Method for screening target of han-kaempferol based on lip-ms and application thereof

Abstract

The application provides a method for screening a target point of action of Han-Huangqin glycoside based on LiP-MS and application. The LiP-MS method is used for the first time to screen the binding target PDHA1 of Han-Huangqin glycoside, and the protective effect of Han-Huangqin glycoside on the acute liver injury induced by acetylaminophenol is evaluated at the in-vivo and in-vitro levels, and then the target is knocked down, and the effect of Han-Huangqin glycoside on the improvement of the acute liver injury induced by acetylaminophenol is evaluated at the in-vitro level in the dependence of the target PDHA1. A new reference is provided for Han-Huangqin glycoside to relieve drug-induced acute liver injury.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology and relates to new indications and uses of baicalin and the screening of its target, particularly to a method and application for screening baicalin targets based on LiP-MS. Background Technology

[0002] Acetaminophen (APAP)-induced liver injury is a leading cause of drug-induced liver injury (DILI) and acute liver failure (ALF) worldwide. Although APAP is a widely used and generally safe analgesic and antipyretic at therapeutic doses, overdose can lead to severe hepatotoxicity. The underlying mechanism involves cytochrome P450-mediated metabolism, primarily through CYP2E1 conversion of APAP to the highly reactive metabolite N-acetyl-p-benzoquinone imine (NAPQI). Normally, NAPQI is detoxified by binding to glutathione (GSH), but APAP overdose depletes hepatic GSH reserves, leading to NAPQI accumulation. This results in covalent binding to mitochondrial proteins, disruption of the electron transport chain, excessive production of reactive oxygen species (ROS), and nuclear DNA damage, ultimately causing extensive necrosis of central lobular hepatocytes. The subsequent aseptic inflammatory response, induced by Kupffer cell activation and peripheral immune cell infiltration, can either promote tissue repair or exacerbate the damage depending on the microenvironment. Currently, N-acetylcysteine ​​(NAC) remains the only approved antidote, with its mechanism of action being that of a glutathione (GSH) precursor. However, its efficacy is significantly time-dependent, achieving optimal results only when administered within 8 hours of an overdose. Given the limitations of NAC and the rising incidence of acetaminophen-related acute liver failure (ALF), there is an urgent need to discover new therapeutic targets and drugs.

[0003] In recent years, natural products have become an important source for the development of hepatoprotective drugs due to their multi-target effects, low toxicity, and excellent biocompatibility. Scutellaria baicalensis (Scutellaria baicalensis) Scutellaria baicalensis Georgi Scutellaria baicalensis, a traditional Chinese medicine with heat-clearing and detoxifying properties, has been documented in the *Compendium of Materia Medica* for treating jaundice and other ailments. Modern pharmacological studies have confirmed that Scutellaria baicalensis extract possesses significant anti-inflammatory, antioxidant, and hepatoprotective effects. Among these, baicalin (… Scutellaria baicalensisThe glycosidic form of baicalin (WGS) has been reported to possess various pharmacological activities, including anti-inflammatory, antitumor, and neuroprotective effects. However, research on the hepatoprotective potential of baicalin remains limited, its mechanism of action is not fully elucidated, and its role in drug-induced liver injury (DILI) and acute liver failure (ALF) is unknown. Given the high content of this component in Scutellaria baicalensis, we hypothesize that baicalin may exert its hepatoprotective effect through different molecular mechanisms. Therefore, this invention aims to provide a baicalin target and its application screened using LiP-MS to address the aforementioned issues. Summary of the Invention

[0004] The present invention aims to at least solve one of the technical problems existing in the prior art, and to provide a target of action of baicalin screened based on LiP-MS technology and its application.

[0005] This invention employs a peptide-based label-free drug target analysis method to extract total protein from HepG2 cells treated with baicalin. Restriction digestion with Proteinase K was performed, and changes in peptide profiles between the control and drug-treated groups were compared. Specific "conformation-maintaining peptides" in the baicalin-treated group were screened, and target proteins inhibiting HePG2 cells were identified through database matching. Furthermore, the liver injury repair effect and target of baicalin were validated through animal model experiments and target knockdown experiments.

