Use of dehydroergotoxine in the preparation of anti-gastric cancer drugs

Abstract

This invention discloses the application of dehydrocamellidine in the preparation of anti-gastric cancer drugs, belonging to the field of biomedical technology. This invention provides the application of dehydrocamellidine in the preparation of anti-gastric cancer drugs, wherein the dehydrocamellidine exerts its anti-gastric cancer effect by targeting and inhibiting the HSP90AA1 protein. The drug exerts its anti-gastric cancer effect through one or more of the following pathways: (a) inhibiting the proliferation of gastric cancer cells; (b) inhibiting the colony formation of gastric cancer cells; (c) inhibiting the invasion of gastric cancer cells; (d) inhibiting the migration of gastric cancer cells; and (e) inducing apoptosis of gastric cancer cells. This invention, for the first time, screened 25 candidate targets from a cross-set of 258 predicted drug targets, 13898 gastric cancer disease targets, and 958 pull-down experimental targets. Based on MCC score ranking and molecular binding energy screening, HSP90AA1 was identified as the key docking target with the highest ranking for the anti-gastric cancer effect of dehydrocamellidine. Molecular docking results showed that dehydrocamellidine had the lowest binding energy and the best binding strength with HSP90AA1.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of the natural product Harmine in the preparation of anti-gastric cancer drugs, and the discovery and application of HSP90AA1, a key drug target for the anti-gastric cancer effect of Harmine. This invention also relates to a method for screening personalized medications for gastric cancer patients based on this target. Background Technology

[0002] Gastric cancer is one of the most common malignant tumors worldwide, causing 769,000 deaths globally in 2020, ranking fourth in mortality rate. China is a high-incidence area for gastric cancer globally, accounting for approximately 40% of new cases annually, with an incidence rate of 25.41 per 100,000 and a mortality rate of 18.44 per 100,000. Treatment for gastric cancer mainly includes surgical resection, chemotherapy, molecular targeted therapy, and immunotherapy. However, early-stage gastric cancer lacks specific clinical signs, and most patients are already in the middle or late stages when they seek medical attention, resulting in limited treatment effectiveness. Traditional chemotherapy drugs have severe toxic side effects, while molecular targeted drugs and immunotherapies are expensive and have low response rates in some patients.

[0003] Finding highly active antitumor components with low toxicity from natural products is an important direction in antitumor drug development. *Peganum harmala* L., belonging to the genus *Peganum* in the family Zygophyllaceae, is mainly distributed in Inner Mongolia, Xinjiang, Gansu, and other northwestern regions of my country. Harmine (HM), a β-carboline alkaloid extracted from *Peganum harmala*, has a content as high as 3.2% and possesses various pharmacological activities, including anti-inflammatory, neuroprotective, antidiabetic, and antitumor effects.

[0004] In existing technologies, dehydrocamellia alkaloids have been reported to have inhibitory effects on gastric cancer cells (Zhang H et al., 2014; Tan B et al., 2020). However, current research mainly focuses on differentially expressed mRNA or protein changes in cells or tissues after drug action, and there are no reports on studies directly targeting the anti-gastric cancer effect of dehydrocamellia alkaloids. The specific molecular targets of dehydrocamellia alkaloids' anti-gastric cancer effect have not been identified in existing technologies, limiting the precise application of the drug and subsequent structural optimization. Current research is limited to phenotypic observation and differential expression analysis, without employing chemical biological target confirmation techniques to verify the direct interaction between the drug and the target. Furthermore, there is a lack of personalized medication guidance and a lack of patient screening methods based on target expression levels, hindering the realization of precision medicine.

