1 endocytoses hCMEC / D3 cells via the TfR1 RMT pathway. BI-hTFR1 partially colocalized with markers of the early and late endosome pathways (Rab5 and Rab7) and the trans-Golgi network (TGN46), but did not extensively colocalize with markers of the cis-Golgi apparatus (Rcas1) or the endoplasmic reticulum (KDEL). Figure 3C and Figure 10In contrast, AAV2 did not colocalize highly with any endosomes or organelle markers except TGN46. Partial colocalization and transduction of both AAVs with TGN46 is consistent with the need for AAV transport to the trans-Golgi apparatus (33). Cell surface TfR1 aggregation promotes clathrin-coated pit formation (34) and uptake into Rab5-rich endosome subsets (35). This is consistent with observations that BI-hTFR1 colocalizes with Rab5 to a greater extent than AAV2. A smaller proportion of TfR1 colocalizes with Rab7 (36), which is distributed in endosomes associated with endocytosis (37) and lysosomal degradation pathways. This is again consistent with observations of partial overlap between the localization of BI-hTFR1 and Rab7 in cells. Colocalization assays indicate that BI-hTFR1 binds to TfR1 and is actively transported across the human BBB model via RMT. In contrast, AAV2 is primarily transported to the trans-Golgi apparatus (33).

[0099] CNS tropism of BI-hTFR1 Having determined that BI-hTFR1 transduces more efficiently into human brain endothelial cells and is more efficiently transported across the human BBB model via its interaction with TfR1, the applicant next sought to investigate whether BI-hTFR1 could cross the BBB in vivo by binding to human TfR1. To test this, the applicant used TFRC knock-in (KI)C57BL / 6J mice, in which exons 4-19 of the mouse Tfrc encoding the extracellular domain were replaced by the corresponding regions of human TFRC. Figure 4A (38). The levels of mouse-human heterozygous gene mRNA and protein products were similar to those in WT mice (Fig. 11) and suitable for assessing the tropism of AAV targeting human TfR1. BI-hTFR1 or AAV9:CAG-NLS-mScarlet - P2A-luciferase-WPRE-SV40pA at 5 x 10^5 per mouse 11 vg was injected intravenously into adult female C57BL / 6J or TFR CKI mice. Figure 4B Three weeks after injection, the applicant observed enhanced biodistribution of BI-hTFR1 in TFRCKI mice and enhanced brain and spinal cord transduction, but not in control C57BL / 6J mice. Figure 4C and Figure 4D(and Figure 12). No increased biodistribution and transduction were observed in any other organs evaluated, suggesting that interaction with human TfR1 selectively enhances CNS tropism. Comparing TFRCKI mice receiving BI-hTFR1 with C57BL / 6J mice receiving AAV9, the applicant detected 6-fold and 12-fold more viral genome in the brain and spinal cord, respectively; 54-fold and 43-fold higher viral mRNA transcription levels; and 132-fold and 58-fold greater luciferase activity, respectively. As expected, AAV9 transduction was not significantly affected by genotype in any of the organs evaluated.

[0100] To assess transduction efficiency for specific cell types within the CNS, the applicant evaluated the fraction of neurons expressing mScarlet or astrocytes that were positive for the marker. In TFRCKI mice, BI-hTFR1 transduced an average of 54%, 32%, and 68% of NeuN cells in the cortex, striatum, and thalamus, respectively. + Neuron ( Figure 5C and Figure 5D In contrast, in C57BL / 6J mice, BI-hTFR1 transduces less than 1% of NeuN in the cortex, striatum, and thalamus. + Cells. Regardless of mouse strain, AAV9 transduced 1-6% of NeuN in these same regions. + Cells. BI-hTFR1 transduced TFRCKI mice showed greater than 80% SOX9 in the cortex, striatum, and thalamus. + Astrocytes, compared to 10% or less of SOX9 in AAV9-transduced C57BL / 6J mice. + 20% or less of SOX9 in cells or C57BL / 6J mice + cell( Figure 5E and Figure 5F Consistent with biodistribution and transduction data, mScarlet levels in the livers of C57BL / 6J and TFRCKI mice were similar between AAV9 and BI-hTFR1. Figure 12A and Figure 12B The biodistribution of DRGs was significantly reduced in TFRCKI animals treated with BI-hTFR1 compared to the AAV9 control. Figure 4C ); Figure 12C The DRG cell transduction induced by AAV9 or BI-hTFR1 in C57BL / 6J or TFRCKI mice is shown.

[0101] The ability of BI-hTFR1 to deliver human glucoceramide β1 (GBA1) to TFRCKI mice was evaluated by mediating GBA expression throughout the brain. A single-stranded AAV genome containing a heterozygous cytomegalovirus enhancer-chicken β-actin (CMV-CBA) promoter was constructed, which drives the expression of human GBA1 with a C-terminal influenza virus hemagglutinin (HA) tag. Figure 6A (39). The genome was packaged into AAV9 or BI-hTFR1 and packaged at 1x10⁻¹. 14 The TFRCKI mice were administered intravenously at a dose of vg / kg, similar to the weight-adjusted dose of the FDA-approved AAV9-based Zolgensma gene therapy for spinal muscular atrophy. Additionally, the applicant administered BI-hTFR1:GBA1 at a dose 20 times lower (5 × 10⁻⁶ vg / kg). 12 Another group of TFRCKI mice was administered (vg / kg). For untreated control mice, the applicant used C57BL / 6J mice with the same genetic background as the TFRCKI mice. Three weeks after administration, the applicant detected approximately 30 times more AAV genome (vg / kg) in the brains of mice treated with BI-hTFR1 compared to mice receiving AAV9. Figure 6B Compared with mice injected with high doses of AAV9 or control C57BL / 6J mice, we observed whole-brain expression of GBA-HA as assessed by HA immunostaining. Figure 6C ) and significantly elevated glucocerebroside lipase (GC enzyme) activity in brain tissue lysates and CSF. Figure 6D as well as Figure 13A and Figure 13B Compared to mice injected with a high dose of BI-hTFR1, the applicant observed very little GBA expression in the brain of mice injected with a high dose of AAV9, but similar amounts of viral genome, GBA expression, and GC enzyme activity were observed in the liver. Figure 6B and Figure 6D as well as Figure 13C As expected, in mice injected with low doses of BI-hTFR1, the amount of viral genome in the liver was reduced compared to the high-dose AAV9 group. Decreased GC enzyme activity in the brain and CSF has been reported to be associated with the progression of Parkinson's disease (40, 41), and previous studies have shown that delivery of GBA1 to the brain can treat neuronal α-commonoproteinopathy (42-44). Notably, in mice receiving low doses of BI-hTFR1, the applicant observed neuronal transduction in areas associated with motor symptoms of Parkinson's disease, such as the pars compacta of the substantia nigra, deep cerebellar nuclei, and other parts of the brainstem. Figure 6C and Figure 13A(Data from 45). Under the same imaging conditions, GBA-HA was not detected in the brains of mice injected with a high dose of AAV9. This suggests that a 20-fold lower dose of BI-hTFR1 resulted in higher levels of GBA in disease-related brain regions compared to AAV9.

[0102] discuss In this study, the applicant utilized the apical domain of conjugated human TfR1 to enable the engineered AAV capsid BI-hTFR1 to cross the BBB. Protein shuttles designed to bind human TfR1 to facilitate RMT have been clinically validated and have demonstrated evidence of CNS entry (NCT04023994) and efficacy (46). The TfR1 apical domain is also a receptor target of the natural virus (47-51), suggesting that this iron transporter could be developed for viral entry. Importantly, the applicant demonstrated that BI-hTFR1 binds to human TfR1 and the pre-formed TfR1-Tf complex with similar kinetics and does not compete with holo-Tf for TfR1 binding. The ability to bind TfR1 in the presence of the natural ligand is crucial, as AAV cannot be administered at doses that would compete with Tf for TfR1 binding. The use of this validated transport mechanism reinforces the applicant's confidence that BI-hTFR1 performs well as a human gene therapy vector targeting the CNS.

[0103] BI-hTFR1 was engineered to bind to TfR1 by directly inserting a novel 7-meric TfR1 recognition sequence into ring VIII on the surface of the capsid. Since this method does not require the introduction or conjugation of a large protein domain as a means of retargeting AAV (52-58), the applicant anticipated no additional complexity in the fabrication of BI-hTFR1 compared to AAV9, one of the best-prepared natural AAVs. Indeed, the applicant consistently prepared and purified BI-hTFR1, with a final yield within twice that of AAV9 (Table S2).

[0104] Compared to natural AAV capsids (such as AAV9 and AAV2) used in approved gene therapies, BI-hTFR1 exhibited significant active transport across the human brain endothelial cell layer and across the BBB, transducing cells throughout the brain and spinal cord in TFRCKI mice after intravenous delivery. BI-hTFR1 displayed similar broad CNS tropism enhancement as observed with engineered transboundary capsids (e.g., AAV-PHP.B, BI28, AAVF, and 9P31) bound to mouse GPI-anchored proteins LY6A, LY6C1, or Car4 (25, 59, 60). These capsids were able to efficiently cross the BBB and enter parenchymal cells by conjugating highly abundant CNS endothelial cell surface proteins as novel receptors.