[0006] Based on the above research, the technical solution adopted in this invention is as follows:

[0007] In a first aspect, the present invention provides the use of baicalin in the preparation of a drug for relieving drug-induced acute liver injury.

[0008] Preferably, the drug-induced acute liver injury is acetaminophen (APAP)-induced acute liver injury.

[0009] Preferably, the acute liver injury includes drug-induced liver injury (DILI) and acute liver failure (ALF).

[0010] This invention experimentally demonstrates that baicalin can improve drug-induced acute liver injury, as follows: Before injecting acetaminophen into experimental mice, different doses of baicalin were administered prophylactically, followed by histological and serum biochemical index detection. The results showed that baicalin can effectively improve the degree of collagen deposition and fibrosis in liver tissue, while significantly reducing acetaminophen-induced AST and ALT levels.

[0011] Furthermore, the drug can be a drug with baicalin as the sole active ingredient, or a drug rich in baicalin. Baicalin is mainly derived from the traditional Chinese medicine Scutellaria baicalensis, therefore drugs rich in it are mainly concentrated in traditional Chinese medicine preparations containing Scutellaria baicalensis.

[0012] In a second aspect, the present invention provides a method for screening baicalin targets based on LiP-MS, comprising the following steps:

[0013] S1. Extraction of native conformational proteins: The target cells were cultured until the cell density reached 80%. The cells were washed with PBS, and PBS was added to scrape the cells. The cells were collected by centrifugation at 1000g for 10-15 minutes. The cell pellet was resuspended in freshly prepared lysis buffer containing protease and phosphatase inhibitors. After lysis on ice for 30 minutes, the cells were centrifuged at 12,000g for 10-20 minutes, and the protein concentration in the supernatant was measured.

[0014] S2. Restrictive protein digestion: The baicalin stock solution was diluted with DMSO to prepare single-dose and multi-dose groups; equal volumes of protein were aliquoted into EP tubes, and baicalin solution or DMSO was added. After mixing, the mixture was incubated at 25°C, followed by the addition of proteinase K and incubation at 25°C. The enzyme reaction was terminated by heating at 98°C for 2-4 minutes; an equal volume of 10% sodium deoxycholate was added, and the mixture was heated at 98°C for 8-12 minutes. TCEP and iodoacetamide were then added to complete protein reduction and alkylation; subsequently, trypsin digestion was performed, sodium deoxycholate was precipitated with formic acid, and the mixture was centrifuged at 18,000g. The supernatant was collected and desalted for concentration.

[0015] S3. Mass spectrometry analysis: Reconstituted peptides are collected using a data-independent acquisition method, and qualitative and quantitative analysis of the peptides is performed.

[0016] S4. Potential target screening: Set thresholds, fold change > 4, p < 0.01, perform peptide differential analysis and enrichment based on KEGG, and determine the enrichment pathways of differentially expressed proteins;

[0017] S5. Dose-dependent analysis of drug response: Dose-dependent analysis of peptides in the tricarboxylic acid cycle revealed that PDHA1 has a significant dose dependence, and potential binding targets of baicalin were screened.

[0018] Preferably, in S1, the target cell is selected from HepG2 cells;

[0019] In S3, Analyst® 1.7 was used for data acquisition, and Spectronaut (v.15.3) was used for qualitative and quantitative analysis of peptides.

[0020] In S5, dose-dependent analysis of drug response revealed that PDHA1 exhibits significant dose dependence and is a potential binding target for baicalin. Further analysis using biomembrane interference technology showed that baicalin has a strong affinity for PDHA1, with a KD value of 16.4 µM.

[0021] Based on the above analysis, in a third aspect, this invention provides a derivative application of PDHA1 as a target of baicalin. Other substances that target PDHA1 and are effective in alleviating acute liver injury can be used as adjuvants to baicalin.

[0022] In a fourth aspect, the present invention provides a drug-induced acute liver injury relief treatment agent selected from any of the following: (1) using baicalin or a pharmaceutical composition rich in baicalin as the active ingredient; (2) using a pharmaceutical composition rich in baicalin in combination with other substances that target PDHA1 and are effective in relieving acute liver injury as the active ingredient.