[0005] The information disclosed above in this background section is only for enhancing the understanding of the background section of this invention, and therefore may include prior art that is not known to those skilled in the art. Summary of the Invention

[0006] This invention addresses the shortcomings of existing technologies by providing the application of dehydrocamellia alkaloids in the preparation of anti-gastric cancer drugs and their drug targets. This invention reveals for the first time that the key docking target of dehydrocamellia alkaloids in the anti-gastric cancer effect is heat shock protein 90α (HSP90AA1), and verifies the direct binding of dehydrocamellia alkaloids to HSP90AA1 and its biological functions through various technical means. Simultaneously, a personalized drug screening method for gastric cancer patients based on HSP90AA1 expression levels is established.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides the use of dehydrocamellia alkaloid in the preparation of an anti-gastric cancer drug, wherein the dehydrocamellia alkaloid exerts its anti-gastric cancer effect by targeting and inhibiting the HSP90AA1 protein.

[0009] Preferably, the drug exerts its anti-gastric cancer effect through one or more of the following pathways:

[0010] (a) Inhibits the proliferation of gastric cancer cells;

[0011] (b) Inhibits the clonal formation of gastric cancer cells;

[0012] (c) Inhibits the invasion of gastric cancer cells;

[0013] (d) Inhibits the migration of gastric cancer cells;

[0014] (e) Induces apoptosis in gastric cancer cells.

[0015] Preferably, the gastric cancer cells are human gastric cancer AGS cells or mouse gastric cancer MFC cells.

[0016] Secondly, the present invention provides a method for screening gastric cancer patients suitable for treatment with dehydrocamellia alkaloids, comprising the following steps:

[0017] (1) Obtain tumor tissue samples from gastric cancer patients;

[0018] (2) Detect the expression level of HSP90AA1 protein in the sample;

[0019] (3) Patients whose HSP90AA1 expression level is higher than the preset threshold are identified as suitable for dehydrocamellia oleracea treatment.

[0020] Preferably, the method for detecting the HSP90AA1 protein expression level includes one or more of immunohistochemical staining, Western blot, and enzyme-linked immunosorbent assay.

[0021] Preferably, the preset threshold is an immunohistochemical H-score score ≥ 4.

[0022] Thirdly, the present invention provides an anti-gastric cancer pharmaceutical composition, characterized in that it comprises an effective amount of dehydrocamellidine or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.

[0023] Preferably, the dosage form of the pharmaceutical composition is an injection, an oral formulation, or a targeted delivery system.

[0024] Preferably, the targeted delivery system is a nanomicelle drug delivery system or an antibody-drug conjugate.

[0025] Fourthly, the present invention provides the application of dehydrocamellia alkaloid in the preparation of HSP90AA1 inhibitors.

[0026] Fifthly, the present invention provides a method for screening anti-gastric cancer drugs, using the binding ability of the test compound to the HSP90AA1 protein as an indicator to screen compounds that can bind to HSP90AA1 and inhibit its activity.

[0027] Preferably, the binding ability of the test compound to the HSP90AA1 protein is detected by micro-thermophoresis or surface plasmon resonance.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] 1. This invention, through pull-down experiments combined with 4D-Labelfree mass spectrometry identification, network pharmacology analysis, and molecular docking technology, for the first time screened 25 candidate targets from a cross-set of 258 predicted drug targets, 13,898 gastric cancer disease targets, and 958 pull-down experimental targets. Based on MCC score ranking and molecular binding energy screening, HSP90AA1 was identified as the key docking target with the highest-ranking anti-gastric cancer activity of dehydrocamellia. Molecular docking results showed that dehydrocamellia had the lowest binding energy and the best binding strength with HSP90AA1.

[0030] 2. This invention is the first to independently verify the direct binding of dehydrocamelin to HSP90AA1 protein using two methods: micro-thermophoresis (MST) and surface plasmon resonance (SPR). The affinity Kd values ​​were 10.3 µM and 144.8 µM, respectively, both of which are considered to be of medium strength, thus confirming the drug-target interaction from a biophysical perspective.

[0031] 3. This invention verified the effect of dehydrocamellia alkaloid on HSP90AA1 expression using both Western blot and qPCR at the protein and gene levels. It found that dehydrocamellia alkaloid downregulated the mRNA and protein expression levels of HSP90AA1 in human gastric cancer AGS cells in a concentration-dependent manner. Further functional verification was performed using two strategies: HSP90AA1 protein inhibitor and shRNA gene knockdown. This confirmed that knockdown or inhibition of HSP90AA1 significantly weakened the inhibitory effect of dehydrocamellia alkaloid on the proliferation, invasion, and migration of gastric cancer cells, demonstrating that HSP90AA1 is a key target mediating the anti-gastric cancer effect of dehydrocamellia alkaloid.

