Use of a quinazoline compound in the preparation of a medicament for the treatment of acute lung injury

Abstract

The application belongs to the technical field of medicine, and particularly relates to application of a quinazoline compound in preparation of a drug for treating acute lung injury. In LPS-induced RAW 264.7 cells, the compound 24 significantly reduces the levels of inflammatory mediators, including TNF-alpha, IL-6, IL-1beta, NO and ROS. In LPS-induced ALI mice, the compound 24 significantly reduces the release of inflammatory factors in the lung, the infiltration of inflammatory cells and histopathological damage. The compound 24 plays an anti-inflammatory role by targeting DYRK1A and inhibiting the TLR4 / NF-kappa B signaling pathway. In summary, the compound 24 has good anti-inflammatory effect and has potential value for further development as an ALI treatment drug.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the application of a quinazoline compound in the preparation of a drug for treating acute lung injury. Background Technology

[0002] Acute lung injury (ALI) and its more severe form, acute respiratory distress syndrome (ARDS), are highly fatal conditions typically caused by pneumonia, non-pulmonary infections, aspiration of gastric contents, trauma, pancreatitis, burns, inhalation injury, drug overdose, multiple transfusions, or shock. Key mechanisms include disruption of the endothelial and epithelial barriers, neutrophil inflammation, release of pro-inflammatory factors, formation of extracellular traps for neutrophils, and coagulation dysregulation. ALI / ARDS primarily relies on supportive therapy, and modulating the inflammatory response is considered beneficial in ALI treatment. Glucocorticoids have potent anti-inflammatory effects and play a positive role in the treatment of ALI / ARDS, but their side effects should not be ignored.

[0003] Dual-specificity tyrosine phosphorylation-regulated kinase 1A (DYRK1A) is a serine / threonine kinase and a key regulator of various cellular and pathological processes. Its biological functions encompass neurogenesis, cell cycle control, DNA damage repair, and pancreatic β-cell function. Dysregulation of DYRK1A is associated with a variety of diseases, including Down syndrome, Alzheimer's disease, cancer, and inflammatory disorders. Increasing evidence suggests that DYRK1A is a key regulator of inflammatory signaling, making it a promising therapeutic target for inflammatory diseases. Preclinical studies of drug-targeted therapies against DYRK1A have shown promising results in the treatment of inflammatory diseases, raising the possibility of its application in the treatment of ALI (Alternative Inflammatory Disease).

[0004] Therefore, this invention provides the application of DYRK1A inhibitor quinazoline compounds in the preparation of anti-ALI drugs. Summary of the Invention

[0005] Purpose of the invention: This invention proposes the application of quinazoline compounds in the preparation of drugs for treating acute lung injury, aiming to address the technical problems of poor targeted binding stability and low inhibitory activity of existing drugs.

[0006] Technical solution This invention proposes the application of quinazoline compounds in the preparation of drugs for treating acute lung injury, wherein the structure of the quinazoline compound is as follows: .

[0007] Furthermore, the quinazoline compounds are used in the preparation of drugs for treating acute lung injury by inhibiting the DYRK1A / TLR4 / NF-κB signaling pathway in cells.

[0008] Furthermore, the quinazoline compounds are used in the preparation of drugs for treating acute lung injury by inhibiting the gene transcription of TNF-α, IL-6, and IL-1β in a concentration-dependent manner.

[0009] Furthermore, the quinazoline compounds are used in the preparation of drugs for treating acute lung injury by inhibiting the decrease in the activity of antioxidant enzymes GSH and SOD.

[0010] Furthermore, the quinazoline compounds can be used in the preparation of drugs for treating acute lung injury by reducing ROS levels.

[0011] Furthermore, the quinazoline compounds can be used in the preparation of drugs for treating acute lung injury by targeting and binding to DYRK1A.

[0012] Furthermore, the targeted binding is as follows: the quinazoline compound forms hydrogen bonds with the glutamic acid residue Glu239 and the leucine residue Leu241 at the hinge site of DYRK1A, and forms strong hydrogen bonds with the lysine residues Lys188 and Lys167 in the active site cavity.

[0013] Furthermore, the quinazoline compounds are used in the preparation of drugs for treating acute lung injury by reducing the percentage of neutrophils.