[0105] A key advantage of BI-hTFR1 and other capsids developed through target receptor binding screening is that their MOA is highly defined, thus their species tropism is predictable and informative for large animal experiments. This contrasts with capsids identified from conventional selection, whose MOA is unknown and therefore translates to unknown potential in other species, including humans. The AAV targeting human TfR1 reported in this study is not expected to exhibit enhanced CNS tropism in NHPs such as rhesus macaques and marmosets. Therefore, testing in these species would only be valuable for analyzing biodistribution, immune responses, and toxicity in the absence of the target (human TfR1). Knowing the precise target of the AAV capsid also helps predict its function in human patients. For example, there are no known missense variants with an allele frequency greater than 1 / 1000 within the TFRC apical domain (61). Therefore, the applicant predicts that BI-hTFR1 binding to human TfR1 will not be affected by common variants within the coding sequence of the human apical domain.

[0106] A second advantage of capsids targeting human receptors is that gene therapies utilizing these vectors can be tested in KI mouse models with human target receptors and one or more disease-related mutations. For example, disease models are typically created using mice and in the absence of cross-species capsids with enhanced CNS tropism. Studies would require alternative capsids that cross the mouse BBB to deliver and test their potential therapeutic payloads in these disease models. Using BI-hTFR1, gene therapy products destined for human patients can be tested in mouse disease models hybridized with TFRCKI mice without replacing the capsid with an alternative. Using treatment-related payloads, the applicant found that BI-hTFR1 delivered 30-fold more AAV:GBA1 genomes into the brains of TFRCKI mice compared to AAV9 and increased brain and CSF GC enzyme activity. GBA1 expression was detectable throughout the brains of BI-hTFR1:GBA1-treated mice even at a 20-fold lower dose. However, TFRCKI mice were WT in terms of Gba1, and only high doses of BI-BI-hTFR1:GBA1 resulted in increased brain and CSF GC enzyme activity, which was detectably higher than endogenous mouse GC enzyme activity.

[0107] In summary, the results demonstrate that BI-hTFR1 can utilize the RMT activity of human TfR1 to cross the BBB and deliver genes broadly and efficiently to neurons and glial cells throughout the CNS. These properties provide strong support for further exploration of BI-hTFR1 as a widely applicable mediator for human CNS gene therapy.