[0032] 4. This invention is the first to study the expression differences of HSP90AA1 in gastric cancer tissues of different pathological types. It found that HSP90AA1 was most highly expressed in well-differentiated tubular adenocarcinoma and least expressed in poorly differentiated tubular adenocarcinoma, and there were significant differences among individual patients. Based on this, this invention provides a method for screening suitable patients for dehydrocamellia alkaloid treatment by detecting the expression level of HSP90AA1 in gastric cancer patient tissues, thus realizing precision treatment with traditional Chinese medicine. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this invention. For those skilled in the art, other drawings can be obtained based on these drawings.

[0034] Figure 1 Effects of dehydrocamellia alkaloids on the growth of various gastric cancer cells; A. Inhibition rate of dehydrocamellia alkaloids on GES-1, MKN-28, MKN-45, AGS, and MFC cells; B. IC50 of dehydrocamellia alkaloids on GES-1, MKN-28, MKN-45, AGS, and MFC cells; *P <0.05, ***P <0.001, ****P <0.0001;

[0035] Figure 2 Results of experiments on the inhibition of colony formation in AGS and MFC cells by dehydrocamellia alkaloids; A. Colony formation rate of AGS cells after treatment with dehydrocamellia alkaloids; B. Colony formation rate of MFC cells after treatment with dehydrocamellia alkaloids; *P <0.05, **P <0.01, ****P <0.0001;

[0036] Figure 3 Results of experiments on the inhibition of AGS and MFC cell invasion by dehydrocamellia alkaloid (Transwell); *P <0.05, **P<0.01, ****P <0.0001;

[0037] Figure 4 Results of the experiment on the inhibition of AGS and MFC cell migration by dehydrocamellia (scratch healing); A. Effect of dehydrocamellia on the scratch healing ability of AGS cells; B. Effect of dehydrocamellia on the scratch healing ability of MFC cells. *P <0.05, ***P <0.001, ****P <0.0001;

[0038] Figure 5 Flow cytometry results of apoptosis in AGS and MFC cells induced by dehydrocamellia oleifera; A. Apoptosis in AGS cells before and after treatment with dehydrocamellia oleifera; B. Apoptosis in MFC cells before and after treatment with dehydrocamellia oleifera. **P < 0.01, ****P < 0.0001;

[0039] Figure 6 The in vivo tumor-inhibiting effect of dehydrocamellidine on tumor-bearing mice; A. Tumor growth curve in nude mice; B. Effect of dehydrocamellidine on tumor weight in nude mice; C. Tumor growth curve in 615 mice; D. Effect of dehydrocamellidine on tumor weight in 615 mice.

[0040] Figure 7 Flowchart and Venn diagram of target screening for the anti-gastric cancer effect of dehydrocamelin;

[0041] Figure 8 : Three-dimensional structure diagram of dehydrocamellidine docking with HSP90AA1 molecule; A. 3D binding conformation diagram (spherical structure diagram); B. 3D binding conformation diagram (crystal structure diagram); C. Schematic diagram of hydrogen bonding at active site;

[0042] Figure 9 Western blot analysis of the effect of dehydrocamellia alkaloid on HSP90AA1 protein expression in AGS cells; A. Western blot analysis of HSP90AA1 expression in GES-1 cells; B. Western blot analysis of HSP90AA1 expression in AGS cells; C. Western blot analysis of HSP90AA1 expression in MFC cells; *P <0.05;

[0043] Figure 10 Effect of dehydrocamellia alkaloid on HSP90AA1 gene expression in AGS cells by qPCR; A. qPCR detection of HSP90AA1 gene expression level in GES-1 cells; B. qPCR detection of HSP90AA1 gene expression level in AGS cells; C. qPCR detection of HSP90AA1 gene expression level in MFC cells; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0044] Figure 11MST method was used to determine the binding affinity of dehydrocamelin to HSP90AA1 protein;

[0045] Figure 12 The binding affinity of dehydrocamelin to HSP90AA1 protein was determined by the SPR method.