[0014] Beneficial effects This invention proposes the application of a quinazoline compound in the preparation of a drug for treating acute lung injury (ALI). In LPS-induced RAW 264.7 cells, quinazoline compound 24 significantly reduced the levels of inflammatory mediators, including TNF-α, IL-6, IL-1β, NO, and ROS. Compound 24 inhibited the upregulation of NO release induced by LPS through the DYRK1A / TLR4 / NF-κB signaling pathway, concentration-dependently inhibited the transcription of TNF-α, IL-6, and IL-1β genes induced by LPS, suppressed the decreased activity of antioxidant enzymes GSH and SOD, reduced ROS levels, targeted the binding of DYRK1A (docking fraction: -13.375), and reduced the percentage of neutrophils, thereby alleviating the release of inflammatory factors, the infiltration of inflammatory cells, and histopathological damage in the lungs. In summary, compound 24 exhibits good anti-inflammatory effects and has the potential value for further development as a therapeutic agent for ALI. Attached Figure Description

[0015] Figure 1 IC50 values ​​of quinazoline derivatives were determined to measure the IC50 values ​​of quinazoline derivatives on LPS-induced release of NO (A) and TNF-α (B) from RAW 264.7 cells. Figure 2 The image shows compound 24, an inhibitor of DYRK1A, where (A) is the structural formula of compound 24 and (B) is a graph showing the cytotoxicity of compound 24 on RAW 264.7 cells. Figure 3 To illustrate the effect of compound 24 on LPS-induced inflammatory responses in RAW 264.7 cells, ELISA was used to detect the concentrations of TNF-α (A), IL-6 (B), IL-1β (C), and NO (D) in the supernatant of RAW 264.7 cells; RT-PCR was used to detect the relative mRNA expression levels of TNF-α (E), IL-6 (F), IL-1β (G), and iNOS (H) in RAW 264.7 cells. Figure 4 The effect of compound 24 on LPS-induced ROS generation in RAW 264.7 cells is shown in (A) flow cytometry analysis of the fluorescence histogram of cells after incubation with the DCFH-DA fluorescent probe, and (B) is the average fluorescence intensity. Figure 5 Figure 1 shows the results of molecular docking (A), CETSA (B, C), and WB (D) experiments for the interaction between compound 24 and the DYRK1A target. In Figure 1(A), compound 24 is represented in light blue rod form, key interacting residues are represented in yellow, and key hydrogen bonds are represented by green dashed lines. In the protein surface diagram, the dark blue area is composed of hydrophilic amino acids, while the yellow area is composed of hydrophobic amino acids. Figure 6 To investigate the effect of compound 24 on the activation of the TLR4 / NF-κB signaling pathway, Western blotting was used to detect the expression level of TLR4 in RAW 264.7 cells (A) and its statistical analysis graph (B), the expression and phosphorylation levels of NF-κB p65 and IκBα (C), and the statistical analysis graphs of NF-κB p65 (D) and IκBα (E). Figure 7 To investigate the effects of compound 24 on LPS-induced lung injury and inflammation in ALI mice, (A) HE staining of lung tissue (scale bar: 100 μm), ELISA was used to measure the release of TNF-α (B), IL-6 (C) and IL-1β (D) in lung tissue, RT-PCR was used to detect the transcriptional levels of TNF-α (E), IL-6 (F) and IL-1β (G) in lung tissue, and the levels of SOD (H) and GSH (I) in lung tissue; Figure 8The effect of compound 24 on the recruitment of LPS-induced inflammatory cells in the lungs of ALI mice, the immunohistochemical staining of MPO (A), Ly6G (B), and CD68 (C) in lung tissue (scale bar: top image 100 μm, bottom image 50 μm), and the statistical results of the density of MPO (D), Ly6G (E), and CD68 (F) positive cells. Figure 9 To investigate the effect of compound 24 on LPS-induced neutrophil infiltration in the BALF of ALI mice, the percentage of BALF neutrophils was detected by flow cytometry (A) and statistical analysis was performed (B).

[0016] In the image above, compared to the Control group, * indicates... p ≤ 0.05, ** indicates p ≤ 0.01, *** indicates p ≤0.001, **** indicates p ≤ 0.0001; compared to the LPS group, # indicates p ≤ 0.05, ## indicates p ≤ 0.01, ### indicates p ≤ 0.001, #### indicates p ≤ 0.0001. Detailed Implementation