[0023] The role and effect of invention

[0024] This invention is the first to employ LiP-MS to screen for PDHA1, the binding target of baicalin, and to evaluate the protective effect of baicalin against acetaminophen-induced acute liver injury at in vitro and in vivo levels. Furthermore, after knocking down the target, the in vitro efficacy of baicalin in improving acetaminophen-induced acute liver injury in a PDHA1-dependent manner was assessed. This provides a new reference for baicalin in alleviating drug-induced acute liver injury. Attached Figure Description

[0025] Figure 1 The following diagrams show the LiP-MS method used to identify PDHA1 as the target of baicalin: (A) Schematic diagram of experimental sample preparation and proteomic mass spectrometry process for the experimental group (HepG2 cells + WGS treatment) and the control group (HepG2 cells + DMSO); (B) Volcano plot of differentially expressed proteins; (C) Bubble plot of differentially expressed proteins enriched in the KEGG pathway; (D) BLI biolayer interference binding curve used to detect the affinity between HepG2 cells and WGS molecules; (E) Results of CETSA cell thermal displacement experiment; (F) Three-dimensional binding model of molecular docking between WGS and PDHA1, where the blue backbone is the three-dimensional structure of PDHA1 protein and the green structure is the small WGS molecule; (G) Molecular dynamics simulation (MD) Rg curve, showing that the binding conformation of WGS and PDHA1 can be maintained stably; (H) Quantitative dose-response curve of the targeted peptide.

[0026] Figure 2 The study demonstrated that baicalin effectively improved APAP-induced acute liver injury in mice: (A) Animal model construction process; (B) Histological examination results; (C) Liver / body weight ratio control; (D, E) Serum biochemical indicators AST and ALT detection results.

[0027] Figure 3The study showed that baicalin exerts its hepatoprotective effect in a target-dependent manner of PDHA1. It was found that after PDHA1 knockdown, administration of the drug to an APAP-induced model did not result in significant changes in the expression levels of AST (A), ALT (B), and LDH (C). Detailed Implementation

[0028] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0029] This invention aims to use LiP-MS to screen for the binding targets of baicalin, and to evaluate the protective effect of baicalin against acetaminophen-induced acute liver injury at the in vivo level. Furthermore, after knocking down the target, the effects of baicalin on target-dependent improvement of acetaminophen-induced acute liver injury will be evaluated. Specifically:

[0030] I. Targets of baicalin screened by LiP-MS method

[0031] See the schematic diagram of the experimental process. Figure 1 A. The specific steps are as follows:

[0032] S1. Extraction of native conformation proteins: HepG2 cells were seeded into 10cm culture dishes. After reaching a cell density of 80%, the cells were washed twice with PBS. HepG2 cells were scraped off with PBS and collected by centrifugation at 1000g for 10 minutes. The cell pellet was resuspended in freshly prepared lysis buffer (containing protease and phosphatase inhibitors). The cell suspension was lysed on ice for 30 minutes and then centrifuged at 12,000g for 15 minutes. The protein concentration in the supernatant was determined using the BCA method.

[0033] S2. Restrictive protein digestion: Baicalin stock solution was diluted with DMSO to prepare single-dose and multi-dose groups (4, 8, 16, 32, 64 μM). Equal volumes of protein were aliquoted into 1.5 mL ep ep tracts, and baicalin solution (experimental group) or DMSO (control group) was added. After mixing, the mixture was incubated at 25°C for 10 minutes. Proteinase K was then added, and the mixture was incubated at 25°C for 5 minutes, followed by heating at 98°C for 3 minutes to terminate the enzyme reaction. An equal volume of 10% sodium deoxycholate was added, and the mixture was heated at 98°C for 10 minutes. TCEP and iodoacetamide were then added to complete protein reductive alkylation. Subsequently, trypsin digestion was performed, and sodium deoxycholate was precipitated with formic acid. The mixture was centrifuged at 18,000 g for 15 minutes. The supernatant was collected and desalted for concentration.

[0034] S3. Mass spectrometry analysis: Reconstituted peptides were acquired using Analyst® 1.7 based on a data-independent acquisition method, and qualitative and quantitative analysis of the peptides was performed using Spectronaut (v.15.3).