[0046] Figure 13 Effects of HSP90AA1 inhibitor intervention on the proliferation capacity of AGS cells;

[0047] Figure 14 Effects of HSP90AA1 inhibitor intervention on the invasive ability of AGS cells;

[0048] Figure 15 Effects of HSP90AA1 inhibitor intervention on the migration ability of AGS cells;

[0049] Figure 16 Effect of dehydrocamelin on the proliferation of AGS cells after shRNA knockdown of HSP90AA1;

[0050] Figure 17 Effects of shRNA knockdown of HSP90AA1 on the invasive ability of AGS cells;

[0051] Figure 18 Effect of dehydrocamelin on AGS cell migration ability after HSP90AA1 knockdown by shRNA;

[0052] Figure 19 Immunohistochemical staining results of HSP90AA1 in gastric cancer tissue and adjacent normal tissue; A. Expression of HSP90AA1 in cancer tissue; B. Expression of HSP90AA1 in adjacent normal tissue;

[0053] Figure 20 Statistical graph showing the difference in expression of HSP90AA1 in gastric cancer tissues of different pathological types. Detailed Implementation

[0054] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0055] Example 1: In vitro anti-gastric cancer efficacy experiment of dehydrocamelin

[0056] 1.1 Cell Culture

[0057] Normal human gastric mucosal cells GES-1, human gastric cancer cells AGS, MKN-28, MKN-45, and mouse gastric cancer cells MFC were all cultured in RPMI-1640 medium with 10% fetal bovine serum in a 5% CO2 incubator at 37°C.

[0058] 1.2 CCK-8 assay for cell viability

[0059] Logarithmic growth phase gastric cancer cells were seeded at 5000 cells / well in 96-well plates and cultured for 24 h. Then, different concentrations (0, 10, 15, 20, 30, 40, 60, 80, 120 µM) of dehydrocamellia alkaloid were added to each well for 48 h. Each well was then incubated at 37°C in the dark for 2 h. The absorbance at 450 nm was measured using a microplate reader, and the cell inhibition rate and IC50 value were calculated.

[0060] The results showed that dehydrocamelin exhibited concentration-dependent inhibitory effects on all gastric cancer cell lines, with the strongest inhibitory effect on AGS cells, and an IC50 of 22.0 µM. Figure 1 ).

[0061] 1.3 Cloning Experiment

[0062] AGS and MFC cells were seeded at 1000 cells / well in 6-well plates. After adhesion, the cells were treated with low (1 / 2 IC50), medium (1×IC50), and high (2×IC50) concentrations of dehydrocamellia alkaloid for 48 h, respectively. The culture medium was then replaced with normal medium and cultured until visible clones appeared. The cells were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and the number of clones was counted.

[0063] The results showed that dehydrocamellia alkaloids inhibited the colony-forming ability of AGS and MFC cells in a concentration-dependent manner. Figure 2 ).

[0064] 1.4 Transwell Invasion Experiment

[0065] Cells treated with the drug for 48 hours showed a growth rate of 2.5 × 10⁻⁶. 5 Cells were seeded at a density of 100 cells / mL in the upper chamber of a Transwell substrate coated with matrix gel, and the lower chamber was filled with complete culture medium containing 10% serum. After 48 hours of culture, the cells were fixed, stained, and the number of cells that crossed the membrane was counted.

[0066] The results showed that dehydrocamellia alkaloids inhibited the invasive ability of AGS and MFC cells in a concentration-dependent manner. Figure 3 ).

[0067] 1.5 Scratch Healing Experiment

[0068] Cells at 5 × 10 5Each well was seeded with 100 cells / well. When the cells reached more than 90% confluence, they were scratched with a 200 µL pipette tip, washed with PBS, and then added to low serum medium containing different concentrations of dehydrocamelin. Photos were taken at 0h, 24h, and 48h, and the scratch healing rate was calculated.