[0017] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0018] Example 1 Preparation of quinazoline compound - compound 24 (1) Preparation of 2-((6-bromoquinazoline-4-yl)amino)-2-phenylethanol (A24) (nucleophilic substitution reaction): 6-bromo-4-chloroquinazoline (1.0 equivalent) was dissolved in isopropanol, followed by the addition of 2-amino-2-phenylethanol (1.2 equivalent), and the reaction was stirred at 85 °C for 6 h. After the reaction was complete, the solvent was removed by vacuum distillation. The concentrated product was purified by rapid silica gel column chromatography or recrystallized from ethyl acetate to give the corresponding intermediate compound A24. Yield 91%, yellow solid. 1 H NMR (400 MHz, DMSO-) d 6) δ 8.95 (d, J = 2.2 Hz, 1H), 8.71 (d, J = 7.6 Hz, 1H), 8.40(s, 1H), 7.89 (dd,J = 8.8, 2.1 Hz, 1H), 7.61 (d, J = 8.9 Hz, 1H), 7.48 –7.42 (m, 2H), 7.30 (t, J = 7.6 Hz, 2H), 7.24 – 7.18 (m, 1H), 5.47 (td, J =8.0, 4.9 Hz, 1H), 5.04 (s, 1H), 3.86 (dd, J = 11.3, 8.6 Hz, 1H), 3.75 (dd, J = 11.5, 5.2 Hz, 1H).

[0019] (2) Preparation method of intermediate B24 (Suzuki coupling reaction): Intermediate A24 (1.0 equivalent) and 3-(4,4,5,5-tetramethyl-1,3,2-dioxoboran-2-yl)-1-p-toluenesulfonyl-1 H -pyrrolo[2,3- b Pyridine (1.2 equivalents) was dissolved in a mixed solvent of dioxane and water (4:1, v / v), and Cs₂CO₃ (3.0 equivalents) and Pd(dppf)Cl₂ (5 mol%) were added sequentially. The reaction was carried out under N₂ protection at 95 °C with stirring for 12 h. After the reaction was complete, the solvent was removed by vacuum distillation. The concentrated product was purified by silica gel column chromatography to give the corresponding intermediate compound B24. Yield: 49%, yellow solid. 1 H NMR (400 MHz, DMSO- d 6) δ 8.81 (d, J = 1.9 Hz, 1H), 8.52 (d, J = 7.9Hz, 1H), 8.48 (dd, J = 4.8, 1.5 Hz, 1H), 8.42 (s, 1H), 8.42 – 8.38 (m, 1H), 8.37 (s, 1H), 8.16 (dd, J = 8.6, 1.9 Hz, 1H), 8.08 (d, J = 8.4 Hz, 2H), 7.79(d, J = 8.6 Hz, 1H), 7.51 – 7.47 (m, 2H), 7.44 (dd, J= 8.2, 3.5 Hz, 3H), 7.33 (t, J = 7.6 Hz, 2H), 7.26 – 7.21 (m, 1H), 5.60 (td, J = 8.0, 5.1 Hz, 1H), 5.08 (t, J = 5.8 Hz, 1H), 3.90 (ddd, J = 11.1, 8.4, 5.7 Hz, 1H), 3.81(dt, J = 11.1, 5.5 Hz, 1H), 2.35 (s, 3H).

[0020] (3) Preparation of target compound 24: Compound B24 (1.0 equivalent) was dissolved in a mixed solvent of dichloromethane and methanol (1:1, v / v), followed by the addition of sodium hydroxide (5.0 equivalent), and the reaction was stirred at 50°C for 2 h. After the reaction was completed, the solvent was removed by vacuum distillation, and the product was diluted with ethyl acetate and water. The organic layer was separated, washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The concentrated product was purified by silica gel column chromatography or recrystallized from methanol to obtain the target compound. The yield was 74%, and the product was a yellow solid, compound 24. 1 H NMR (400 MHz, DMSO- d 6) δ 12.10 (s, 1H), 8.74 (d, J = 1.9 Hz, 1H), 8.58 (d, J = 7.9 Hz, 1H), 8.44 (dd, J = 8.0,1.5 Hz, 1H), 8.41 (s, 1H), 8.33 (dd, J = 4.7, 1.5 Hz, 1H), 8.19 (dd, J = 8.7, 1.8 Hz, 1H), 8.05 (d, J = 2.6 Hz, 1H), 7.76 (d, J = 8.6 Hz, 1H), 7.48 (d, J =7.6 Hz, 2H), 7.33 (t, J = 7.5 Hz, 2H), 7.27 – 7.24 (m, 1H), 7.23 (dd, J =6.0, 3.1 Hz, 1H), 5.59 (td,J = 8.1, 5.1 Hz, 1H), 5.10 (s, 1H), 3.90 (t, J =10.4 Hz, 1H), 3.84 – 3.77 (m, 1H). 13 C NMR (100 MHz, DMSO- d 6) δ 159.74,154.41, 149.56, 147.15, 143.64, 141.49, 133.38, 132.35, 128.64 (2C), 128.33,127.90, 127.49 (2C), 127.36, 125.15, 119.65, 117.71, 116.71, 115.83, 114.33,65.05, 57.44. HRMS (ESI, m / z) for C 23 H 19 N5O [M + H] + : calcd, 382.1668; found, 382.1668. HPLC purity: 99.84%, t R = 2.068 min.

