Use of a salix extract in the preparation of skin care products for promoting sebum secretion and barrier repair

Abstract

The application discloses the technical field of skin care products and discloses application of a sambucus williamsii extract in preparation of skin care products for promoting oil secretion and barrier repair, wherein the skin care products have at least one of the effects of promoting oil secretion and barrier repair, the sambucus williamsii extract is a sambucus williamsii water extract, the use concentration of the sambucus williamsii water extract is 0.5-2%, sambucus williamsii powder is added into ultrapure water, the obtained mixture is subjected to heating treatment, and the supernatant is taken after centrifugation and filtration, so that the sambucus williamsii water extract is obtained. The application finds and verifies that the sambucus williamsii water extract has the effects of antioxidation, promotion of oil secretion and barrier repair, provides a new direction for application of the sambucus williamsii extract in cosmetics, and provides a new approach for solving the problems of skin dryness and barrier function decline caused by age growth and reduction of sebum secretion.

Description

Technical Field

[0001] This invention relates to the field of skincare technology, specifically to the application of elderberry extract in the preparation of skincare products that promote sebum secretion and repair the skin barrier. Background Technology

[0002] As we age, the decline in androgen levels leads to decreased sebum production, exacerbating transepidermal water loss. This is accompanied by a slower stratum corneum metabolism and reduced synthesis of intercellular lipids (ceramides, cholesterol, etc.) and natural moisturizing factors, ultimately damaging the lipid barrier structure that forms the skin. Therefore, promoting sebum secretion and repairing the skin barrier are crucial for combating skin aging. Sufficient sebum builds a lipid barrier on the skin's surface, reducing transepidermal water loss and maintaining skin hydration. Repairing the damaged barrier strengthens the skin's defenses, protecting against UV rays and external irritants, and preventing repeated inflammation and damage. The synergistic effect of these two factors improves signs of aging such as dryness, roughness, and flaking caused by reduced sebum, while breaking the vicious cycle between barrier damage and skin aging, delaying the appearance of wrinkles and sagging, and maintaining healthy, youthful skin in the long term.

[0003] Elderberry (Sambucus nigra), a deep purple berry of the elderberry tree, belongs to the Caprifoliaceae family and is rich in bioactive components, widely used in food, health products, and natural medicine. Current research has confirmed that elderberry extract possesses various effects such as antioxidant, anti-inflammatory, and antiviral properties, but there are no reports on its application in promoting sebum secretion and barrier repair. Therefore, this invention proposes an application of elderberry extract in the preparation of skincare products that promote sebum secretion and barrier repair. Summary of the Invention

[0004] The purpose of this invention is to provide an application of elderberry extract in the preparation of skin care products that promote sebum secretion and repair the skin barrier, in order to solve the above-mentioned problems.

[0005] The present invention achieves the above objectives through the following technical solutions: This invention provides an application of elderberry extract in the preparation of skincare products, wherein the skincare products possess at least one of the following effects: (1) It promotes sebum secretion; (2) The effect of barrier repair.

[0006] As a further optimization of the present invention, the elderberry extract is an elderberry water extract.

[0007] As a further optimization of the present invention, the concentration of elderberry water extract used is 0.5-2%.

[0008] As a further optimization of the present invention, the method for preparing elderberry water extract includes the following steps: (1) Add elderberry powder to ultrapure water to obtain a mixture; (2) The mixture is heated and centrifuged, and the supernatant is filtered to obtain elderberry water extract.

[0009] As a further optimization of the present invention, in step (1), the amount of elderberry powder added is 0.08-0.12 g / ml.

[0010] As a further optimization of the present invention, in step (2), the heating temperature is 70-80℃ and the heating time is 0.5-1.5h.

[0011] As a further optimization of the present invention, the preparation method also includes step (3): adjusting the concentration of elderberry water extract using ultrapure water.

[0012] As a further optimization of the present invention, elderberry water extract promotes sebum secretion by increasing the expression levels of sebum secretion-related factors PPARγ, SREBP-1c, FASN, and ACC.