[0069] The results showed that dehydrocamellia alkaloids inhibited the migration ability of AGS and MFC cells in a concentration- and time-dependent manner. Figure 4 ).

[0070] 1.6 Apoptosis Detection

[0071] Cells treated with the drug for 48 hours were double-stained with Annexin V-FITC / PI, and the apoptosis rate was detected by flow cytometry.

[0072] The results showed that dehydrocamellidine induced apoptosis in AGS and MFC cells in a concentration-dependent manner. Figure 5 ).

[0073] Example 2: In vivo anti-gastric cancer efficacy experiment of dehydrocamelin

[0074] 2.1 Acute toxicity test

[0075] The LD50 of dehydrocamelin administered via tail vein injection to Kunming mice and C57BL / 6 mice was determined using a modified Koch method, and the LD50 of dehydrocamelin administered via tail vein injection to nude mice and 615 mice was determined using a sequential method.

[0076] The results showed that the LD50 of Kunming mice was 47.9999 mg / kg (95% CI: 30.3577~58.5356 mg / kg), the LD50 of C57BL / 6 mice was 70.6968 mg / kg (95% CI: 57.4381~87.0161 mg / kg), and the LD50 of nude mice and 615 mice was 57.5400 mg / kg.

[0077] 2.2 Establishment of tumor-bearing mouse model and evaluation of drug efficacy

[0078] MFC cells (1×10) 6 Tumor-bearing models were established by subcutaneously injecting 200 µL of dehydrocamellidine into the right axilla of nude mice and 615 mice. Once the tumors were palpable, the treatment group received daily intravenous injections of 28.77 mg / kg of dehydrocamellidine via the tail vein, while the control group received an equal volume of saline. Administration continued until the maximum tumor length reached 2 cm. The tumor length (a) and short diameter (b) were measured, and the tumor volume TV = a × b² / 2 was calculated. Tumor growth curves were plotted, and the tumor inhibition rate was calculated.

[0079] The results showed that dehydrocamellia alkaloids inhibited the tumor growth of nude mice bearing MFC tumors by 63.38% and the tumor growth of 615 MFC tumor-bearing mice by 60.98%. Figure 6 HE staining showed no obvious pathological damage in any organ in the treatment group, and biochemical tests showed that the treatment dose had no significant effect on liver and kidney function and myocardial enzyme levels.

[0080] Example 3: Screening and Identification of Targets for the Anti-Gastric Cancer Effect of Dehydrocamelin

[0081] 3.1 Synthesis of Biotin-Labeled Dehydrocamelin

[0082] Dehydrocamellidine was reacted with N-Boc-bromoethylamine, and after deprotection, it was condensed with biotin to obtain a biotin-labeled dehydrocamellidine complex, the structure of which was confirmed by ¹H NMR, ¹³C NMR and ESI-MS.

[0083] 3.2 Pulldown Experiment

[0084] Biotin-labeled dehydrocamelin was incubated with lysates of human gastric cancer AGS and MKN-45 cells. The drug-protein complex was then pulled down using streptavidin magnetic beads, separated by SDS-PAGE, and identified by 4D-Labelfree mass spectrometry. A total of 958 dehydrocamelin-plutonium-plutonium-plutonium targets were identified.

[0085] 3.3 Network Pharmacological Analysis

[0086] 276 predicted targets of dehydrocamellia were obtained from the SwissTargetPrediction and PharmMapper databases, and 13,898 gastric cancer disease targets were obtained from the GeneCards database. The intersection of the predicted drug targets, disease targets, and pulldown targets yielded 25 candidate anti-gastric cancer targets for dehydrocamellia. Figure 7 ).

[0087] 3.4 PPI Network Construction and Core Target Screening

[0088] Twenty-five candidate targets were imported into the STRING database to construct a PPI network. Using the CytoHubba plugin in Cytoscape software, the top 10 core targets were selected based on MCC scores: HSP90AA1, HSP90AB1, GSR, CDC42, GRB2, GSTP1, CDK2, ALDH2, PRKACA, and GSTM1. HSP90AA1 ranked first.