[0035] S4. Potential Target Screening: Thresholds were set: fold change > 4, p < 0.01. Peptide differential analysis was performed, identifying a total of 563 differentially expressed proteins. Figure 1 B), KEGG enrichment analysis revealed that the differentially expressed proteins were mostly enriched in the tricarboxylic acid cycle pathway (B). Figure 1 C).

[0036] S5. Dose-dependent analysis of drug response; Dose-dependent analysis of peptides in the tricarboxylic acid cycle pathway revealed that PDHA1 exhibited significant dose dependence. Figure 1 E, F, and G are potential binding targets for baicalin.

[0037] II. Evaluation of the affinity between baicalin and the target site based on biomembrane interferometry

[0038] S1. Sensor Hydration and Baseline Equilibrium: Attach the SA sensor to the Octet instrument probe arm. Immerse the sensor in the detection buffer for at least 10 minutes to hydrate. Incubate the sensor in the detection buffer for 60 seconds to ensure a stable baseline.

[0039] S2. Immobilization of biotinylated PDHA1 protein: Dilute the biotinylated PDHA1 protein to an appropriate concentration in the detection buffer. Immerse the SA sensor in the protein solution and incubate at room temperature for 300 seconds until a binding plateau is reached. Wash the sensor with the detection buffer for 60 seconds to remove unbound protein and establish a stable baseline.

[0040] S3. Concentration gradient setting and binding / dissociation detection:

[0041] Prepare a series of concentration gradients of baicalin, with three replicates for each concentration. Immerse the PDHA1 protein-loaded sensor sequentially in baicalin solutions of different concentrations to detect the binding phase and record the binding curves in real time. Figure 1 D). The sensor was then transferred to a drug-free detection buffer solution for dissociation phase monitoring to observe the dissociation behavior of the complex.

[0042] S4. Control Setup: Blank Control: The same drug concentration was detected using an unloaded SA sensor for background subtraction. Non-specific Control: Parallel experiments were performed using an irrelevant biotinylated protein to verify binding specificity.

[0043] S5. Data Acquisition and Analysis: Data processing was performed using Octet Data Analysis Software. The blank control signal was subtracted, and baseline correction was performed on the binding-dissociation curves. Figure 1 G). The affinity KD value between baicalin and PDHA1 was determined to be 16.4 µM, indicating a strong affinity. Figure 1 H).

[0044] III. Application of baicalin in improving drug-induced acute liver injury

[0045] S1. Establishment of an acute liver injury model ( Figure 2 A): Male wild-type C57BL / 6J mice aged 6-8 weeks were purchased from Shanghai Silex Laboratory Animal Co., Ltd. The mice were housed in a specific pathogen-free facility at a temperature of 22 ± 2°C and a relative humidity of 50% ± 10%. Two hours before acetaminophen treatment, the mice were prophylactically administered baicalin at doses of 30 mg / kg and 60 mg / kg, respectively. Sixteen hours later, the mice were euthanized by cervical dislocation.

[0046] S2. HE staining and Masson staining: Mouse liver tissue samples were collected and fixed in 10% neutral buffered formalin for histopathological analysis. The fixed tissues were embedded in paraffin and subjected to hematoxylin-eosin staining for histological examination, and Masson staining to assess collagen deposition and fibrosis. Results showed that baicalin effectively slowed liver tissue damage and alleviated collagen deposition and fibrosis. Figure 2 B).

[0047] S3. Serum Biochemical Detection: After blood sample collection, serum was immediately separated by centrifugation at 3,000 g for 10 minutes. Subsequently, the liver-to-body ratio was measured, and the activities of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were determined using a biochemical assay kit. Results showed that baicalin could slightly increase the liver-to-body ratio (…). Figure 2 C), significantly reduced acetaminophen-induced AST and ALT levels ( Figure 2 D, E).

[0048] IV. Functional verification of PDHA1 target dependence:

[0049] S1. Construction of specific shPDHA1 cells: A specific shRNA plasmid was designed and constructed targeting the PDHA1 gene. After transfection into HEPG2 cells, a cell line with stable PDHA1 knockdown was obtained through antibiotic screening, and the knockdown efficiency was verified by qPCR and Western Blot.