[0013] As a further optimization of the present invention, elderberry water extract achieves the effect of barrier repair by increasing the expression levels of barrier function-related factors FLG, LOXL2, and IVL.

[0014] The beneficial effects of this invention are as follows: This invention extracted water extract, alcohol extract, and elderberry polysaccharide from elderberry. The composition and efficacy of these three extracts were analyzed, revealing differences in their component content. The water extract exhibited the best effects in promoting sebum secretion and strengthening the skin barrier, and also demonstrated the strongest antioxidant capacity. This discovery provides a new direction for the application of elderberry extract in cosmetics and offers a novel approach to addressing skin dryness and decreased barrier function caused by aging and reduced sebum secretion. Attached Figure Description

[0015] Figure 1 The effects of different concentrations of elderberry aqueous extract on SZ95 cells; Figure 2 The effects of different concentrations of elderberry alcohol extract on SZ95 cells; Figure 3 Effects of different concentrations of elderberry polysaccharide on SZ95 cells; Figure 4 Effects of different elderberry extracts on lipid secretion in SZ95 cells (Nile Red staining method). Figure 5 Effects of different elderberry extracts on lipid secretion in SZ95 cells (Oil Red O stained microscopic images). Figure 6 To investigate the effects of different elderberry extracts on lipid secretion in SZ95 cells (quantitative detection by Oil Red O staining absorbance). Figure 7 The effect of elderberry water extract on the expression levels of lipid secretion-related factors in SZ95 cells; Figure 8 The effects of different concentrations of elderberry aqueous extract on HaCaT cells; Figure 9 The effect of elderberry water extract on the expression levels of barrier function-related factors in HaCaT cells. Detailed Implementation

[0016] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0017] I. Experimental Materials Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products.

[0018] II. Experimental Methods 1. Preparation of elderberry extract 1.1 Preparation of Elderberry Aqueous Extract The dried elderberries were crushed into a fine powder, 5g of which was weighed and added to 50ml of ultrapure water. The mixture was heated at 75℃ for 1 hour, centrifuged, and the supernatant was filtered to obtain an aqueous extract with a concentration of 0.1g / ml.

[0019] 1.2 Preparation of elderberry alcohol extract The dried elderberry fruit was crushed into a fine powder, 5g was weighed, 50ml of 70% ethanol was added, and the mixture was sonicated at 25℃ and 180W for 1 hour. After centrifugation, the supernatant was filtered to obtain an ethanol extract with a concentration of 0.1g / ml.

[0020] 1.3 Preparation of elderberry polysaccharide The dried elderberry fruit was crushed into a fine powder, 15g was weighed, and 300ml of ultrapure water was added. The mixture was heated to boiling for 1 hour. After filtration, 150ml of ultrapure water was added to the residue and the mixture was boiled for another 40 minutes. The filtrates were combined, and 3 times the volume of 95% ethanol was added to the filtrate. The mixture was left to stand for 12 hours, and after centrifugation, the precipitate was collected and dissolved in ultrapure water to 150ml to obtain elderberry polysaccharide with a concentration of 0.1g / ml.

[0021] 2. Component content detection of the extract 2.1 Methods for detecting protein content BCA method, protein molecules in alkaline solution will react with Cu2+. ＋ Reduced to Cu ＋ 2,2'-Biquinoline-4,4'-dicarboxylic acid (BCA) binds to form a purple complex. At a wavelength of 562 nm, the intensity of its color is directly proportional to the protein concentration. Using a protein reference solution as a standard curve, the protein content in the test sample is determined by colorimetry.