[0021] The structure of compound 24 is as follows: .

[0022] Example 2 Animal Experiment 2.1 Cell Culture and Treatment Mouse macrophage line RAW 264.7 cells were cultured in DMEM medium containing 10% serum at 37°C, 95% humidity, and 5% CO2. Cells were divided into five treatment groups: control group, lipopolysaccharide (LPS) group, LPS + dexamethasone (DEX) group (10 μM), LPS + high-dose compound 24 group (10 μM), LPS + medium-dose compound 24 group (5 μM), and LPS + low-dose compound 24 group (2.5 μM). Cells were pretreated with different concentrations of compound 24 or DEX for 1 hour, followed by stimulation with LPS (1 μg / mL) for 6 hours for subsequent analysis.

[0023] 2.2 Laboratory Animals and Statistical Analysis Methods Female C57BL / 6 mice (6-8 weeks old) were purchased from Beijing Huafukang Biotechnology Co., Ltd. Mice were housed under SPF conditions at a temperature of 23℃-25℃ and humidity of 40%-60%, with a 12-hour / 12-hour light-dark cycle. All animal experiments in this study were approved by the Ethics Committee of the Northern Theater Command General Hospital (Approval No.: Ethics Review No.

[2024] 052).

[0024] Data were statistically analyzed using GraphPad Prism software 9.0 and expressed as mean ± standard error (SEM) or mean ± standard deviation (SD). Student's t-test, one-way or two-way ANOVA were used. p A value < 0.05 is considered statistically significant.

[0025] 2.3 Establishment of the ALI model and administration method C57BL / 6 mice were randomly divided into six groups of eight mice each: control group, LPS group, LPS + DEX group (5 mg / kg), LPS + high-dose compound 24 group (50 mg / kg), LPS + medium-dose compound 24 group (25 mg / kg), and LPS + low-dose compound 24 group (12.5 mg / kg). Mice were anesthetized and infused with saline or LPS (5 mg / kg, 20 μL) intratracheally. One hour before LPS challenge, compound 24 or DEX was injected intraperitoneally, while control mice were injected with saline. Six hours after LPS challenge, mice were sacrificed, and bronchoalveolar lavage fluid (BALF) or lung tissue was collected for subsequent analysis. 2.4 Cell Viability Assay The MTT assay was used to detect the toxicity of 19 quinazoline derivatives and the positive control drug DEX to RAW 264.7 cells, and cell viability at a 10 μM drug concentration. To evaluate the in vitro anti-inflammatory activity of quinazoline derivatives, an LPS-induced RAW 264.7 cell inflammation model was first used to detect the levels of inflammatory factors in the cell supernatant for initial screening of single-concentration anti-inflammatory activity. The Griess assay was used to detect the NO level in the LPS-induced RAW 264.7 cell supernatant. Simultaneously, the TNF-α level in the LPS-induced RAW 264.7 cell supernatant was detected by ELISA. The results are shown in Table 1.

[0026] Table 1. Initial screening of in vitro anti-inflammatory activity of quinazoline compounds

[0027] The structural formulas of the 19 quinazoline derivatives in Table 1 are as follows: .

[0028] Table 1 shows that the cell viability of DEX and these 19 compounds were all above 70%, with low cytotoxicity, making them valuable for further activity screening. At a dosage concentration of 10 μM, LPS significantly induced an increase in NO levels in RAW 264.7 cells, while DEX significantly inhibited LPS-induced NO production, indicating the validity of the cellular inflammation model. Among the 19 quinazoline derivatives, compounds 6, 9, 13, 24, 25, 27, and 30 showed an inhibition rate greater than 50% in NO production in RAW 264.7 cells stimulated by LPS. At a dosage concentration of 5 μM, LPS significantly induced an increase in TNF-α levels in RAW 264.7 cells, while DEX significantly inhibited LPS-induced TNF-α production. Among the 19 quinazoline derivatives, compounds 2, 9, 10, 11, 18, 21, 24, and 27 showed an inhibition rate greater than 50% in TNF-α production in RAW 264.7 cells stimulated by LPS.