[0108] References and Notes 1.O.J. F.Kaul,M.D.Weitzman,R.Pasqualini,W.Arap,J.A.Kleinschmidt,M.Trepel,Random peptide libraries displayed on adeno-associated virus toselect for targeted gene therapy vectors.Nat.Biotechnol.21,1040-1046(2003). 2.J.T.Koerber,N.Maheshri,B.K.Kaspar,D.V.Schaffer,Construction ofdiverse adeno-associated viral libraries for directed evolution of enhancedgene delivery vehicles.Nat.Protoc.1,701-706(2006). 3.W.Li,A.Asokan,Z.Wu,T.Van Dyke,N.DiPrimio,J.S.Johnson,L.Govindaswamy,M.Agbandje-McKenna,S.Leichtle,D.Eugene Redmond Jr,T.J.McCown,K.B.Petermann,N.E.Sharpless,R.J.Samulski,Engineering and Selection ofShuffled AAV Genomes:A New Strategy for Producing Targeted BiologicalNanoparticles.Mol.Ther.16,1252-1260(2008). 4.Y.H.Chen,M.Chang,B.L.Davidson,Molecular signatures of disease brainendothelia provide new sites for CNS-directed enzyme therapy.Nat.Med.15,1215-1218(2009). 5.B.E.Deverman,P.L.Pravdo,B.P.Simpson,S.R.Kumar,K.Y.Chan,A.Banerjee,W.-L.Wu,B.Yang,N.Huber,S.P.Pasca,V.Gradinaru,Cre-dependent selection yieldsAAV variants for widespread gene transfer to the adultbrain.Nat.Biotechnol.34,204-209(2016). 6.M.Nonnenmacher,W.Wang,M.A.Child,X.-Q.Ren,C.Huang,A.Z.Ren,J.Tocci,Q.Chen,K.Bittner,K.Tyson,N.Pande,C.H.-Y.Chung,S.M.Paul,J.Hou,Rapid evolutionof blood-brain-barrier-penetrating AAV capsids by RNA-driven biopanning MolTher Methods Clin Dev.20,366-378(2021). 7.K.S.Hanlon,J.C.Meltzer,T.Buzhdygan,M.J.Cheng,M.Sena-Esteves,R.E.Bennett,T.P.Sullivan,R.Razmpour,Y.Gong,C.Ng,J.Nammour,D.Maiz,S.Dujardin,S.H.Ramirez,E.Hudry,C.A.Maguire,Selection of an Efficient AAV Vector forRobust CNS Transgene Expression.Mol Ther Methods Clin Dev.15,320-332(2019). 8.R.S.Ajioka,J.Kaplan,Intracellular pools of transferrin receptorsresult from constitutive internalization of unoccupied receptors.Proc.Natl.Acad.Sci.U.S.A.83,6445-6449(1986). 9.F.R.Maxfield,T.E.McGraw,Endocytic recycling.Nat.Rev.Mol.CellBiol.5,121-132(2004). 10.T.Moos,E.H.Morgan,Transferrin and transferrin receptor function inbrain barrier systems.Cell.Mol.Neurobiol.20,77-95(2000). 11.W.M.Pardridge,J.Eisenberg,J.Yang,Human blood-brain barriertransferrin receptor.Metabolism.36,892-895(1987). 12.W.A.Jefferies,M.R.Brandon,S.V.Hunt,A.F.Williams,K.C.Gatter,D.Y.Mason,Transferrin receptor on endothelium of braincapillaries.Nature.312,162-163(1984). 13.S.Kida,Y.Koshimura,E.Yoden,A.Yoshioka,H.Morimoto,A.Imakiire,N.Tanaka,S.Tanaka,A.Mori,J.Iro,A.Inoue,R.Yamamoto,K.Minami,T.Hirato,K.Takahnshi,H.Sonoda,Enzyme replacement with transferrin receptor-targetedα-L-iduronidase rescues brain pathology in mucopolysaccharidosis 1 mice.MolTher Methods Clin Dev.29,439-449(2023). 14.J.C.Ullman,A.Arguello,J.A.Getz,A.Bhalla,C.S.Mahon,J.Wang,T.Giese,C.Bedard,D.J.Kim,J.R.Blumenfeld,N.Liang,K.Ravi,A.A.Nugent,S.S.Davis,C.Ha,J.Duque,H.L.Tran,R.C.Wells,S.Lianoglon,V.M.Daryani,W.Kwan,H.Solanoy,H.Nguyen,T.Earr,J.C.Dugas,M.D.Tuck,J.L.Harvey,M.L.Reyzer,R.M.Caprioli,S.Hall,S.Poda,P.E.Sanchez,M.S.Dennis,K.Gunasekaran,A.Srivastava,T.Sandman,K.R.Henne,R.G.Thorne,G.Di Paolo,G.Astarita,D.Diaz,A.P.Silverman,R.J.Watts,Z.K.Sweeney,M.S.Kariolis,A.G.Henry,Brain delivery and activity of a lysosomal enzymeusing a blood-brain barrier transport vehicle in mice.Sci.Transl.Med.12(2020),doi:10.1126 / scitranslmed.aay 1163. 15.S.M.Hammond,F.Abendroth,L.Goli,J.Stoodley,M.Burrell,G.Thom,I.Gurrell,N.Ahlskog,M.J.Gait,M.J.Wood,C.I.Webster,Antibody-oligonucleotideconjugate achieves CNS delivery in animal models for spinal muscularatrophy.JCI Insight.7(2022),doi:10.1172 / jci.insight.154142. 16.M.S.Kariolis,R.C.Wells,J.A.Getz,W.Kwan,C.S.Mahon,R.Tong,D.J.Kim,A.Srivastava,C.Bedard,K.R.Henne,T.Giese,V.A.Assimon,X.Chen,Y.Zhang,H.Solanoy,K.Jenkins,P.E.Sanchez,L.Kane,T.Miyamoto,K.S.Chew,M.E.Pizzo,N.Liang,M.E.K.Calvert,S.L.DeVos,S.Baskaran,S.Hall,Z.K.Sweeney,R.G.Thorne,R.J.Watts,M.S.Dennis,A.P.Silverman,Y.J.Y.Zuchero,Brain delivery of therapeutic proteinsusing an Fc fragment blood-brain barrier transport vehicle in mice andmonkeys.Sci.Transl.Med.12(2020),doi:10.1126 / scitranslmed.aay 1359. 17.L.Rué,T.Jaspers,I.M.S.Degors,S.Noppen,D.Schols,B.De Strooper,M.Dewilde,Novel Human / Non-Human Primate Cross-Reactive Anti-TransferrinReceptor Nanobodies for Brain Delivery of Biologics.Pharmaceutics.15(2023),doi:10.3390 / pharmaceutics15061748. 18.YJYu,JKAtwal,Y.Zhang,RKTong,KRWildsmith,C.Tan,N.Bien-Ly,M.Hersom,JAMaloney,WJMeilandt,D.Bumbaca ,K.Gadkar,K.Hoyte,W.Luk,Y.Lu,JAErnst,K.Seearce-Levie,JACouch,MSDennis,RJWatts,Therapeuticbispecific antibodies cross the blood-brain barrier in nonhumanprimates.Sci.Transl.Med.6,261ra154(2014). 19.B.van Lengerich,L.Zhan,D.Xia,D.Chan,D.Joy,JIPark,D.Tatarakis,M.Calvert,S.Hummel,S. Lianoglou,MEPizzo,R.Prorok,E.Thomsen,LMBartos,P.Beumers,A.Capell,SSDavis,L.de Weerd,JCDugas,J.Duque,T.Earr,K.Gadkar,T.Giese,A.Gill,J. C.Ha,M.Kannuswamy,DJKim,STKunte,LHKunze,D.Lac,K.Lechtenberg,AW-S.Leung,C.-C.Liang,I.Lopez,P.McQuade,A.Modi,VOTorres,HNNguyen,I. N.Propson,M.Reich,Y.Robles-Colmenares,K.Schlepckow,L.Slemann,H.Solanoy,J.H.Suh,R.G.Thorne,C.Vieira,K.Wind-Mark,K.Xiong,Y.J.Y.Zuchero,D.Diaz,M.S.Dennis,F.Huang,K.Scearce-Levie,R.J.Watts,C.Haass,J.W.Lewcock,G.Di Paolo,M.Brendel,P.E.Sanchez,K.M.Monroe,A TREM2-activatingantibody with a blood-brain barrier transport vehicle enhances microglialmetabolism in Alzheimer’s disease models.Nat.Neurosci.26,416-429(2023). 20.P.V.Candelaria,L.S.Leoh,M.L.Penichet,T.R.Daniels-Wells,AntibodiesTargeting the Transferrin Receptor 1(TfR1)as Direct Anti-cancerAgents.Front.Immunol.12,607692(2021). 21.S.J.Barker,M.B.Thayer,C.Kim,D.Tatarakis,M.Simon,R.L.Dial,L.Nilewski,R.C.Wells,Y.Zhou,M.Afetian,A.Chappell,K.S.Chew,J.Chow,A.Clemens,C.B.Discenza,J.Dugas,C.Dwyer,T.Earr,C.Ha,D.Huynh,S.Jayaraman,W.Kwan,C.Mahon,M.Pizzo,E.Roche,L.Sanders,A.Stergioulis,R.Tong,H.Tren,J.Zuchero,A.A.Estrada,K.Gadkar,C.M.M.Koth,P.E.Sanchez,R.G.Thorne,R.J.Watts,T.Sandmann,L.Kane,F.Rigo,M.S.Dennis,J.W.Lewcock,S.L.DeVos,Targeting Transferrin Receptor toTransport Antisense Oligonucleotides Across the Blood-Brain Barrier.bioRxiv(2023),p.2023.04.25.538145. 22.R.Giugliani,A.M.Martins,S.So,T.Yamamoto,M.Yamaoka,T.Ikeda,K.Tanizawa,H.Sonoda,M.Schmidt,Y.Sato,Iduronate-2-sulfatase fused with anti-hTfR antibody,pabinafusp alfa,for MPS-II:A phase 2 trial inBrazil.Mol.Ther.29,2378-2386(2021). 23. T. Okuyama, Y. Eto, N. Sakai, K. Nakamura, T. Yamamoto, M. Yamaoka, T. Ikeda, S. So, K. Tanizawa, H. Sonoda, Y. Sato, A Phase 2 / 3 Trial of Pabinafusp Alpha, IDSFused with Anti-Human Transferrin Receptor Antibody,TargetingNeurodegeneration in MPS-II.Mol.Ther.29,671-679(2021). doi:10.3390 / cells11081261 24.L.Smith,AHVSchapira,GBA Variants of Parkinson's Disease:Mechanisms and Treatments.Cells.11(2022). 25.Q.Huang,ATChen,KYChan,H.Sorensen,AJBarry,B.Azari,Q.Zheng,T.Beddow,B.Zhao,IGTobey,C. Moncada-Reid,F.-E.Eid,CJWalkey,MCLjungberg,WRLagor,JDHeaney,YAChan,BEDeverman,Targeting AAV vectors to thecentral nervous system by engineering capsid-receptor interactions thatenable crossing of the blood-brain barrier.PLoS Biol.21,e3002112(2023). 26.S.Ferrero,M.D.Flores,C.Short,C.A.Vazquez,L.E.Clark,J.Ziegenbein,S.Zink,D.Fuentes,C.Payes,M.V.Batto,M.Collazo,C.C.García,J.Abraham,S.M.Cordo,J.A.Rodriguez,G.Helguera,Antibody-Based Inhibition of Pathogenic New WorldHemorrhagic Fever Mammarenaviruses by Steric Occlusion of the HumanTransferrin Receptor 1 Apical Domain.,J.Virol.95,e0186820(2021). 27.J.Williams,K.Moreton,The distribution of iron between the metal-binding sites of transferrin human serum.Biochem.J.185,483-488(1980). 28.V.Balzer,P.Poc,E.Puris,S.Martin,M.Aliasgari,S.Auriola,G.Fricker,Re-evaluation of the hCMEC / D3 based in vitro BBB model for ABC transporter studies.Eur.J.Pharm.Biopharm.173,12-21(2022). 29.G.Di Pasquale,J.A.Chiorini,AAV transcytosis through barrierepithelia and endothelium.Mol.Ther.13,506-516(2006). 30.S.F.Merkel,A.M.Andrews,E.M.Lutton,D.Mu,E.Hudry,B.T.Hyman,C.A.Maguire,S.H.Ramirez,Trafficking of adeno-associated virus vectors acrossa model of the blood-brain barrier,a comparative study of transcytosis andtransduction using primary human brain endothelial cells.J.Neurochem.140,216-230(2017). 31.R.Song,K.Pekrun,T.A.Khan,F.Zhang,S.P. M.A.Kay,Selection of rAAVvectors that cross the human blood-brain barrier and target the centralnervous system using a transwell model.Mol Ther Methods Clin Dev.27,73-88(2022). 32.R. J.Lampe,M.Schwaninger,L.Collin,Intracellular transportand regulation of transcytosis across the blood-brain barrier.Cell.Mol.LifeSci.76,1081-1092(2019). 33.M.E.Nonnenmacher,J.-C.Cintrat,D.Gillet,T.Weber,Syntaxin 5-dependent retrograde transport to the trans-Golgi network is required foradeno-associated virus transduction.J.Virol.89,1673-1687(2015). 34.A.P.Liu,F.Aguet,G.Danuser,S.L.Schmid,Local clustering oftransferrin receptors promotes clathrin-coated pit initiation.J.CellBiol.191,1381-1393(2010). 35.D.M.Navaroli,K.D.Bellvé,C.Standley,L.M.Lifshitz,J.Cardia,D.Lambright,D.Leonard,K.E.Fogarty,S.Corvera、Rabenosyn-5 defines the fate ofthe transferrin receptor following clathrin-mediated endocytosis.Proc.Natl.Acad.Sci.U.S.A.109,E471-80(2012). 