[0022] The specific method for using the BCA test kit is as follows: Preparation of BSA standards: Prepare BSA standard solutions with concentrations of 2000 μg / ml, 1500 μg / ml, 1000 μg / ml, 750 μg / ml, 500 μg / ml, 250 μg / ml, 125 μg / ml, and 25 μg / ml using 1×PBS; Preparation of BCA detection working solution: Prepare according to the ratio of reagent A: reagent B = 50:1. Dilute the sample to different concentrations using 1xPBS for subsequent experiments; In a 96-well plate, add 10 μl of standard solution and the sample solution to be tested to each well, add 200 μL of BCA working solution, mix well, and incubate at 37°C for 30 min. After incubation, cool to room temperature, use a multi-mode microplate reader to detect the absorbance at a wavelength of 562 nm, plot a standard curve, and calculate the protein content of the sample to be tested.

[0023] 2.2 Methods for determining soluble sugar content Sugars dehydrate under the action of concentrated sulfuric acid to produce furfural or its derivatives. The latter condenses with anthrone reagent to form a blue-green compound with maximum absorption at a wavelength of 625 nm. The color depth is directly proportional to the sugar content within a certain range. The specific method is as follows: Preparation of glucose standard solutions: Stock solution (1 mg / mL): Accurately weigh 100 mg of anhydrous glucose dried to constant weight at 105 °C, dissolve in distilled water, and dilute to a 100 mL volumetric flask. Series of working standard solutions: When using, dilute with the stock solution to prepare a series of concentration gradients: 0, 62.5 µg / mL, 125 µg / mL, 250 µg / mL, 500 µg / mL, 750 µg / mL, and 1000 µg / mL. Preparation of 1 mg / mL anthrone solution: Accurately weigh a certain amount of anthrone reagent, add water, and finally add concentrated sulfuric acid to prepare a 1 mg / mL 80% sulfuric acid-anthrone solution. Add 50 μl of glucose standard working solution or the sample to be tested to a 96-well plate, add 150 μl of 1 mg / ml 80% sulfuric acid-anthrone solution, mix immediately, let stand for 15 min, then cool on ice for 15 min and remove. Use a multi-functional microplate reader to detect the absorbance at a wavelength of 625 nm. Plot a standard curve with absorbance as the ordinate and concentration as the abscissa, and calculate the soluble sugar content of the sample to be tested.

[0024] 2.3 Methods for detecting polyphenol content Under alkaline conditions, phenolic substances reduce tungstic molybdic acid to produce a blue compound with a characteristic absorption peak at 760 nm. The total phenol content of the sample can be obtained by measuring the absorbance at 760 nm.

[0025] The total phenols were detected using the Total Phenols Kit (catalog number: A143-1-1, TP spectrophotometry). Please refer to the instruction manual for specific procedures.

[0026] 2.4 Methods for detecting flavonoid content Flavonoids are a class of polybenzene compounds belonging to plant secondary metabolites. They have anti-inflammatory, antibacterial, lipid-lowering, hydroxyl free radical scavenging, and cancer-preventing effects on the human body. In alkaline nitrite solution, flavonoids form a red complex with aluminum ions, exhibiting a characteristic absorption peak at 502 nm. The flavonoid content of the sample can be calculated by measuring the absorbance of the sample extract at 502 nm.

[0027] The detection was performed using a plant flavonoid detection kit (catalog number: A142-1-1 Flavonoid Kit, colorimetric method). Please refer to the instruction manual for specific operation procedures.

[0028] 2.5 Test Results and Conclusions The component content of elderberry water extract, alcohol extract and elderberry polysaccharide were detected based on 2.1-2.4. The results are shown in Table 1. It can be seen from the table that among the three elderberry extracts, the elderberry water extract has relatively higher contents of polyphenols, proteins and flavonoids.