[0089] Example 4: Molecular docking verification of the binding of dehydrocamelin to the core target.

[0090] Crystal structures of 10 core targets were downloaded from the PDB database. Preprocessing, including hydrogenation and charge addition, was performed using AutoDock Tools. The 3D structure of dehydrogenated camellia alkaloids was optimized using Chem3D. Molecular docking was performed using AutoDock Vina, and the results were visualized using PyMol.

[0091] The results showed that dehydrocamelin had a strong binding ability with all 10 core targets, with binding energies all < -10 KJ / mol. Among them, the binding energy with HSP90AA1 was the lowest and the number of hydrogen bonds was the highest. Figure 8 The results indicate that HSP90AA1 is the most critical docking target for dehydrocamellia alkaloids.

[0092] Example 5: Effect of dehydrocamelin on HSP90AA1 expression

[0093] 5.1 Western blot detection

[0094] GES-1, AGS, and MFC cells were treated with low, medium, and high concentrations of dehydrocamellia alkaloid for 48 h, respectively. Total protein was extracted by RIPA lysis, followed by SDS-PAGE electrophoresis, membrane transfer, HSP90AA1 antibody incubation, and ECL imaging.

[0095] The results showed that dehydrocamellia alkaloids had no significant effect on HSP90AA1 protein expression in GES-1 cells; HSP90AA1 protein expression in AGS cells decreased significantly with increasing drug concentration (P<0.05); and HSP90AA1 protein expression in MFC cells showed no significant change. Figure 9 ).

[0096] 5.2 qPCR detection

[0097] Total RNA was extracted using the Trizol method, reverse transcribed into cDNA, and real-time quantitative PCR was performed using the SYBR Green method to detect the expression level of HSP90AA1 mRNA.

[0098] The results showed that dehydrocamellia alkaloid had no significant effect on HSP90AA1 mRNA expression in GES-1 cells; HSP90AA1 mRNA expression in AGS cells decreased significantly with increasing drug concentration (P<0.001); and HSP90AA1 mRNA expression in MFC cells increased significantly with increasing drug concentration (P<0.0001). Figure 10 ).

[0099] Example 6: MST and SPR assays to determine the binding affinity of dehydrocamelin to HSP90AA1

[0100] 6.1 MST Experiment

[0101] HSP90AA1 protein was fluorescently labeled according to the instructions of the RED-tris-NTA protein labeling kit. Dehydrocamellia alkaloid was used for 2-fold serial dilution (500 µM to 0.0305 µM), mixed with a fixed concentration of labeled protein, loaded into capillary tubes, and detected by an MST-NT.115 instrument.

[0102] The results showed that dehydrocamelin specifically bound to HSP90AA1, with an affinity Kd value of 10.3 µM, which is considered a moderate binding strength. Figure 11 ).

[0103] 6.2 SPR Experiment

[0104] The HSP90AA1 protein was coupled to a CM5 chip, and after being serially diluted with dehydrocamellia alkali, it flowed through the chip surface. The binding-dissociation curve was detected by Biacore equipment, and the affinity was calculated by steady-state analysis.

[0105] The results showed that the affinity Kd value between dehydrocamelin and HSP90AA1 was 144.8 µM, which is considered a moderate binding strength. Figure 12 ).

[0106] Example 7: Validation of target function of HSP90AA1 inhibitor

[0107] 7.1 Screening of HSP90AA1 inhibitor concentrations

[0108] AGS cells were treated with different concentrations (0.5-64 nM) of HSP90AA1 inhibitor for 24 h and 48 h, and cell viability was detected by CCK-8 assay to calculate IC50.

[0109] The results showed that the IC50 values ​​of the HSP90AA1 inhibitor against AGS cells at 24h and 48h were 100 nM and 18.06 nM, respectively.