36.A.S.H-aqqani,C.E.Delaney,E.Brunette,E.Baumann,G.K.Farrington,W.Sisk,J.Eldredge,W.Ding,T.-L.Tremblay,D.B.Stanimirovic,Endosomal traffickingregulates receptor-mediated transcytosis of antibodies across the blood brainbarrier.J.Cereb.Blood Flow Metab.38,727-740(2018). 37.P.Alam,M.R.Holst,L.Lauritsen,J.Nielsen,S.S.E.Nielsen,P.H.Jensen,J.R.Brewer,D.E.Otzen,M.S.Nielsen,Polarized α-synuclein trafficking andtranscytosis across brain endothelial cells via Rab7-decoratedcarriers.Fluids Barriers CNS.19,37(2022). 38.C.Liu,C.Shang,L.Ma,X.Zhou,C.Guo,Abstract 377:Evaluating deliveryof TFR1-targeting therapies to the CNS in a novel humanized TFR1 mousemodel.Cancer Res.82,377-377(2022). 39.J.R.Mendell,S.Al-Zaidy,R.Shell,W.D.Arnold,L.R.Rodino-Klapac,T.W.Prior,L.Lowes,L.Alfano,K.Berry,K.Church,J.T.Kissel,S.Nagendran,J.L’Italien,D.M.Sproule,C.Wells,J.A.Cardenas,M.D.Heitzer,A.Kaspar,S.Corcoran,L.Braun,S.Likhite,C.Miranda,K.Meyer,K.D.Foust,A.H.M.Burghes,B.K.Kaspar,Single-Dose Gene-Replacement Therapy for Spinal MuscularAtrophy.N.Engl.J.Med.377,1713-1722(2017). 40.C.E.G.Leyns,A.Prigent,B.Beezhold,L.Yao,N.G.Hatcher,P.Tao,J.Kang,E.Suh,V.M.Van Deerlin,J.Q.Trojanowski,V.M.Y.Lee,M.E.Kennedy,M.J.Fell,M.X.Henderson,Glucocerebrosidase activity and lipid levels are related toprotein pathologies in Parkinson’s disease.NPJ Parkinsons Dis.9,74(2023). 41.L.Oftedal,J. I.Dalen,O.-B.Tysnes,K.F.Pedersen,G.Alves,J.Lange,Association of CSF Glucocerebrosidase Activity With the Risk ofIncident Dementia in Patients With Parkinson Disease.Neurology.100,e388-e395(2023). 42.G.Morabito,S.G.Giannelli,G.Ordazzo,S.Bido,V.Castoldi,M.Indrigo,T.Cabassi,S.Cattaneo,M.Luoni,C.Cancellieri,A.Sessa,M.Bacigaluppi,S.Taverna,L.Leocani,J.L.Lanciego,V.Broccoli,AAV-PHP.B-Mediated Global-Scale Expressionin the Mouse Nervous System Enables GBA1 Gene Therapy for Wide Protectionfrom Synucleinopathy.Mol.Ther.25,2727-2742(2017). 43.K.L.Jackson,C.Viel,J.Clarke,J.Bu,M.Chan,B.Wang,L.S.Shihabuddin,S.P.Sardi,Viral delivery of a microRNA to Gba to the mouse central nervoussystem models neuronopathic Gaucher disease.Neurobiol.Dis.130,104513(2019). 44.E.M.Rocha,G.A.Smith,E.Park,H.Cao,E.Brown,M.A.Hayes,J.Beagan,J.R.McLean,S.C.Izen,E.Perez-Torres.P.J.Hallett,O.Isacson,Glucocerebrosidasegene therapy prevents α-synucleinopathy of midbrain dopamineneurons.Neurobiol.Dis.82,495-503(2015). 45K.Seidel,J.Mahlke,S.Siswanto,R.Krüger,H.Heinsen,G.Auburger,M.Bouzrou,L.T.Grinberg,H.Wicht,H.-W.Korf,W.den Dunnen,U.Rüb,The brainstempathologies of Parkinson’s disease and dementia with Lewy bodies.BrainPathol.25,121-135(2015). 46.Agents shuttle across blood-brain barrier to treat Huntersyndrome.Nat.Biotechmol.39,253(2021). 47.S.R.Radoshitzky,J.Abraham,C.F.Spiropoulou,J.H.Kuhn,D.Nguyen,W.Li,J.Nagel,P.J.Schmidt,J.H.Nunberg,N.C.Andrews,M.Farzan,H.Choe,Transferrinreceptor 1 is a cellular receptor for New World haemorrhagic feverarenaviruses.Nature.446,92-96(2007). 48.E.Wang,N.Obeng-Adjei,Q.Ying,L.Meertens,T.Dragic,R.A.Davey,S.R.Ross,Mouse mammary tumor virus uses mouse but not human transferrinreceptor 1 to reach a low pH compartment and infect cells.Virology.381,230-240(2008). 49.M.L.Flanagan,J.Oldenburg,T.Reignier,N.Holt,G.A.Hamilton,V.K.Martin,P.M.Cannon,New world clade B arenaviruses can use transferrinreceptor 1(TfR1)-dependent and -independent entry pathways,and glycoproteinsfrom human pathogenic strains are associated with the use of TfR1.J.Virol.82,938-948(2008). 50.L.B.Goodman,S.M.Lyi,N.C.Johnson,J.O.Cifuente,S.L.Hafenstein,C.R.Parrish,Binding site on the transferrin receptor for the parvoviruscapsid and effects of altered affinity on cell uptake andinfection.J.Virol.84,4969-4978(2010). 51.J.S.Parker,W.J.Murphy,D.Wang,S.J.O’Brien,C.R.Parrish,Canine andfeline parvoviruses can use human or feline transferrin receptors to bind,enter,and infect cells.J.Virol.75,3896-3902(2001). 52.S.Ponnazhagan,G.Mahendra,S.Kumar,J.A.Thompson,M.Castillas Jr,Conjugate-based targeting of recombinant adeno-associated virus type 2vectors by using avidin-linked ligands.J.Virol.76,12900-12907(2002). 53.J.Reul,A.Muik,C.J.Buchholz,Ligand Coupling to the AAV Capsid forCell-Specific Gene Transfer.Methods Mol.Biol.1950,35-50(2019). 54.R.C.Münch,H.Janicki,I. A.Rasbach,M.Hallek,H.Büning,C.J.Buchholz,Displaying high-affinity ligands on adeno-associated viralvectors enables tumor cell-specific and safe gene transfer.Mol.Ther.21,109-118(2013). 55.R.C.Münch,A.Muth,A.Muik,T.Friedel,J.Schmatz,B.Dreier,A.Trkola,A.Plückthun,H.Büning,C.J.Buchholz,Off-target-free gene delivery by affinity-purified receptor-targeted viral vectors.Nat.Commun.6,6246(2015). 56.A.Muik,J.Reul,T.Friedel,A.Muth,K.P.Hartmann,I.C.Schneider,R.C.Münch,C.J.Buchholz,Covalent coupling of high-affinity ligands to the surface ofviral vector particles by protein trans-splicing mediates cell type-specificgene transfer Biomaterials 144,84-94(2017). 57.A.M.Eichhoff,K. B.Albrecht,W.Schafer,N.Baum,F.Haag,J.Korbelin,M.Trepel,I.Braren,D.Grimm,S.Adriouch,F.Koch-Nolte,Nanobody-Enhanced Targetingof AAV Gene Therapy Vectors.Mol Ther Methods Clin Dev.15,211-220(2019). 58.M.V.Hamann,N.Beschorner,X.-K.Vu,I.Hauber,U.C.Lange,B.Traenkle,P.D.Kaiser,D.Foth,C.Schneider,H.Büning,U.Rothbauer,J.Hauber,Improvedtargeting of human CD4+ T cells by nanobody-modified AAV2 gene therapyvectors.PLoS One.16,e0261269 (2021). 59.Q.Huang,K.Y.Chan,I.G.Tobey,Y.A.Chan,T.Poterba,C.L.Boutros,A.B.Balazs,R.Daneman,J.M.Bloom,C.Seed,B.E.Deverman,Delivering genes acrossthe blood-brain barrier:LY6A,a novel cellular receptor for AAV-PHP.Bcapsids.PLoS One.14,e0225206(2019). 60.T.F.Shay,E.E.Sullivan,X.Ding,X.Chen,S.Ravindra Kumar,D.Goertsen,D.Brown,A.Crosby,J.Vielmetter,M.Borsos,D.A.Wolfe,A.W.Lam,V.Gradinaru,Primate-conserved carbonic anhydrase IV and murine-restricted LY6C1 enable blood-brain barrier crossing by engineered viral vectors.Sci Adv.9,eadg6618(2023). 61.S.Iqbal,E.Pérez-Palma,J.B.Jespersen,P.May,D.Hoksza,H.O.Heyne,S.S.Ahmed,Z.T.Rifat,M.S.Rahman,K.Lage,A.Palotie,J.R.Cottrell,F.F.Wagner,M.J.Daly,A.J.Campbell,D.Lal,Comprehensive characterization of amino acidpositions in protein structures reveals molecular effect of missense variants.Proc.Natl.Acad.Sci.U.S.A.117,28201-28211(2020). 62.W.J.Errington B.Bruncsics,C.A.Sarkar,Mechanisms of noncanonicalbinding dynamics in multivalent protein-protein interactions.Proc.Natl.Acad.Sci.U.S.A.116,25659-25667(2019). 63.A.J.Schoeffler,E.Helgason,N.Popovych,E.C.Dueber,Diagnosing andmitigating method-based avidity artifacts that confound polyubiquitin-bindingassays.Biophys Rep(N Y).1,100033(2021). 64.F.-E.Eid,A.T.Chen,K.Y.Chan,Q.Huang,Q.Zheng,I.G.Tobey,S.Pacouret,P.P.Brauer,C.Keyes,M.Powell,J.Johnston,B.Zhao,K.Lage,A.F.Tarantal,Y.A.Chan,B.E.Deverman,Systematic multi-trait AAV capsid engineering for efficient genedelivery.bioRxiv(2022),p.2022.12.22.521680. 65.R.C.Challis,S.Ravindra Kumar,K.Y.Chan,C.Challis,K.Beadle,M.J.Jang,H.M.Kim,P.S.Rajendran,J.D.Tompkins,K.Shivkumar,B.E.Deverman,V.Gradinaru,Systemic AAV vectors for widespread and targeted gene delivery inrodents.Nat.Protoc.14,379-414(2019). 66. S. Berg, D. Kutra, T. Kroeger, C. N. Straehle, B. X. Kausler, C. Haubold, M. Schiegg, J. Ales, T. Beier, M. Rudy, K. Eren, J. I. Cervantes, B. Xu, F. Beuttenmueller, A. Wolny, C. Zhang, U. Koethe, F. A. Hamprecht, A. Kreshuk, ilastik: interactive machine learning for (bio)image analysis. Nat. Methods. 16, 1226-1232 (2019). 67. D. R. Stirling, M. J. Swain-Bowden, A. M. Lucas, A. E. Carpenter, B. A. Cimini, A. Goodman, CellProfiler 4: improvements in speed, utility and usability. BMC Bioinformatics. 22, 433 (2021). 68. N. K.-H. Lim, V. Moestrup, X. Zhang, W.-A. Wang, A. F.-D. Huang, An Improved Method for Collection of Cerebrospinal Fluid from Anesthetized Mice. J. Vis. Exp. (2018), doi: 10.3791 / 56774. Supplementary material of Example 1 Materials and methods Animal All procedures were performed with approval from the Broad Institute IACUC. C57BL / 6J (000664) was obtained from The Jackson Laboratory (JAX). TFR CKI mice (C57BL / 6-Tfr1tm1TFR1 / Bcgen, B-hTFR1, 110861) were obtained from Biocytogen. The recombinant AAV vector was administered via the retroorbital sinus vein to young adult male or female mice. Mice were randomly assigned to groups according to predetermined sample size. Genotyping of the transgenic animals was performed using the primers listed in Table S1 using the DNeasy Blood & Tissue Kit (Qiagen, 69504). In Figures 4, 5, 11, and 12, two mice were excluded from the analysis: the first was a mouse in the TFR CKI group assigned to AAV9 but identified as WT by genotyping and immunoblotting analysis. In the BI-hTFR1-treated C57BL / 6J group, one mouse showed no evidence of transduction in biodistribution, transduction, or luciferase assays, and no fluorescent reporter signal was observed in the liver or brain. The experimenters did not blind the sample groups.