[0029] Table 1. Component content detection results of elderberry extract

[0030] 3. Effects of the extract on sebum secretion in human sebaceous gland cells SZ95 3.1 Cell proliferation assay Add 100 μl of human sebaceous gland cell suspension (SZ95) to each well of a 96-well plate to achieve a cell density of 5000 cells / well. Incubate in a 5% CO2 incubator for 24 h. Dilute the sample to 20% (v / v) with DMEM containing 10% FBS, sterilize by filtration through a 0.22 μm filter, and then further dilute to concentrations of 10%, 5%, 2.5%, 1.3%, 0.6%, 0.3%, 0.2%, 0.1%, and 0%. Cells cultured for 24 hours were removed, and the culture supernatant was discarded. Different concentrations of the analyte were added to each well, with six replicates per concentration. The cells were then incubated in a 5% CO2 incubator for another 24 hours. The cell culture plates were then removed, the supernatant was discarded, and 100 μl of DMEM culture medium and 10 μl of CCK8 solution were added to each well. The plates were then incubated in a 5% CO2 incubator for 2-4 hours. The absorbance was measured at 450 nm using a microplate reader. Cell proliferation rate was calculated using the formula: Cell proliferation rate = (OD experimental group / OD cell control group) × 100%. Note that the experimental groups contained different concentrations of the analyte, while the control group did not contain the analyte.

[0031] The results are as follows Figure 1-3 As shown in the figure, it can be seen that water extracts with concentrations below 20% (v / v) have no toxic effect on human sebaceous gland cells, while water extracts with concentrations of 2.5-10% have the effect of promoting the proliferation of sebaceous gland cells. Alcohol extracts at concentrations below 0.6% (v / v) have no toxic effect on human sebaceous gland cells, and polysaccharides at concentrations below 20% (v / v) have no toxic effect on human sebaceous gland cells. Neither alcohol extracts nor polysaccharides promote the proliferation of sebaceous gland cells.

[0032] 3.2 Nile Red Staining Model Cell resuscitation and culture: Human sebaceous gland cells SZ95 were taken out from liquid nitrogen, thawed quickly in a 37°C water bath, and then transferred to centrifuge tubes containing preheated culture medium. After centrifugation, the supernatant was discarded, the cells were resuspended in fresh culture medium and seeded into culture dishes, and cultured in an incubator until the cells reached the logarithmic growth phase. Cell passage and plating: Cells in logarithmic growth phase were passaged, and the cell density was adjusted to 5 × 10⁴ cells / ml. 100 μl of the cells were then seeded into 96-well plates with a black transparent bottom, with an appropriate amount of culture medium added to ensure uniform cell distribution. Cells were cultured until they adhered stably. Test substance intervention: After cell adhesion and stabilization, the original culture medium was removed, and culture medium containing the test substance was added. A control group (culture medium only, without the test substance) and a positive control group (containing 200 μmol / L oleic acid) were also set up. Cells were cultured for another 24 h. Six replicates were set up for each group to ensure the reliability of the results. Lipid secretion detection: Remove the cell culture plate, discard the culture medium, wash twice with sterile PBS, add 10 μg / ml Nile Red solution to each well and stain for 15 min. Measure the fluorescence intensity at 485 nm / 565 nm; The calculation formula is: Cell lipid secretion rate = F experimental group / F cell control group × 100%.

[0033] Test results as follows Figure 4 As shown in the figure, it can be seen that 1% elderberry water extract and alcohol extract, as well as 1-20% polysaccharide, all have the effect of promoting sebum secretion, and 1% elderberry water extract has the best effect in promoting sebum secretion.

[0034] 3.3 Oil Red O staining model Cell resuscitation and culture: Human sebaceous gland cells SZ95 were taken out from liquid nitrogen, thawed quickly in a 37°C water bath, and then transferred to centrifuge tubes containing preheated culture medium. After centrifugation, the supernatant was discarded, the cells were resuspended in fresh culture medium and seeded into culture dishes, and cultured in an incubator until the cells reached the logarithmic growth phase. Cell passage and plating: Passage cells in logarithmic growth phase, adjust cell density to 1×10⁵ cells / ml, and seed them into clear 12-well plates, 1 ml per well, ensuring uniform cell distribution, and continue culturing until cells adhere stably. Intervention with the test substance: After cells adhered and stabilized, the original culture medium was aspirated, and culture medium containing the test substance was added. A control group (culture medium only, without the test substance) and a positive control group (containing 200 μmol / L oleic acid) were also set up and cultured for another 24 h. Three replicates were set up for each group to ensure the reliability of the results. Lipid secretion assay: Remove the cell culture plate and discard the culture medium. Wash four times with sterile PBS, add 0.5 ml of 4% paraformaldehyde fixative to each well, and fix for 15 min at room temperature. Discard the fixative, wash twice with sterile PBS, add 0.5 ml of Oil Red O working solution to each well, and stain for 15 min at room temperature. Discard the staining solution, wash four times with sterile PBS, add 0.5 ml of PBS to each well, and take a micrograph. Discard the ultrapure water, add 1 ml of isopropanol to each well, dissolve, and then pipette 200 μl of the isopropanol solution into a 96-well plate. Measure the absorbance at 510 nm. The calculation formula is: Cell lipid secretion rate = OD experimental group / OD cell control group × 100%.