[0029] Based on the results of the above two inflammatory markers, NO and TNF-α, the five compounds (9, 18, 21, 24, and 27) with the best in vitro anti-inflammatory activity were selected for further evaluation. The IC50 values ​​of the five compounds for NO and TNF-α inflammatory markers were determined. 50 The compound was administered at concentration gradients of 20, 10, 5, 2.5, 1.25, and 0.625 μM. NO in the cell culture supernatant was detected using the Griess method, and TNF-α was measured using ELISA. The results showed that all active compounds inhibited LPS-induced NO and TNF-α release in a dose-dependent manner. The IC50 values ​​of the five compounds (9, 18, 21, 24, and 27) for inhibiting NO release were... 50 The values ​​were 3.594 μM, 9.371 μM, 7.917 μM, 2.175 μM, and 3.750 μM, respectively. Figure 1 A); Compounds 9, 18, 21, 24, and 27 inhibit the IC50 of TNF-α production. 50 The values ​​were 5.263 μM, 21.745 μM, 4.879 μM, 12.533 μM, and 12.194 μM, respectively. Figure 1(B) These results indicate that in the in vitro LPS-induced RAW 264.7 cell inflammation model, compound 24 showed the best inhibitory effect on NO, while compound 21 showed the best inhibitory effect on TNF-α. Compounds 24 and 21, which exhibited good in vitro anti-inflammatory activity, were selected for in vivo efficacy evaluation. However, due to the high toxicity of compound 21 in animals, which led to the death of mice, compound 24 was subsequently used for further in vivo anti-inflammatory activity and mechanism studies.

[0030] Furthermore, the cytotoxicity of the compound was assessed using the MTT assay. RAW 264.7 cells (5 × 10⁶ cells per well) were then cultured. 4 Cells were seeded into 96-well plates and incubated overnight. Cells were treated with different concentrations of compound 24 (0.625, 1.25, 2.5, 5, 10, or 20 μM) and then cultured continuously for 24 hours. MTT (5 mg / mL) was added to each well, and the cells were incubated at 37°C in the dark for another 4 hours. The supernatant was removed, and 150 μL of DMSO was added to each well. The absorbance was measured at 490 nm using a microplate reader. The results are shown below. Figure 2 .

[0031] Quinazoline derivative compound 24 exhibits good inhibitory activity against DYRK1A (IC50 = 0.63 nM). Figure 2 A). To determine the safe dose of compound 24 for RAW 264.7 cells, cells were treated with different concentrations ranging from 0.625 to 10 µM. As shown in Figure 2B, the MTT assay revealed no significant toxicity of compound 24 to RAW 264.7 cells within the 10 µM concentration range, indicating that compound 24 has good in vitro cell safety within the 10 µM concentration range.

[0032] 2.5 Effect of compound 24 on LPS-induced inflammatory response in RAW 264.7 cells ELISA experiments were performed using a mouse TNF-α, IL-6, and IL-1β ELISA kit to determine the levels of TNF-α, IL-6, and IL-1β in cell supernatants. Absorbance values ​​were measured at 450 nm using a microplate reader. Results are shown below. Figure 3 .like Figure 3 As shown in A, B, and C, the ELISA results showed that the levels of TNF-α, IL-6, and IL-1β in the supernatant of LPS-induced RAW 264.7 cells were significantly increased compared with the control group, indicating that the inflammation model was successfully established. After treatment with compound 24, the levels of LPS-induced cytokines were significantly reduced, and this inhibitory effect was dose-dependent.

[0033] In the NO production assay, RAW 264.7 cells were divided into 10... 5 Cells were seeded at a density of cells / well in 96-well plates and incubated overnight. Cells were pretreated for 1 hour with different concentrations of compound 24 (2.5, 5, or 10 μM) or DEX, followed by stimulation with LPS (1 μg / mL) for 24 hours. Cell supernatant was collected, and nitric oxide production was measured using a NO assay kit. Griess Reagent I and Griess Reagent II were added sequentially, and absorbance was measured at 540 nm using a microplate reader. Results are shown below. Figure 3 As shown in Figure D. The results showed that the NO release in the LPS group was significantly increased compared to the control group, while the NO release in the DEX group was significantly decreased compared to the LPS group, indicating that the cellular inflammation model was valid; compound 24 could significantly inhibit the LPS-induced upregulation of NO release and alleviate the inflammatory response.