[0110] 7.2 Evaluation of efficacy after inhibitor intervention

[0111] The study included a control group, an HM group, an HSP90AA1 inhibitor group, and an HSP90AA1 inhibitor + HM group, which were subjected to colony formation, Transwell invasion, and scratch healing experiments, respectively.

[0112] The results showed that after intervention with HSP90AA1 inhibitors, the inhibitory effects of dehydrocamellia alkaloids on the proliferation, invasion, and migration of AGS cells were significantly weakened (P<0.01). Figures 13-15 This demonstrates that HSP90AA1 is an important target for the function of dehydrocamellidine.

[0113] Example 8: shRNA knockdown of HSP90AA1 to verify target function

[0114] 8.1 Construction of stable cell lines by lentiviral infection

[0115] Three HSP90AA1 shRNA target sequences and a negative control sequence were designed. A lentiviral vectors were constructed, infecting AGS cells. Stable transfected cells were screened with puromycin, and Western blotting was used to verify the knockdown efficiency.

[0116] Target sequence:

[0117] HSP90AA1-shRNA-1:GTTATCCTACACCTGAAAGAA

[0118] HSP90AA1-shRNA-2: TATGGCATGACAACTACTTTA

[0119] HSP90AA1-shRNA-3:TACTTGGAGGAACGAAGAATA

[0120] shRNA NC: CAACAAGATGAAGAGCACCAA

[0121] The results showed that Western blot analysis indicated that shRNA-2 knockdown was the most efficient method. Figures 16-18 ), for use in subsequent experiments.

[0122] 8.2 Evaluation of efficacy after knockdown

[0123] The AGS group, sh-Ctrl group, and sh-HSP90AA1 group were set up, and CCK-8, colony formation, Transwell invasion, and scratch healing experiments were performed to observe the effects of dehydrocamelin on the cells of each group.

[0124] The results are as follows:

[0125] CCK-8: The survival rate of dehydrocamellia alkaloids against sh-HSP90AA1 cells was 55.27%, which was significantly higher than that of AGS group (42.40%) and sh-Ctrl group (41.81%) (P<0.0001).

[0126] Colony formation: The colony formation ability of the sh-HSP90AA1 group was significantly enhanced after drug treatment compared with the AGS group and the sh-Ctrl group (P<0.05).

[0127] Invasion assay: The cell invasion ability of the sh-HSP90AA1 group did not change significantly after drug treatment, while that of the AGS group and sh-Ctrl group was significantly weakened (P<0.0001).

[0128] Migration assay: The cell migration ability of the sh-HSP90AA1 group showed no significant change after drug treatment (P>0.05), while that of the AGS group and the sh-Ctrl group was significantly reduced (P<0.0001).

[0129] The above results indicate that knocking down HSP90AA1 significantly weakens the inhibitory effect of dehydrocamellia on the proliferation, invasion, and migration of gastric cancer cells, confirming that HSP90AA1 is a key target for the anti-gastric cancer effect of dehydrocamellia.

[0130] Example 9: Expression of HSP90AA1 in gastric cancer tissues and its clinicopathological relationship

[0131] 9.1 Patient Sample Collection

[0132] Surgical specimens were collected from 30 patients with gastric cancer (6 cases each of well-differentiated tubular adenocarcinoma, moderately differentiated tubular adenocarcinoma, poorly differentiated tubular adenocarcinoma, mucinous adenocarcinoma, and signet ring cell carcinoma). The patients were aged 50-70 years and had not received neoadjuvant chemotherapy or radiotherapy.

[0133] 9.2 Immunohistochemical staining

[0134] Paraffin sections were dewaxed and hydrated, subjected to antigen retrieval with citrate buffer, incubated overnight at 4°C with HSP90AA1 antibody (1:200), incubated with HRP-labeled secondary antibody at room temperature, developed with DAB, and counterstained with hematoxylin. Quantitative analysis was performed using the H-score scoring system (staining intensity × staining area, <4 points for low expression, ≥4 points for high expression).