[0035] The results are as follows Figure 5 , 6 As shown in the figure, it can be seen that 1% elderberry water extract and alcohol extract, as well as 1% and 10% elderberry polysaccharide, all have the effect of promoting sebum secretion, and the 1% elderberry water extract has the best effect in promoting sebum secretion.

[0036] 3.4 Detection of sebum secretion-related factors The effects of different concentrations of elderberry aqueous extract on the expression levels of lipid secretion-related factors in human sebaceous gland cells (SZ95 cells) were investigated.

[0037] (1) Correlation factors PPARG (NCBI accession number is NM_138712.5); SREBP-1c (GenBank login number AB373959.1); FASN (NCBI accession number is NM_004104.5); ACC1 (NCBI accession number is NM_198834.3); GAPDH (NCBI login number NM_001357943.2) is an internal reference.

[0038] (2) Detection method Human sebaceous gland cells SZ95 were taken out of liquid nitrogen, thawed quickly in a 37°C water bath, and then transferred to centrifuge tubes containing preheated DMEM high-glucose medium (containing L-glutamine, pyruvate-free) (catalog number: C11965500BT, brand: gibco). After centrifugation, the supernatant was discarded, the cells were resuspended in fresh medium and seeded into culture dishes, and cultured in an incubator until the cells reached the logarithmic growth phase.

[0039] Cells in the logarithmic growth phase were passaged, and the cell density was adjusted to 1×10⁻⁶. 5After obtaining cells / ml, seed them into 6-well plates, add an appropriate amount of culture medium to each well to ensure uniform cell distribution, and continue culturing until the cells adhere and reach the initial density required for the experiment.

[0040] After the cells adhered and stabilized, the original culture medium was aspirated, and culture medium containing different concentrations of the extract was added. A control group was also set up (culture medium was added only, without extract). The cells were cultured for another 24 hours. Each group was divided into three replicates to ensure the reliability of the results.

[0041] Remove the cell culture plate, discard the culture medium, and directly add the RZ lysis buffer from the Total RNA Extraction Kit (brand: TIANGEN, catalog number: DP419) to the culture dish. Extract RNA according to the kit instructions, and measure the RNA concentration using a micro UV spectrophotometer. If the RNA quality is good, proceed to the next step.

[0042] Following the instructions for the Starscript II Reverse Transcription Kit (Genstar, catalog number: A233-10), reverse transcription was performed in RNase-free PCR tubes. Primers and template were added according to the instructions for the 2xSYBR Green Master Mix Kit (Bimake, catalog number: B21203). The primer sequences are as follows: PPARG-F: 5'-GAGAAGCTGTTGGCGGAGAT-3'; PPARG-R: 5'-GCGGGAAGGACTTTATGTATGA-3'; SREBP-1c-F: 5'-GGTCGTAGATGCGGAGAAGC-3'; SREBP-1c-R: 5'-TCATTGATGGAGGAGCGGTAG-3'; FASN-F: 5'-GTGTCCACCAGCAACATCAGC-3'; FASN-R: 5'-GGTTCTCCAGCAAGCCATCTC-3'; ACC1-F: 5'-ACAACGCAGGCATCAGAAGA-3'; ACC1-R: 5'-CAGCACTCACATAACCCACCCAT-3'; GAPDH-F: 5' TGAAGGTCGGAGTCAACGG 3'; GAPDH-R: 5' CCTGGAAGATGGGTGATGGG 3'.