[0034] In the RT-PCR experiment, total RNA was extracted from RAW 264.7 cells using Trizol reagent according to the manufacturer's instructions. The total RNA was reverse transcribed into cDNA using the PrimeScript™ RT Master Mix kit. The gene expression of TNF-α, IL-6, IL-1β, and iNOS was then detected in an RT-PCR instrument using the TB Green® Premix Ex Taq™ II kit. β-actin was used as an internal control, and the relative mRNA expression levels were calculated using the 2-ΔΔCT method. The primers used are as follows (5'–3'): TNF-α: Forward CCTATGTCTCAGCCTCTTCTCAT, Reverse CACTTGGTGGTTTGCTACGA; IL-6: Forward CCTCTCTGCAAGAGACTTCC, Reverse CTCCGGACTTGTGAAGTAGG; IL-1β: ForwardGGACCCCAAAAGATGAAGGGCTGC, Reverse GCTCTTGTTGATGTGCTGCTGCG; iNOS: ForwardCAGCTGGGCTGTACAAACCTT, Reverse CATTGGAAGTGAAGCGTTTCG; β-actin: ForwardGGCTGTATTCCCCTCCATCG, Reverse CCAGTTGGTAACAATGCCATGT.

[0035] according to Figure 3As shown in E, F, G, and H, RT-PCR results showed that the transcription of TNF-α, IL-6, and IL-1β genes was significantly upregulated in the LPS group compared to the control group, and compound 24 was able to inhibit the transcription of TNF-α, IL-6, and IL-1β genes induced by LPS in RAW 264.7 cells in a concentration-dependent manner.

[0036] 2.6 Effect of compound 24 on LPS-induced ROS production in RAW 264.7 cells RAW264.7 cells were collected and washed twice with PBS. Using a ROS fluorescence detection kit, cells were incubated with the DCFH-DA probe (10 μM) at 37°C for 30 minutes, followed by PBS washing. ROS levels were detected using a BD FACSCanto II flow cytometer. Results are shown below. Figure 4 .

[0037] like Figure 4 As shown in A and B, flow cytometry results showed that, compared with the control group, LPS stimulation significantly increased ROS production in RAW 264.7 cells, while compound 24 at 2.5, 5, and 10 μM significantly reduced the LPS-induced increase in ROS levels in a concentration-dependent manner.

[0038] 2.7 Interaction between compound 24 and the DYRK1A target The DYRK1A protein crystal structure (PDB ID: 6S17) from the PDB database (https: / / www.rcsb.org / ) was used to perform molecular docking between compound 24 and DYRK1A using Schrödinger Maestro 11.5 and XP (extra precision) mode. The docking results were generated using PyMol (https: / / pymol.sourceforge). See below for details. Figure 5 .

[0039] As shown in Figure 5A, molecular docking results confirmed that compound 24 could target and bind to DYRK1A (docking score: -13.375). Compound 24 formed hydrogen bonds with glutamic acid residue Glu239 and leucine residue Leu241 at the hinge site, and strong hydrogen bonds with lysine residues Lys188 and Lys167 in the active site cavity. These key interactions are essential for anchoring small molecules to the target active site. The azaindole and quinazoline portions are embedded in the hydrophobic pocket of the protein, while their nitrogen atoms face the hydrophilic region. This optimal interaction network enhances the binding affinity of the ligand and the stability of the protein-ligand complex (Figure 5A). The target affinity of compound 24 was assessed using CETSA. Compared with the DMSO group, the DYRK1A level in the compound 24 group was significantly higher, indicating that compound 24 has a strong targeting affinity for DYRK1A (Figures 5B and 5C).

[0040] Western blotting was performed, with total protein extracted from RAW264.7 cells using RIPA buffer and its concentration determined by BCA assay. Proteins were separated by 8% SDS-PAGE and then transferred to PVDF membranes (70 V, 2 hours). The membranes were blocked with TBST containing 5% skim milk and then incubated overnight at 4°C with primary antibodies including DYRK1A, TLR4, NF-κB p65, phosphorylated NF-κB p65 (1:1000), NF-κB IκBα, phosphorylated IκBα (1:2000), and GAPDH (1:30000), followed by incubation for 2 hours with goat anti-rabbit HRP antibody (1:50000). Protein bands were developed and photographed using Sparkjade ECL star and analyzed using ImageJ software.