[0109] Mice were euthanized with Euthasol and carefully perfused with PBS at room temperature, followed by ice-cold PBS containing 4% paraformaldehyde (PFA). Tissues were fixed overnight in PBS containing 4% PFA and sectioned using a vibratome. Immunohistochemical analysis (IHC) was performed on the floating sections using antibodies diluted in PBS containing 5% donkey serum, 0.1% Triton X-100, and 0.05% sodium azide. Primary antibodies NeuN 1:500 (Invitrogen, MA5-33103) and SOX91:250 (abcam, ab185966) were incubated overnight at room temperature. Sections were then washed and stained with secondary Alexa conjugated antibodies Alexa Fluor 647 (Invitrogen, A-31573) and Alexa Fluor 555 (Invitrogen, A-21427) at a dilution of 1:1000 for four hours or overnight.

[0110] plasmid AAV9 and BI-hTFR1 Rep-Cap plasmids were generated via gene synthesis (GenScript). The CAG-WPRE-hGH pA backbone was obtained from Viviana Gradinaru's laboratory via Addgene (#99122). GFP, GFP-2A-luciferase, and mScarlet cDNA were synthesized in gBlock form (IDT) or synthesized and cloned (GenScript).

[0111] Full-length TFR C cDNA expression and lentiviral plasmids were cloned by inserting the open reading frame of TFR C (human: NM_003234.4, mouse: NM_011638.4, marmoset: NM_001301847.1, rhesus macaque: NM_001257303.1) into the lentiviral backbone pLenti-EF-FH-TAZ-ires-blast (Addgene #52083) with EcoRI / SalI sites.

[0112] For the C-terminal Fc fusion protein, the coding sequence of the extracellular region of human TfR1 (residues 89-760) was amplified by PCR and inserted into pCMV6-XL4 FLAG-NGRN-Fc (Addgene#115773) with EcoRV and XbaI sites. The signal peptide H7 (ATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTTAGAGGTGTCCAGTGT (SEQ ID NO: 43843) was introduced into the N-terminus of the TFR C sequence to guide protein secretion.

[0113] For the N-terminal Fc fusion protein, the coding sequence of the extracellular region of human TfR1 (residues 89-760) was amplified by PCR. The N-terminal Fc region, containing the N-terminal H7 signal peptide and the C-terminal GS adapter, was purchased from IDT. The desired region of plasmid pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) was amplified by PCR. These three DNA fragments were then used... HiFi DNA component (NEBE2621) assembly.

[0114] Cell lines and primary cultures HEK293T / 17 (CRL-11268), Pr05 (CRL-1781), and CHO-K1 (CCL-61) were all obtained from ATCC. hBMVEC cells (H-6023) were obtained from Cell Biologics and cultured according to the manufacturer's instructions. hCMEC / D3 cells were obtained from Millipore-Sigma (SCC066).

[0115] Reconstruction of full-length TfR 1 Full-length human TfR1 was reconstituted into peptide discs (PEPTIDISC LAB, dissolved at 2 mg / mL in 20 mM TrisHCl, pH 8). Briefly, HEK293 cells expressing C-terminal-labeled full-length human TfR1 were harvested by centrifugation at 300 × g. Cells were lysed by sonication, and fractionated by centrifugation at 15,000 × g to remove nuclei and cell debris, and by centrifugation at 100,000 × g to precipitate the cell membrane. The membrane was resuspended in buffer A (TrisHCl (pH 7.5), 50 mM NaCl, 10% glycerol) to a concentration of 10 mg / mL, and then dissolved by adding 0.8% n-dodecyl-β-D-maltose glycoside (DDM, Goldbio, DDM5) at 4°C with gentle stirring. Anti-FLAG M2 magnetic beads (Sigma-Aldrich) were incubated with the dissolved membrane, and the membrane was washed with buffer A containing 0.02% DDM. The beads were incubated for five minutes at room temperature in a solution of 1 mg / mL peptide disks, and then thoroughly washed in buffer A without detergent. Peptide disk-TfR1 was eluted with TrisHCl (pH 7.5), 150 mM NaCl, and 0.1 mg / mL 3XFLAG peptide, and analyzed by SDS-PAGE.

[0116] Biological layer interferometry All BLI studies were performed using a GatorPrime instrument for binding kinetic characterization, and all analyses were performed using Gator Bio software v 2.10.4.0713. Experiments were conducted in black 384-well plates (Greiner Bio-One, 781906). All reagents and buffers were prepared using Gator Bio's Q buffer and probes.

[0117] For binding of the AAV capsid to full-length human TfR1, the AAVx probe (Gator Bio) was equilibrated in Q buffer and then loaded with BI-hTFR1, BI-hTFR1-2, BI-hTFR1-3, BI-hTFR1-4, or AAV9 by uniform thresholding to an 8 nm offset. Seven sequential dilutions of full-length human TfR1-FLAG were associated with each capsid for 120 seconds, followed by dissociation in Q buffer for 120 seconds. Only the five highest concentrations are shown on the sensor plot. Three assays were performed. Each assay included incubation of the probe with Q buffer instead of human TfR1 for background subtraction.

[0118] For the binding of BI-hTFR1 and AAV9 to Tf pre-incubated with full-length human TfR1, the determination and analysis were performed as above, but using 300 nM holo-Tf (Millipore Sigma T413) pre-incubated with each dilution of TfR1 for 15 minutes.

[0119] For the kinetic analysis of capsid binding to TfR1, sensor plot data from each of the three trials using seven different analyte concentrations for each capsid showed clear multiple binding and dissociation characteristics that could not be explained by monovalent interactions. Therefore, the applicant used a global 2:1 exponential association and decay model. However, the applicant did not imply that the binding between the TfR1-targeting capsid and TfR1 was bivalent. The kinetic constants shown in Figure 8 should be interpreted with caution, as they are attributable to the following factors: First, the high density of binding epitopes on the AAV surface may lead to an increased local effective concentration of the receptor analyte, resulting in a higher apparent affinity (62). Second, TfR1 itself is bivalent, which may contribute to the aforementioned affinity artifact and also cause bridging of tightly loaded adjacent AAVs. Although the probe was loaded to less than 60% of its total binding capacity, the uniformity of loading could not be controlled, and part of the measurement may be due to the 2:1 binding of the receptor dimer to adjacent capsids (63). Third, transitional binding states attributable to conformational changes or sequential binding events may have contributed to the observation of multiple binding kinetics.

[0120] The rate constants calculated by the software for these repeated fittings are subjected to QC thresholding, the QC thresholding including R 2 >0.99, the error rate calculated by Gator is <25% of its corresponding kinetic constant, and the fitting residual is <10%. In both BI-hTFR1-3 and BI-hTFR1-4 cases, due to k 缔合 If the error rate is greater than 25%, a repeat is eliminated. The QC threshold is determined by averaging the experimental data and taking its standard error.

[0121] In the tandem competitive binding assay, the antibody OKT9 (ThermoFisher Scientific), targeting the apical domain of human TfR1, was selected as the competitor. The extracellular domain of human TfR1 (residues 89-760) was recombinantly expressed as an N-terminal Fc fusion protein (Fc-hTfR1) in Expi293 suspension cells, and Pierce... TMProtein A agarose (Thermo Fisher Scientific) was purified by gravity flow. HFCII probes loaded with Fc-hTfR1 were thresholded to a 1 nm offset. The Fc-TfR1-loaded probes were tandemly associated, first with BI-hTFR1 until a signal reached approximately 2 nm, and then subsequently with OKT9 antibody at 250, 100, 50, or 25 nM or in a separate Q buffer. The latter was included to demonstrate BI-hTFR1 dissociation in the absence of the competing OKT9 antibody. Simultaneously, the Fc-hTfR1-loaded probes were first associated in a separate Q buffer, followed by association with 250 nM OKT9 antibody, demonstrating maximum antibody binding in the absence of a capsid. The two association phases were 240 seconds and 360 seconds, respectively.

[0122] In the triple tandem binding assay involving holo-Tf, holo-Tf was used on ice with EZ-Link. TM Biotinylation was performed for two hours using the Thermo Fisher Scientific sulfonyl-NHS-LC-LC-biotin kit, followed by replacement with PBS using 0.5 mL Pierce Protein Concentrator PES column buffer at 10 K MWCO to remove unreacted biotin. The streptavidin (SA) probe was equilibrated in Q buffer and then loaded with biotinylated holo-Tf to a 2 nm offset or incubated in Q buffer as a ligand-free control. All three probes were then fed into the sequential binding steps, each lasting 240 seconds. Between each binding step, the probe was incubated in Q buffer for 240 or 120 seconds to demonstrate a baseline offset of <10% (i.e., binding loss) before binding the next molecule. In channel 1, the holo-Tf-loaded probe first associated with 150 nM full-length human TfR1, then with Q buffer only, and finally with BI-hTFR1. In channel 2, the holo-Tf-loaded probe associates with TfR1, then with 200 nM OKT9 antibody, and finally with the BI-hTFR1 capsid. In channel 3, the holo-Tf-loaded probe associates with Q buffer alone, then with OKT9 antibody, and finally with BI-hTFR1. In channel 4, the unloaded probe associates with TfR1, then with OKT9 antibody, and finally with BI-hTFR1 to reveal any non-specific binding to the probe.