[0043] For real-time quantitative PCR, a 20 μl system was used. In a 96-well plate, 1 μl of template, 1 μl each of the upstream and downstream primers, 10 μl of 2xSYBR Green Master Mix, and 7 μl of deionized water were added to each well to prepare the reagent mixture. After sealing the plate with a PCR clear film, centrifuged and placed in a PCR instrument. Amplification was performed according to the table below. The collected data were analyzed using statistical software such as Excel or SPSS, and the results were calculated. -△△ct The values ​​and their statistical indicators, such as mean and standard deviation, are shown in Table 2. PCR reaction conditions are also shown in Table 2.

[0044] Table 2 PCR reaction conditions

[0045] (3) Test results Test results as follows Figure 7 As shown in the table, 0.5-2% (v / v) elderberry water extract can significantly increase the expression of lipid secretion-related factors in SZ95 cells, and this increase is dose-dependent.

[0046] 4. Effects of elderberry water extract on HaCaT barrier function in human keratinocytes 4.1 Cytotoxicity assay (CCK-8 / MTT method) Cell culture: Remove frozen HaCaT keratinocytes from liquid nitrogen, thaw them quickly in a 37°C water bath, and then transfer them to centrifuge tubes containing preheated DMEM high-glucose medium (catalog number: C3113-0500, brand: VC). After centrifugation, discard the supernatant, resuspend the cells in fresh DMEM high-glucose medium, and seed them into culture dishes. Incubate the cells in an incubator until they reach the logarithmic growth phase.

[0047] Cell passage and plating: Cells in the logarithmic growth phase were passaged, and the cell density was adjusted to 1×10⁻⁶. 5 After obtaining cells / ml, seed them into 96-well plates, add an appropriate amount of culture medium to each well to ensure uniform cell distribution, and continue culturing until the cells adhere and reach the initial density required for the experiment.

[0048] Extract Intervention: After cell adhesion and stabilization, the original culture medium was aspirated. The sample was diluted to 20% (v / v) with DMEM containing 10% FBS, and then filtered through a 0.22 μm filter for sterilization. Further dilutions were then performed to concentrations of 20%, 10%, 5%, 2.5%, 1.3%, 0.6%, 0.3%, 0.2%, 0.1%, and 0%. Multiple replicates were set for each group to ensure the reliability of the results.

[0049] Cell treatment: Cell proliferation was assessed using the CCK8 assay after 24 hours. Statistical software such as Excel or SPSS was used to process the collected data and calculate statistical indicators such as mean and standard deviation.

[0050] The test results show that: Figure 8 As shown, elderberry aqueous extracts at concentrations below 20% (v / v) have no toxic effect on HaCaT cells.

[0051] 4.2 Detection of factors related to barrier function The effects of different concentrations of elderberry water extract on the expression levels of barrier function-related factors in HaCaT cells were investigated.

[0052] (1) Barrier function related factors FLG (NCBI login number is NM_002016.2); LOXL2 (NCBI login number is NM_002318.3); IVL (Involucrin) (NCBI accession number NM_005547.4); GAPDH (NCBI login number NM_001357943.2) is an internal reference.

[0053] (2) Detection method The frozen keratinocytes HaCaT cells were removed from liquid nitrogen and quickly thawed in a 37°C water bath. They were then transferred to centrifuge tubes containing preheated DMEM high-glucose medium (catalog number: C3113-0500, brand: VC). After centrifugation, the supernatant was discarded, and the cells were resuspended in fresh DMEM high-glucose medium and seeded into culture dishes. The cells were then cultured in an incubator until they reached the logarithmic growth phase.