[0041] Western blot results showed that DYRK1A expression levels were increased in LPS-induced RAW 264.7 cells, while expression levels were decreased in cells treated with compound 24 (Fig. 5D, E), indicating a potential interaction between compound 24 and DYRK1A, consistent with molecular docking and CETSA results.

[0042] 2.8 Effect of compound 24 on activation of the TLR4 / NF-κB signaling pathway CETSA was used to analyze the thermal stability of proteins. RAW 264.7 cells were seeded in 6 cm culture dishes and incubated at 37°C for 6 hours with 10 μM compound 24 or an equal volume of DMSO. After removing the culture medium, the cells were washed twice with cold PBS and aliquoted into 11 different EP tubes. The tubes were heated at a specified temperature (37°C–77°C) for 3 minutes and equilibrated at 25°C for 3 minutes. Cell lysis was achieved by at least three freeze-thaw cycles in liquid nitrogen. The cell lysis buffer was centrifuged at 14,000 rpm for 30 minutes at 4°C. The supernatant was then aspirated, mixed with 5× loading buffer, and boiled at 100°C for 5 minutes for further Western blotting. The results are shown in [Figure number missing]. Figure 6 .

[0043] Depend on Figure 6 It was found that in LPS-induced RAW 264.7 cells, the expression level of TLR4 and the phosphorylation levels of NF-κBp65 and IκBα were higher than those in control cells. Compound 24 could significantly inhibit this increase induced by LPS, indicating that compound 24 may exert its anti-inflammatory effect by inhibiting the DYRK1A / TLR4 / NF-κB axis in RAW 264.7 cells.

[0044] 2.9 Effects of compound 24 on LPS-induced lung injury and inflammation in ALI mice For histopathological analysis, the right upper lung tissue was fixed with 4% paraformaldehyde, then dehydrated, embedded, and sectioned. The lung sections were stained with hematoxylin and eosin (HE) for histological examination, and the pathological changes in the lung tissue were then observed and photographed under an optical microscope.

[0045] In the ALI mouse model, HE results showed that, compared with the negative control group, the LPS group had increased lung congestion, inflammatory infiltration and alveolar septal thickness. The lung tissue of mice treated with compound 24 or DEX did not show obvious pathological changes (Figure 7A), indicating that compound 24 effectively alleviated LPS-induced lung tissue damage.

[0046] ELISA experiments were performed using a mouse TNF-α, IL-6, and IL-1β ELISA kit to determine the levels of TNF-α, IL-6, and IL-1β in lung homogenates. Absorbance values ​​were measured at 450 nm using a microplate reader. Results are shown below. Figure 7 .

[0047] like Figure 7As shown in BD, ELISA results showed that, in mice, the levels of cytokines TNF-α, IL-6, and IL-1β in the lungs of the LPS group were significantly increased compared with the control group; and treatment with compound 24 significantly reduced the release of cytokines compared with the LPS group, indicating that the inflammatory response in the lungs was suppressed.

[0048] In the RT-PCR experiment, total RNA was extracted from RAW 264.7 lung tissue using Trizol reagent according to the manufacturer's instructions. The total RNA was reverse transcribed into cDNA using the PrimeScript™ RT Master Mix kit. The gene expression of TNF-α, IL-6, IL-1β, and iNOS was then detected in an RT-PCR instrument using the TB Green® Premix Ex Taq™ II kit. β-actin was used as an internal control, and the relative mRNA expression levels were calculated using the 2-ΔΔCT method. The primers used are as follows (5'–3'): TNF-α: Forward CCTATGTCTCAGCCTCTTCTCAT, Reverse CACTTGGTGGTTTGCTACGA; IL-6: Forward CCTCTCTGCAAGAGACTTCC, Reverse CTCCGGACTTGTGAAGTAGG; IL-1β: ForwardGGACCCCAAAAGATGAAGGGCTGC, Reverse GCTCTTGTTGATGTGCTGCTGCG; iNOS: ForwardCAGCTGGGCTGTACAAACCTT, Reverse CATTGGAAGTGAAGCGTTTCG; β-actin: ForwardGGCTGTATTCCCCTCCATCG, Reverse CCAGTTGGTAACAATGCCATGT.

[0049] according to Figure 7 As shown in E, F, and G, RT-PCR results of ALI mouse lung tissue showed that the transcription of TNF-α, IL-6, and IL-1β genes was significantly increased in the LPS group compared to the control group, and compound 24 could significantly inhibit the transcription of TNF-α, IL-6, and IL-1β genes in the lungs induced by LPS.