[0123] For binding of full-length hTfR to human holo-Tf, the MFC probe was equilibrated in Q buffer and then loaded with anti-Tf monoclonal antibody 12A6 (Thermo Fisher Scientific) to a 1 nm offset. Next, holo-Tf was loaded as a ligand to saturation. A serially diluted solution of the full-length peptide disk-reconstructed hTfR1-FLAG was associated with holo-Tf for 120 seconds, followed by dissociation in Q buffer for 120 seconds. Three experiments were performed. In sensor plot fitting and kinetic analysis, each experiment included a probe incubated with a separate Q buffer for background subtraction. For subsequent kinetic analysis, sensor plot data from each of the three experiments were fitted using a global 1:1 exponential association and decay model. The software-calculated rate constants for these repeated fits were subjected to QC thresholding, which included R... 2 The value is greater than 0.99, the calculated error rate is less than 10% of the corresponding kinetic constant, and the fitting residual is less than 10%. The kinetic values ​​are averaged and their standard error is taken.

[0124] Lentiviral preparation Lentiviral viruses were generated in HEK293T / 17 cells by co-transfection with three packaging plasmids (pMDLg-RRE, pRSV-Rev, and pVSV-G) and a vector plasmid (pLenti-EF-FH-TAZ-IRES-blast, provided by Yutaka Hata, Addgene plasmid #52083) at a ratio of 4:1:1:6 using a third-generation lentiviral system. The vector plasmid encodes the full coding sequence of TFR C or Tfrc (human: NM_001128148; rhesus macaque: NM_001257303; marmoset: NM_001301847; or mouse: NM_011638.4). Three days post-transfection, the lentivirus was harvested from the culture medium and filtered through 0.45 μm PES to remove cell debris.

[0125] Exogenous TfR1 expression in CHO cell lines CHO cell lines expressing human TFR C or rhesus monkey, marmoset, or mouse Tfrc were identified via random lentiviral integration. Briefly, CHO cells were seeded at 150,000 cells / well in 12-well plates and transduced with lentiviral medium for 48 hours, then transferred to 10 cm plates for selection with 10 μg / mL blast fungicide for one week, followed by maintenance in medium containing 1 μg / mL blast fungicide. To validate the expression of the desired constructs, RNA was extracted from cells using the Qiagen RNeasy kit. cDNA synthesis was performed using Maxima HMinus reverse transcriptase (ThermoFisher, EP0753) and oligo dT. qPCR was performed using species-specific primers (Table S1). CHO cells expressing TfR1 for each species were also evaluated by immunostaining with two anti-TfR1 antibodies: ab84036 (Abcam) and OKT9 (eBioscience™) (Figure 7).

[0126] AAV preparation and titer determination AAV9 variant capsids carrying CAG-NLS-mScarlet-P2A-luciferase-WPRE-SV40pA or CMV / CBA-GBA1-HA-pA were either prepared in suspension followed by iodixanol purification and titer determination as previously described (64), or prepared using adherent cells as previously described (65). Preparation, purification methods, and post-purification yields are provided in Table S2. In BLI experiments, AAV vectors were prepared in adherent HEK293T cells and purified by static binding (3 to 10 plates per formulation). 72 hours post-transfection, cells and supernatant were collected in 125–500 mL shake flasks (60–200 mL for each formulation) and incubated at 37°C for 90 min with 0.1% Triton X-100, 2 mM MgCl2, and 25 U / mL benzonase (Sigma, E1014-25KU), followed by purification by centrifugation at 3724 × g for 10 min. The purified lysate was incubated with 150 μL of POROS AAV9 resin (Thermofisher, A27353) at 37°C with stirring (1.14 × g) for 90 min. The mixture was loaded into a detergent-removing centrifuge column (Thermofisher, 87778), and the supernatant was discarded using a vacuum manifold. The POROS AAV9 beads were washed three times with 5 mL PBS using a vacuum manifold. Elute the AAV vector in a 15 mL FAlcon tube with 2 mL of elution buffer (0.1 M glycine, pH 2.5) and neutralize with 500 μL of 1 M Tris, 0.5 M NaCl, pH 8. Dialyze the AAV using a float-a-lyzer G2 dialysis kit (Repligen, G235067) with a MWCO of 8–10 kDa and PBS (containing calcium and magnesium) supplemented with 0.001% Prönkel F68, or use a centrifuge filter (Thermofisher, 88532) with a MWCO of 100 kDa for buffer replacement and concentration in the same final preparation.

[0127] Combined measurement CHO cells stably expressing human TFR C or rhesus monkey, marmoset, or mouse Tfrc were seeded at 30,000 cells / well; hCMEC / D3 cells were seeded at 30,000 cells / well; and hBMVEC cells were seeded at 15,000 cells / well. Twenty-four hours after seeding, the medium for each well was replaced with fresh, cold medium containing 3,000, 6,000, or 12,000 vg of each AAV variant carrying CAG-NLS-mScarlet-P2A-luciferase-WPRE-SV40pA per cell for CHO, hCMEC / D3, or hBMVEC cells, respectively. The plates were then maintained at 4°C with gentle agitation for one hour, followed by five washes with phosphate-buffered saline (PBS). Cells were treated with proteinase K at 56°C for one hour, followed by heat inactivation at 95°C for 10 minutes. Total DNA was extracted using the DNeasy kit (Qiagen). The DNA was diluted 1:20 and qPCR was performed using mScarlet-qPCR-F and mScarlet-qPCR-R primers (Table S1).

[0128] Transduction measurement CHO cells stably expressing human TFRC or rhesus monkey, marmoset, or mouse Tfrc were seeded at 100,000 cells / well; hCMEC / D3 cells were seeded at 10,000 cells / well; and hBMVEC cells were seeded at 5,000 cells / well. Twenty-four hours after seeding, the medium in each well was replaced with fresh, cold medium containing 3,000, 6,000, or 12,000 vg of the AAV variant carrying CAG-NLS-mScarlet-P2A-luciferase-WPRE-SV40pA per cell for CHO, hCMEC / D3, or hBMVEC cells, respectively. The plates were incubated at 37°C with 5% CO2 for 24 hours. Transduction was measured using a Britelite Plus reporter gene assay system (PerkinElmer, 6066766). Report luciferase activity using relative light units (RLU) as raw data or normalize for AAV9 controls.

[0129] Antibody Inhibition Assay hCMEC / D3 cells were seeded at 7,500 cells / well. Two days later, cells containing 3 x 10⁻⁶ cells were cultured. 8 Transfer 100 μL of culture medium containing vg / mL AAV and the specified concentration of OKT9 or R&D AF2474 antibody to each well. Incubate the plate at 37°C with 5% CO2 for 24 hours. Measure transduction using the Britelite Plus reporter gene assay system.

[0130] Transwell assay hCMEC / D3 cells (up to nine passages) were maintained in VEGF-containing EGM2-MV medium (Lonza, CC4147). 24-well plates with 1.0 μm transparent PET membranes (Corning, 353104) were prepared by coating with collagen type I (Millipore, 08-115) diluted 1:50 in PBS and incubating at 37°C for two hours. Permeable support. On day 0, cells were introduced at a rate of 30,000 cells / cm². 2 The cells were coated onto the membrane and grown for two days in 200 μL of VEGF-containing EGM2-MV medium at the top and 600 μL of medium in the bottom chamber. On days 2 and 4, the medium at the top and bottom of the transwell was replaced with VEGF-free EGM2-MV medium, and the medium at the bottom of the transwell was replaced with astrocyte conditioned medium (Sciencell, 1811). Starting from day 4, TEER values ​​were measured using an EVOM2 meter (World Precision Instruments). The TEER value was calculated by subtracting the TEER reading of the cell-containing well from the TEER reading of the cell-free well and then multiplying by the surface area (in cm²). 2 The TEER value is calculated using units of (in units).

[0131] Transwell permeability using this method was previously validated by measuring the permeability of dextran FITC 4k (Sigma, 46944), 40k (Biotium, 76221-470), and 70k (Biotium, 76221-460). The TEER value peaked on day 6, reaching >10 Q / cm. 2 The value is the value when AAV is added to the transwell. BI-hTFR1, AAV2, and AAV9 with capsid-specific barcode transgenes were pooled and added to the top wells of the transwell at 25,000 vg per cell (each AAV). After incubation at 37°C or 4°C for three hours, 22 μL of culture medium was extracted from the bottom chamber. To determine the amount of AAV in the medium, the extract was treated with DNase I (NEB, MO303S) at room temperature for 15 min, then diluted in TE buffer (5 mM EDTA), and denatured at 70°C for 10 min to deactivate the DNase I. The DNA extract was then subjected to treatment with UltraPure... TMSalmon sperm DNA solution (ThermoFisher, 15632011) was diluted in 5% Tween 20. The amount of AAV passing through the transwell was measured by qPCR using a standard curve derived from known amounts of AAV-containing medium applied to the top well.