[0135] The results are as follows:

[0136] HSP90AA1 was highly expressed in gastric cancer tissues (82%), significantly higher than in adjacent normal tissues (13%) (P<0.001). Figure 19 );

[0137] HSP90AA1 expression levels were closely related to pathological type and differentiation degree, with the highest expression in well-differentiated tubular adenocarcinoma, significantly higher than that in moderately and poorly differentiated tubular adenocarcinoma (P<0.01); signet ring cell carcinoma showed higher expression than poorly differentiated tubular adenocarcinoma (P<0.05). Figure 20 ).

[0138] Example 10: Pharmaceutical composition formulation

[0139] 10.1 Preparation of Lyophilized Dehydrocamelamine Powder for Injection

[0140] Prescription: 10 g of dehydrocamelin, 50 g of mannitol, appropriate amount of phosphate buffer (pH 6.0), and water for injection to 1000 mL.

[0141] Preparation method: Dissolve dehydrocamelin in an appropriate amount of water for injection, add mannitol and stir to dissolve, adjust the pH to 6.0 with phosphate buffer, add water for injection to the total volume, filter sterilize with a 0.22 µm filter membrane, dispense into vials, freeze dry, and seal with capping.

[0142] 10.2 Preparation of dehydrocamellia alkaloid nanomicelle formulation

[0143] Dehydrocamelin and amphiphilic block copolymer (such as PEG-PLA) were dissolved in an organic solvent at a weight ratio of 1:10, and a polymer film was formed by rotary evaporation. After hydration, the film was ultrasonically dispersed to obtain drug-loaded nanomicelles with a particle size of 50-200 nm.

[0144] This formulation can improve the water solubility and tumor targeting of dehydrocamelin, and reduce toxic side effects.

[0145] The foregoing has only described certain exemplary embodiments of the present invention by way of illustration. Undoubtedly, those skilled in the art can modify the described embodiments in various ways without departing from the spirit and scope of the present invention. Therefore, the foregoing drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. The application of dehydrocamelin in the preparation of anti-gastric cancer drugs, characterized in that... The dehydrocamelin exerts its anti-gastric cancer effect by targeting and inhibiting the HSP90AA1 protein; the drug exerts its anti-gastric cancer effect through one or more of the following pathways: (a) Inhibits the proliferation of gastric cancer cells; (b) Inhibits the clonal formation of gastric cancer cells; (c) Inhibits the invasion of gastric cancer cells; (d) Inhibits the migration of gastric cancer cells; (e) Inducing apoptosis in gastric cancer cells; The gastric cancer cells are human gastric cancer AGS cells or mouse gastric cancer MFC cells.

2. A method for screening gastric cancer patients suitable for treatment with dehydrocamellia alkaloid, characterized in that, Includes the following steps: (1) Obtain tumor tissue samples from gastric cancer patients; (2) Detect the expression level of HSP90AA1 protein in the sample; (3) Patients whose HSP90AA1 expression level is higher than the preset threshold are identified as suitable for dehydrocamellia oleracea treatment.

3. The method according to claim 2, characterized in that, The methods for detecting HSP90AA1 protein expression levels include one or more of immunohistochemical staining, Western blot, and enzyme-linked immunosorbent assay.

4. The method according to claim 2, characterized in that, The preset threshold is an immunohistochemical H-score score ≥ 4.

5. An anti-gastric cancer drug composition, characterized in that, It contains an effective amount of dehydrocamelin or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.

6. The pharmaceutical composition according to claim 5, characterized in that, The dosage form of the pharmaceutical composition is an injection, an oral formulation, or a targeted delivery system.

7. The pharmaceutical composition according to claim 6, characterized in that, The targeted delivery system is a nanomicelle drug delivery system or an antibody-drug conjugate.

8. Application of dehydrocamellia alkaloid in the preparation of HSP90AA1 inhibitors.

9. A method for screening anti-gastric cancer drugs, characterized in that, Using the binding ability of the test compound to the HSP90AA1 protein as an indicator, compounds that can bind to HSP90AA1 and inhibit its activity are screened.

10. The method according to claim 9, characterized in that, The binding ability of the test compound to the HSP90AA1 protein was detected by micro-thermophoresis or surface plasmon resonance.

Images