[0050] SOD and GSH activity assay: Mouse lung tissue was collected, and the SOD and GSH activities in the lung tissue homogenate were detected according to the instructions of the Nanjing Jiancheng reagent kit. Results are shown below. Figure 7 H, I.

[0051] In ALI mice, compared with the control group, the activities of two major antioxidant enzymes, GSH and SOD, were significantly reduced in the lung tissue of mice after LPS stimulation, while the compound 24 treatment group significantly reversed this reduction caused by LPS.

[0052] 2.10 Effect of compound 24 on the recruitment of LPS-induced inflammatory cells in the lungs of ALI mice The effect of compound 24 on the recruitment of LPS-induced inflammatory cells in the lungs of ALI mice was analyzed by immunohistochemistry. After dewaxing, lung sections were incubated with primary antibodies (1:50) against MPO, Ly6G, and CD68, followed by incubation with secondary antibodies, and observed and photographed under a microscope.

[0053] Immunohistochemical results showed that, compared with the control group, the number of MPO, Ly6G, and CD68 positive cells in the lung tissue of mice in the LPS group was significantly increased, indicating that there was extensive recruitment of inflammatory cells in the lung tissue after LPS challenge. Figure 8 Compound 24 significantly reduced LPS-induced inflammatory cell infiltration. Figure 8 ).

[0054] 2.11 Effect of compound 24 on LPS-induced neutrophil infiltration in BALF of ALI mice In the flow cytometry analysis, mice were euthanized, their neck skin was cut open to expose the trachea, and the lungs were lavaged three times with 0.7 mL PBS. BALF was collected, and cells and supernatant were separated by centrifugation. The cell pellet was washed and incubated with flow cytometry antibodies: PE anti-mouse CD45 antibody, PerCP / Cyanine5.5 anti-mouse CD11b antibody, APC / Cyanine7 anti-mouse CD11c antibody, and FITC anti-mouse Ly6G antibody. After washing, the cells were resuspended, and the immune cell subsets in the BALF were analyzed by flow cytometry. CD45+CD11b+CD11c−Ly6G+ cells were considered neutrophils.

[0055] The flow cytometry results are shown in Figure 9. Compared with the negative control group, LPS significantly increased the percentage of neutrophils in mouse BALF, and treatment with compound 24 significantly reduced the LPS-induced increase in the percentage of neutrophils. Figure 9 These results indicate that compound 24 can effectively alleviate LPS-induced ALI in mice.

[0056] In summary, compound 24 exhibits good anti-inflammatory activity and has the potential to be further developed into a therapeutic agent for ALI. It can be used to prepare drugs for treating acute lung injury.

[0057] Specific examples have been used to illustrate the principles and implementation methods of this invention. The descriptions of the above embodiments are only for the purpose of helping to understand the method and core ideas of this invention. Furthermore, those skilled in the art will recognize that, based on the ideas of this invention, there will be changes in the specific implementation methods and application scope. Therefore, the content of this specification should not be construed as a limitation of this invention.

Claims

1. The use of a quinazoline compound in the preparation of a drug for treating acute lung injury, wherein the structure of the quinazoline compound is as follows: 。 2. The application according to claim 1, characterized in that, The quinazoline compounds are used in the preparation of drugs for treating acute lung injury by inhibiting the DYRK1A / TLR4 / NF-κB signaling pathway in cells.

3. The application according to claim 1, characterized in that, The quinazoline compounds are used in the preparation of drugs for treating acute lung injury by inhibiting the gene transcription of TNF-α, IL-6, and IL-1β in cells in a concentration-dependent manner.

4. The application according to claim 1, characterized in that, The quinazoline compounds are used in the preparation of drugs for treating acute lung injury by inhibiting the decrease in the activity of antioxidant enzymes GSH and SOD.

5. The application according to claim 1, characterized in that, The quinazoline compounds are used in the preparation of drugs for treating acute lung injury by reducing ROS levels.

6. The application according to claim 1, characterized in that, The quinazoline compounds are used in the preparation of drugs for treating acute lung injury by targeting and binding to DYRK1A.

7. The application according to claim 6, characterized in that, The targeted binding is as follows: the quinazoline compound forms hydrogen bonds with the glutamic acid residue Glu239 and the leucine residue Leu241 at the hinge site of DYRK1A, and forms strong hydrogen bonds with the lysine residues Lys188 and Lys167 in the active site cavity.

8. The application according to claim 1, characterized in that, The quinazoline compounds are used in the preparation of drugs for treating acute lung injury by reducing the percentage of neutrophils.

Images