[0050] The sequence of PDHA1 shRNA is as follows: CGACGTAAACGGCCACAAGTT (SEQ ID NO.1).

[0051] S2. Assessment of PDHA1 target-dependent liver injury markers: A liver injury model was established by treating control cells and PDHA1 knockdown cells with acetaminophen, and then divided into a solvent control group and a baicalin treatment group. After the experiment, cell supernatant was collected, and AST, ALT, and LDH levels were measured using a kit to assess the degree of liver injury. Results are as follows: Figure 3 The results showed that in the control group, baicalin significantly reduced AST and ALT levels, demonstrating a significant hepatoprotective effect; however, in the PDHA1 knockdown experimental group, the effect of baicalin in reducing transaminase was significantly weakened or even disappeared, suggesting that its pharmacological effect in improving liver injury depends on the PDHA1 target.

[0052] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above specific embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. The use of baicalin or pharmaceutical compositions rich in baicalin in the preparation of drugs to alleviate drug-induced acute liver injury.

2. The application according to claim 1, characterized in that, The drug-induced acute liver injury was acetaminophen (APAP)-induced acute liver injury.

3. The application according to claim 1 or 2, characterized in that, The acute liver injury mentioned includes drug-induced liver injury (DILI) and acute liver failure (ALF).

4. The application according to claim 1 or 2, characterized in that, The relieving drug is a drug with baicalin as the sole active ingredient, or a drug rich in baicalin.

5. A method for screening baicalin targets based on LiP-MS, characterized in that, Includes the following steps: S1. Extraction of native conformational proteins: The target cells were cultured until the cell density reached 80%. The cells were washed with PBS, and PBS was added to scrape the cells. The cells were collected by centrifugation at 1000g for 10-15 minutes. The cell pellet was resuspended in freshly prepared lysis buffer containing protease inhibitors and phosphatase inhibitors. The cells were lysed on ice for 30 minutes, centrifuged at 12,000g for 10-20 minutes, and the protein concentration in the supernatant was measured. S2. Restrictive protein digestion: The baicalin stock solution was diluted with DMSO to prepare single-dose and multi-dose groups; equal volumes of protein were aliquoted into EP tubes, and baicalin solution or DMSO was added. After mixing, the mixture was incubated at 25°C, followed by the addition of proteinase K and incubation at 25°C. The enzyme reaction was terminated by heating at 98°C for 2-4 minutes; an equal volume of 10% sodium deoxycholate was added, and the mixture was heated at 98°C for 8-12 minutes. TCEP and iodoacetamide were then added to complete protein reduction and alkylation; subsequently, trypsin digestion was performed, sodium deoxycholate was precipitated with formic acid, and the mixture was centrifuged at 18,000g. The supernatant was collected and desalted for concentration. S3. Mass spectrometry analysis: Reconstituted peptides are collected using a data-independent acquisition method, and qualitative and quantitative analysis of the peptides is performed. S4. Potential target screening: Set thresholds, fold change > 4, p < 0.01, perform peptide differential analysis and enrichment based on KEGG, and determine the enrichment pathways of differentially expressed proteins; S5. Dose-dependent analysis of drug response: Dose-dependent analysis of peptides in the tricarboxylic acid cycle was performed to screen for potential binding targets of baicalin.

6. The method for screening baicalin targets based on LiP-MS according to claim 5, characterized in that, In S1, the target cells are selected from HepG2 cells; In S3, Analyst® 1.7 was used for data acquisition, and Spectronaut (v.15.3) was used for qualitative and quantitative analysis of peptides.

7. The method for screening baicalin targets based on LiP-MS according to claim 5, characterized in that, The target site for baicalin identified through screening was PDHA1.

8. A drug-induced acute liver injury relief agent, characterized in that, (1) Using baicalin or a pharmaceutical composition rich in baicalin as the active ingredient; (2) Combining a pharmaceutical composition rich in baicalin with other substances that target PDHA1 and are effective in relieving acute liver injury as the active ingredient.

Images