[0054] Cells in the logarithmic growth phase were passaged, and the cell density was adjusted to 1×10⁻⁶. 5 After obtaining cells / ml, seed them into 96-well plates, add an appropriate amount of culture medium to each well to ensure uniform cell distribution, and continue culturing until the cells adhere and reach the initial density required for the experiment.

[0055] After the cells adhered and stabilized, the original culture medium was aspirated, and culture medium containing 0%, 0.1%, 0.5%, 1.0%, and 2.0% of the culture medium was added. The culture medium for elderberry water extract was prepared, and a control group (with only culture medium) was set up. Both groups were cultured for another 24 hours. Multiple replicates were set up for each group to ensure the reliability of the results.

[0056] Remove the cell culture plate, discard the culture medium, and directly add the RZ lysis buffer from the Total RNA Extraction Kit (brand: TIANGEN, catalog number: DP419) to the culture dish. Extract RNA according to the kit instructions, and measure the RNA concentration using a micro UV spectrophotometer. If the RNA quality is good, proceed to the next step.

[0057] Following the instructions for the Starscript II Reverse Transcription Kit (Genstar, catalog number: A233-10), reverse transcription was performed in RNase-free PCR tubes. Primers and template were added according to the instructions for the 2xSYBR Green Master Mix Kit (Bimake, catalog number: B21203). The primer sequences are as follows: FLG-F: 5'-GACAGTGAGGCATACCCAGAG-3' FLG-R: 5'-AAGTGACCATGTTCCTTAGCG-3' LOXL2-F: 5'-CAAAATGTTTGCCTCACGG-3' LOXL2-R: 5'-TCTGGCTTTGTACGCTTTCC-3' IVL-F: 5'-TCCTCCAGTCAATACCCATCA-3' IVL-R: 5'-CATTCTTGCTCAGGCAGTCC-3' GAPDH-F: 5'-TGAAGGTCGGAGTCAACGG-3' GAPDH-R: 5'-CCTGGAAGATGGGTGATGGG-3' For real-time quantitative PCR, a 20 μl system was used. In a 96-well plate, 1 μl of template, 1 μl each of the upstream and downstream primers, 10 μl of 2xSYBR Green Master Mix, and 7 μl of deionized water were added to each well to prepare the reagent mixture. After sealing the plate with a PCR clear film, centrifuged and placed in a PCR instrument. Amplification was performed according to the table below. The collected data were analyzed using statistical software such as Excel or SPSS, and the results were calculated. -△△ct The values ​​and their statistical indicators, such as mean and standard deviation, are shown in Table 3. PCR reaction conditions are also shown in Table 3.

[0058] Table 3 PCR reaction conditions

[0059] (3) Test results Test results as follows Figure 9As shown in the figure, it can be seen that 0.1-2% (v / v) of elderberry water extract can significantly increase the expression of barrier factor-related factors in HaCaT cells, and this increase is dose-dependent.

[0060] 5. Antioxidant capacity test of the extract 5.1 Determination of DPPH free radical scavenging rate DPPH ethanol solution is purple-red and has a maximum absorption wavelength at 519 nm. When a free radical scavenger is added, DPPH free radicals are eliminated, the solution gradually becomes lighter in color, and the absorbance at 519 nm decreases accordingly. The lighter the solution color and the lower its absorbance value, the better the free radical scavenger is at eliminating DPPH free radicals.

[0061] The specific method is as follows: the analyte is diluted into multi-level concentration sample solutions using the sample solvent; a 96-well plate is used to set up experimental wells (T), experimental control wells (T0), DPPH model wells (C) and model control wells (C0). For each sample, three parallel wells are set up for each test concentration of the experimental wells (T), and three parallel wells are also set up for each DPPH model well (C). 100 μl of sample solution was added to each of the experimental wells (T) and the experimental control wells (T0). 100 μl of ultrapure water was added to each of the DPPH model wells (C) and the model control wells (C0). 100 μl of DPPH working solution (0.5 mmol / L) was added to each of the experimental wells (T) and the DPPH model wells (C). 100 μl of anhydrous ethanol was used instead of DPPH solution in the experimental control wells (T0) and the model control wells (C0). After incubating the 96-well plate at room temperature in the dark for 30 min, the absorbance was measured at 519 nm. The DPPH free radical scavenging rate of each group of analytes was calculated based on the absorbance values, using the following formula: ; In the formula: A 模 -DPPH model aperture absorbance; A 模对 - Absorbance value of the model control aperture; A 样 - Absorbance of the experimental well; A 样对 -Absorbance value of the control hole in the experiment.