[0132] Immunofluorescence staining and colocalization in hCMEC / D3 cells To image the binding of BI-hTFR1 or AAV2 to hCMEC / D3 cells in the presence or absence of OKT9 or Tf-647, BI-hTFR1 and AAV2 were added to hCMEC / D3 cells in optical plates (PhenoPlate 96 wells, PerkinElmer, 6055302) at a concentration of 50,000 vg per cell. Meanwhile, Tf-647 (ThermoFisher, T23366) and purified TfR1 antibody (OKT-9, AAT Bioquest, 10713000) were added to the wells at a 1:200 dilution to achieve a final concentration of 1 μg / mL each. Cells were incubated at 4°C for one hour, washed three times with PBS, fixed with 4% paraformaldehyde, and blocked (avidin / biotin blocking kit, SP-2001, Vector Laboratories). Anti-AAV9 (1:200 dilution, ThermoFisher, 7103332100) was then applied to wells treated with BI-hTFR1 or those without virus, or anti-AAVX (1:200 dilution, ThermoFisher, 7103522100) was applied to wells treated with AAV2. After three PBS washes to remove unbound primary antibodies, streptavidin 555 (1:500 dilution, ThermoFisher, S21381) and Alexa were applied, respectively. 488 (1:500 dilution, Jackson Immuno Research, 115-545-003) to visualize AAV and TfR1.

[0133] To perform co-localization imaging of AAV and Tf-647, BI-hTFR1 or AAV2, along with Tf-647 (1 μg / mL), was added to hCMEC / D3 cells in an optical plate at a dose of 25,000 vg per cell. The cells were incubated at 4°C for one hour, followed by immunostaining as described above.

[0134] To co-localize and image AAV and TfR1, BI-hTFR1 or AAV2 was added to hCMEC / D3 cells in an optical plate at 25,000 vg per cell. Cells were incubated at 37°C for one hour to prepare for immunostaining as described above, but a permeabilization step was added before blocking endogenous biotin to visualize TfR1. Streptavidin 555 (1:500 dilution, Thermofisher, S21381) and goat anti-mouse 647nm (1:500 dilution, 115-605-062, Jackson Immuno Research) were applied.

[0135] For organelle colocalization, the following conjugated reagents were applied: Rab5 ((D-11)FITC, 1:100 dilution, Santa Cruz Biotechnology, sc-46692), Rab7 (1:400 dilution, abcam, ab198337), KDEL (1:500 dilution, abcam, ab184819), RCAS1 (1:200 dilution, Cell Signaling Technology, 12290), and TGN46 (1:50 dilution, abcam, ab50595). For non-conjugated antibodies (RCAS1 and TGN46), goat anti-rabbit 488 (Alexa) was applied. 488 AffiniPure goat anti-rabbit IgG (H+L), 1:500 dilution, Jackson Immuno, 111-545-144) to visualize the staining. For wells requiring double mouse antibody (wells co-stained with Rab5 and OKT9), use mouse-to-mouse blocking reagent (ReadyProbes) between antibody staining procedures. TM The mouse IgG blocking reagent (1:30 dilution, ThermoFisher, R37621) blocked cells for one hour.

[0136] Except for TGN46 staining, which was performed on a Zeiss LSM 900 confocal microscope with a 63x oil objective, all experimental images were obtained on a Nikon Ti-e inverted rotating disk confocal microscope with a 60x oil objective. Within each experiment, images were acquired using predetermined, optimized, and fixed exposure times for image comparison.

[0137] Images and tissue cell counts Images of native mScarlets in the whole brain, cortex, striatum, thalamus, spinal cord, liver, or dorsal root ganglion were acquired on a Keyence BZ-X810. For whole brain slices, single-plane tiled images were acquired using autofocus mode and stitched together using Keyence analysis software. To compare native mScarlet fluorescence across groups, imaging settings for BI-hTFR1 in TFR CKI mice were optimized and then applied to all samples and groups within each organ. The same settings were used across all samples within each brain region or tissue type, with color and gamma adjustments applied to images of the whole brain, cortex, striatum, thalamus, spinal cord, liver, and dorsal root ganglion.

[0138] During acquisition, stained sections were imaged on a Keyence BZ-X810 using a slicing mode with a Z-stack depth of 10 μm. For cell counting, image settings were configured with exposure parameters to detect low mScarlet expression cells in each sample group within each brain region. Z-stack maps were reconstructed into full single-stack images using Keyence analysis software, and each imaging channel was output as a separate TIF. The images were then fed into ilastik version 1.4.0 (66) as input data, where pixel classification was used within the segmentation workflow. All color / intensity, edge, and texture features were selected and used during training. Training was performed on images of the cortex, striatum, or thalamus in NeuN or SOX9 stained brain sections representing C57BL / 6J or TFR CKI mice that had received BI-hTFR1 or AAV9 to distinguish foreground and background pixels. The predictions were then output as probabilistic maps in TIF format and fed into CellProfiler 4.2.4 (67). Create a custom workflow to determine the percentage overlap between positive transduced cells and antibody markers. First, align channels using the alignment module. Second, use the IdentifyPrimaryObjects module with Otsu's two-class thresholding to detect and segment foreground objects (positive transduced cells, NeuN-positive cells, or SOX9-positive cells) from the background of the image. Third, use the ExpandOrShrinkObjects module to expand the foreground objects by 2-5 pixels. Fourth, use the MaskObjects module to determine the number of co-localized objects overlapping with a threshold of 40% overlap or more. Create a separate CellProfiler workflow where the IdentifyPrimaryObjects module detects foreground and background objects (two classes), and then the OverlayOutlines module overlays the contours of the detected foreground objects onto the original input image of the mScarlet, NeuN, or SOX9 channel. Output the image using the SaveImages module. Then use the output image to verify whether further training with pixel classification in Ilastik is needed to detect missed or incorrectly classified cells. An independent evaluator manually counted randomly selected images using Photoshop's counting tool without prior knowledge of the expected results to determine the percentage overlap between mScarlet-positive cells and NeuN or SOX9-positive cells in stained tissue. Results were evaluated to be within ±5% deviation.

[0139] Protein blot Purified N-terminal flag-labeled full-length human and mouse TfR1 protein or mouse whole brain lysate were isolated on Bolt 4-12% Bis-Tris Plus gels and transferred to nitrocellulose membranes. After incubation with anti-TfR1 antibody (0.5 μg / mL ThermoFisher, catalog 13-6890; 0.25 μg / mL R&D, AF2474) or anti-β-actin (1:5000; Abcam, AB20272), subsequent incubation was followed by incubation with a horseradish peroxidase (HRP) conjugated secondary antibody. HRP signal was detected using a Bio-Rad ChemiDoc™ MP system #1708280 with the highest sensitivity substrate from the SuperSignal West Femto.

[0140] In vivo biodistribution, transduction and luciferase assay BI-hTFR1 or AAV9 encoding CAG-NLS-mScarlet-P2A-luciferase-WPRE-SV40pA was administered at 5 x 10⁻⁶ doses per mouse. 11 The dose of vg was administered intravenously to female C57BL / 6J or TFRC KI mice aged 18 to 21 weeks. Three weeks later, the mice were perfused with PBS. Tissue samples from the brain, liver, spinal cord, and DRG were fixed in 4% PFA. Remaining tissues (including other samples from the brain, liver, spinal cord, and DRG) were collected, rapidly frozen on dry ice, and stored at -80°C. Biodistribution analysis: Samples were processed using the DNeasy 96 Blood and Tissue Kit (Qiagen, 69581). qPCR was performed on the mScarlet transgene and mouse glucagon gene as previously described (see primer sequences in Table S1) (5). For mRNA analysis, RNA was isolated using TRIzol (Invitrogen, 15596026) and purified using the RNeasy 96 Kit (Qiagen, 74171). cDNA synthesis was performed using Maxima H Minus reverse transcriptase (Thermo Scientific, EP0753). qPCR was performed on mScarlet and mouse GAPDH (primer sequences are shown in Table S1). Luciferase assay: Proteins were extracted from tissue samples using lysis buffer T-Per (Invitrogen, 78430) containing a 1X Halt protease inhibitor while maintaining ice-cold conditions. Reporter genes were assessed using 10 μg of total protein in the Britelite Plus reporter gene assay system.

[0141] GBA1 in vivo delivery experiment The BI-hTFR1 or AAV9 encoding CMV / CBA-GBA1-HA-pA will be 1 x 1014 Or 5 x 10 12 Intravenous injection of vg / kg was administered to female TFRC KI mice aged 28 to 30 weeks. Three weeks later, cerebrospinal fluid (CSF) was collected from the cerebrospinal cisterns of the anesthetized mice as previously described (68). Briefly, the cerebrospinal cisterns were surgically exposed and punctured with a pointed glass capillary, allowing CSF to flow into the capillary. Approximately 6–10 μL of CSF was collected from each animal. The pleural cavity was then exposed and 200–400 μL of blood was collected into a micro-blood collection tube (BD, 365967) containing serum separation additive. The mice were then cardiac perfused with ice-cold PBS. Sections of brain, liver, and spinal cord tissue were fixed in 4% PFA. Other tissue samples from these organs were collected and rapidly frozen at -80°C. After incubation at room temperature for 1.5 hours, the blood was centrifuged at 10,000 × g for 90 seconds, and the serum was collected and stored at -80°C. The fixed tissues were subjected to IHC as described in the Animal section of the Methods. GBA-HA was detected using a 1:50 dilution of anti-HA primary antibody (Sigma, 11867423001) followed by a 1:500 dilution of Alexa Fluor 568 conjugated secondary antibody (Invitrogen, A78946). Vector genome was quantified using qPCR primers targeting CMV and mouse GAPDH (Table S1).

[0142] To measure GC enzyme activity, whole tissue lysates were prepared. Tissues were thawed on ice, weighed, and homogenized using GenoGrinder (SPEX Sample prep) in 2 volumes of ultrapure distilled water (Sigma, 4693132001) containing cOmplete protease inhibitor. The homogenate was then centrifuged at 10,000 × g for 2 min, transferred to new pre-chilled 1.5 mL Eppendorf tubes, and incubated on ice for 15–30 min. Next, the samples were centrifuged at 12,000 × g for 20 min. The supernatant was collected and stored at -80°C or used for subsequent analysis. The total protein concentration in the resulting lysates was determined using the BCA assay (Thermo Fisher Scientific, 23225) as described by the product manufacturer. Enzyme activity in serum and whole tissue lysate samples was determined using the SensoLyte Red Glucocerebroside Lipoproteinase (GBA) Activity Assay Kit (AnaSpec, AS-72259). In short, add 20 μL of serum or a volume of tissue lysate containing 30 μg of protein to each well. Add assay buffer to a total volume of 50 μL. Then, add 50 μL of 1X enzyme substrate to each well. Gently mix the samples and incubate at room temperature for one hour. Measure the fluorescence signal at excitation / emission wavelengths of 570 / 610 nm in endpoint mode using an EnVision 2104 plate reader (PerkinElmer). Determine the amount of reaction product in each well by the measured relative fluorescence units (RFU) using a Resorufin reference fluorescence standard curve. Calculate the enzyme activity using the obtained values, expressed as μU / mL blood or μU / mg protein. One unit of GC enzyme activity is the amount of enzyme that produces 1 μmol of product per minute under specified reaction conditions.

[0143] Table S1. Primers and barcodes used for qPCR in this study. Each sequence is listed from 5′ to 3′.

[0144] Table S2. Preparation and purification methods used in this study and the final purified yield.

[0145] Table S3. Human GBA1 NT and HA tag (underlined and bold) sequences used in the vector

[0146] Table S4. The hGBA1-HA oxyacid sequence used in the vector:

[0147] *** Various modifications and variations of the methods, pharmaceutical compositions, and kits described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. While the invention has been described in conjunction with specific embodiments, it should be understood that further modifications are possible and the invention, as claimed, should not be unduly limited to such specific embodiments. Indeed, the various modifications to the described modes of carrying out the invention that are apparent to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any changes, uses, or modifications to the invention that generally follow the principles of the invention and include such differences from this disclosure and are within the scope of known conventions in the art to which this invention pertains, and that can be applied to the essential features set forth above.

Claims

1. An engineered recombinant adeno-associated virus (AAV) particle comprising an engineered AAV capsid polypeptide containing a transferrin receptor (TfR1) binding moiety and a recombinant AAV genome flanked by an AAV ITR sequence, the recombinant AAV genome comprising a polynucleotide encoding GBA1 operatively linked to a regulatory element that promotes the expression of GBA1 in the central nervous system (CNS).

2. The engineered recombinant AAV particle of claim 1, wherein the TfR1 binding portion is inserted into or substituted within loop IV, loop VIII, or both of the AAV capsid protein.

3. The engineered recombinant AAV particle as described in any of the preceding claims, wherein the AAV capsid polypeptide is VP1, VP2, VP3 or a combination thereof.

4. The engineered recombinant AAV particle as described in any of the preceding claims, wherein the TfR1 binding portion is inserted between amino acids 588 and 589 of the capsid protein of AAV9, or at a similar position in the capsid protein of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh.74, or AAVrh.

10.

5. The engineered recombinant AAV particle as claimed in any of the preceding claims, wherein the TfR1 binding portion is inserted between two consecutive amino acids within amino acid 451-460 of the capsid protein of AAV9, or at a similar position in the capsid protein of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh.74, or AAVrh.

10.

6. The engineered recombinant AAV particles as described in any of the preceding claims, wherein the TfR1 binding portion comprises a 7-mer, the 7-mer comprising LHRLGPN (SEQ ID NO: 36834), YSRIGPN (SEQ ID NO: 42487), LHRLGPD (SEQ ID NO: 36413), LHRAGPD (SEQ ID NO: 36894), YSRIGPD (SEQ ID NO: 38223), LSRIGPD (SEQ ID NO: 36274), LARSGPD (SEQ ID NO: 18035), YSRNSDN (SEQ ID NO: 42488), LHKAGPN (SEQ ID NO: 36305), LSRIGPN (SEQ ID NO: 36347), LAKSGPN (SEQ ID NO: 36287), YARNGPN (SEQ ID NO: 14048), FRSTNGV (SEQ ID NO: 16070), VESTNGR (SEQ ID NO: 14048), LHRLGPN (SEQ ID NO: 16070), LHRLGPN (SEQ ID NO: 36834), YSRIGPN (SEQ ID NO: 36287), YARNGPN (SEQ ID NO: 14048), FRSTNGV (SEQ ID NO: 16070), VESTNGR (SEQ ID NO: 36834), LHRLGPN (SEQ ID NO: 36834), LHRLGPD (SEQ ID NO: 36413), LHRAGPD (SEQ ID NO: 36894), YSRIGPD (SEQ ID NO: 38223), LSRIGPD (SEQ ID NO: 36274), LARNGPN (SEQ ID NO: 18035), YSRNSDN (SEQ ID NO: 42488), LHKAGPN (SEQ ID NO: 36305), LSRIGPN (SEQ ID NO: 36347), LAK NO: 36431), VDSTNGV (SEQ ID NO: 12206), VQSTNGV (SEQ ID NO: 36423), VSSTNGV (SEQ ID NO: 12333), TESTNGR (SEQ ID NO: 17558), VQSTNGI (SEQ ID NO: 11292), FVSTNGV (SEQ ID NO: 42491), RGEDVYP (SEQ ID NO: 36864), RLEDVFP (SEQ ID NO: 36264), RTYDSYP (SEQ ID NO: 37938), RTYDAYP (SEQ ID NO: 38571), RTYDSFP (SEQ ID NO: 37806), RTETVYP (SEQ ID NO: 36486), RTETVFP (SEQ ID NO: 36389), RTEHVFP (SEQ ID NO: 36603), LCKPCLD (SEQ ID NO: 36437), LCKPCPT (SEQ ID NO: 36438), KDEFTTF (SEQ ID NO: 36308), KDDFTTY (SEQ ID NO: 36336), RDEFTTY (SEQ ID NO: 36615), KDEFSTY (SEQ ID NO: 36390), RDEFTSF (SEQ ID NO: 36701), REDHVSW (SEQ ID NO: 37067), IALKGWD (SEQ ID NO: 36248), NALEGRD (SEQ IDNO:36407)、VALEGRD(SEQ ID NO:36604)、VALKGWD(SEQ ID NO:17701)、YSRLNMN(SEQ ID NO:14301)、YSRLNKD(SEQ ID NO:16577)、YHRLSNN(SEQ ID NO:16636)、VHRLQDK(SEQ ID NO:16602)、LHALSHN(SEQ ID NO:16608)、PSATNGV(SEQ ID NO:20486)、QVSTNGI(SEQ ID NO:16021)、SYSSNGV(SEQ ID NO:16234)、HQSSNGV(SEQ ID NO:15978)、VGSINGI(SEQ ID NO:16199)、AMSTNGR(SEQ ID NO:16000)、SASTNGV(SEQ ID NO:16127)、YMSTNGV(SEQ ID NO:16042)、YYSSNGV(SEQ ID NO:16206)、VHSTNGI(SEQ ID NO:16134)、PLSTNGV(SEQ ID NO:16233)、VYSTNGI(SEQ ID NO:16059)、IISTNGV(SEQ ID NO:16054)、RSVSSNGV(SEQ ID NO:20502)、YKSSNGV(SEQ ID NO:16123)。 7. The engineered recombinant AAV particles of claim 6, wherein the heptomer comprises YSRIGPN (SEQ ID NO: 42487).

8. The engineered recombinant AAV particle according to any one of claims 1 to 5, wherein the TfR1 binding portion is selected from any one of SEQ ID NO: 42513-43842.

9. A pharmaceutical composition comprising engineered recombinant AAV particles as described in any one of claims 1 to 8 and an acceptable carrier.

10. A method of delivering GBA1 to the central nervous system (CNS), the method comprising administering the pharmaceutical composition of claim 9.

11. The method of claim 10, wherein the pharmaceutical composition is in a concentration of 0.1 x 10⁻⁶. 12 vg / kg to 1x10 14 Dosage between vg / kg.

12. The method of claim 11, wherein the pharmaceutical composition is in a concentration of 0.1 x 10⁻⁶. 12 vg / kg up to 100x10 12 Administer at a dose of vg / kg.

13. The method of claim 12, wherein the pharmaceutical composition is in a concentration of 1x10 12 vg / kg up to 10x10 12 Administer at a dose of vg / kg.

14. The method of claim 13, wherein the pharmaceutical composition is in a concentration of 5 x 10 12 Administer at a dose of vg / kg.

15. The method of any one of claims 10 to 14, wherein the subject suffers from Gaucher disease.

16. The method of any one of claims 10 to 14, wherein the subject suffers from Parkinson's disease.

Images