[0062] 5.2 Determination of ABTS free radical scavenging rate ABTS reacts with potassium persulfate to form green ABTS+. Substances with antioxidant properties can scavenge ABTS+. ABTS+ has maximum absorption at 734 nm; by measuring the absorbance, the free radical scavenging ability of the reactant can be quantitatively determined. That is, the lower the absorbance value, the stronger the ability of the antioxidant to scavenge ABTS free radicals.

[0063] The specific method is as follows: the analyte is diluted into sample solutions of multiple concentrations using the sample solvent; experimental wells (T), experimental control wells (T0), ABTS model wells (C) and model control wells (C0) are set up using a 96-well plate. For each test concentration of each sample, experimental wells (T) need to be set up with 3 parallel wells, and ABTS model wells (C) also need to be set up with 3 parallel wells. Add 50 μl of sample solution of the same concentration to each of the experimental wells (T) and experimental control wells (T0), and add 50 μl of ultrapure water to each of the ABTS model wells (C) and model control wells (C0). Add 150 μl of ABTS working solution (7.4 mmol / L ABTS solution and 2.6 mmol / L K2S2O8 solution mixed at a 1:1 ratio, incubated for 12 h, and then diluted 20 times) to each of the experimental wells (T) and ABTS model wells (C), and replace the experimental control wells (T0) and model control wells (C0) with 150 μl of ultrapure water. After incubating the 96-well plate at room temperature for 6 min, measure the absorbance at 734 nm. Finally, calculate the ABTS radical scavenging rate of the analyte at different concentrations based on the absorbance values, using the following formula: ; In the formula: A 模 -ABTS model aperture absorbance; A 模对 - Absorbance value of the model control aperture; A 样 - Absorbance of the experimental well; A 样对 -Absorbance value of the control hole in the experiment.

[0064] 5.3 Test Results and Conclusions The test results are shown in Table 4. It can be seen from the table that the antioxidant effect of elderberry water extract is significantly better than that of elderberry alcohol extract and elderberry polysaccharide.

[0065] Table 4. Antioxidant effects of elderberry extract

[0066] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. An application of elderberry extract in the preparation of skincare products, characterized in that: The skincare product has at least one of the following effects: (1) It promotes sebum secretion; (2) The effect of barrier repair.

2. The application according to claim 1, characterized in that: The elderberry extract is an aqueous extract of elderberry.

3. The application according to claim 1, characterized in that: The concentration of the elderberry water extract used is 0.5-2% (v / v).

4. The application according to claim 1, characterized in that: The method for preparing the elderberry water extract includes the following steps: (1) Add elderberry powder to ultrapure water to obtain a mixture; (2) The mixture is heated and centrifuged, and the supernatant is filtered to obtain elderberry water extract.

5. The application according to claim 4, characterized in that: In step (1), the amount of elderberry powder added is 0.08-0.12 g / ml.

6. The application according to claim 4, characterized in that: In step (2), the heating temperature is 70-80℃ and the heating time is 0.5-1.5h.

7. The application according to claim 4, characterized in that: The preparation method further includes step (3): adjusting the concentration of elderberry water extract using ultrapure water.

8. The application according to claim 2, characterized in that: The elderberry water extract promotes sebum secretion by increasing the expression levels of sebum secretion-related factors PPARγ, SREBP-1c, FASN, and ACC.

9. The application according to claim 2, characterized in that: The elderberry water extract achieves its barrier repair effect by increasing the expression levels of barrier function-related factors FLG, LOXL2, and IVL.

Images