Use of bckdhb locus-derived circular rna and expression vector thereof in treatment of hyperglycemia or type 2 diabetes

Abstract

The application belongs to the technical field of nucleic acid drugs, and relates to application of a BCKDHB locus-derived circular RNA and an expression vector thereof in treatment of hyperglycemia or type 2 diabetes. The circular RNA is mouse circBckdhb shown in SEQ ID NO. 1 or human circBCKDHB shown in SEQ ID NO. 2. The application also provides an expression construct and an expression vector containing an islet beta cell preferred promoter, a target nucleic acid sequence and flanking sequences for promoting reverse splicing and circularization, and preferably realizes islet biased expression by using an AAV8 capsid and a RIP2 promoter. Experiments of the application show that mouse circBckdhb is relatively enriched in islets; expression of human circBCKDHB is reduced in serum of type 2 diabetes patients and in islets of type 2 diabetes donors; and increasing expression of mouse islet circBckdhb can reduce fasting blood glucose and improve glucose tolerance.

Description

Technical Field

[0001] This invention relates to the application of circular RNA in the preparation of nucleic acid drugs, and more particularly to the application of circular RNA derived from the BCKDHB locus and its expression vector in the treatment of hyperglycemia or type 2 diabetes, belonging to the field of nucleic acid drugs and metabolic disease treatment technology. Background Technology

[0002] Diabetes mellitus is a group of metabolic diseases characterized by chronic hyperglycemia, with type 2 diabetes accounting for the vast majority. Its development is closely related to insulin resistance, compensatory increase in insulin secretion by pancreatic β cells, and subsequent β cell dysfunction. Sustained high glucose, high lipid, and inflammatory stimulation can further aggravate β cell stress, apoptosis, and insulin secretion disorders, and cause metabolic abnormalities in multiple organs such as the liver, skeletal muscle, and adipose tissue.

[0003] Current treatments for type 2 diabetes include lifestyle interventions, insulin sensitizers, insulin secretagogues, GLP-1 receptor agonists, SGLT2 inhibitors, and insulin therapy. However, some patients still experience inadequate glycemic control, persistent decline in pancreatic β-cell function, or poor long-term adherence to treatment. Therefore, developing nucleic acid drugs or gene therapy strategies with novel mechanisms of action that can directly improve pancreatic β-cell function and alleviate hyperglycemia is of significant practical value.

[0004] Circular RNAs (RRNAs) are a class of covalently closed RNA molecules formed by backsplicing of precursor mRNA. Lacking free 5′ and 3′ ends, they exhibit strong resistance to exonucleases. Some RRNAs exhibit tissue-, cell-type-, or developmental-stage-specific expression and can participate in cellular function regulation by binding to microRNAs or RNA-binding proteins, and by regulating parental gene transcription or translation. These characteristics give RRNAs and their expression regulation systems potential value as targets for nucleic acid drugs or therapeutic nucleic acid molecules. [1-3] .

[0005] Previous studies have shown that pancreatic islet cells contain a large number of circular RNAs, which exhibit cell type-selective expression, and that some circular RNAs expressed in islets are associated with type 2 diabetes status. [4-6] For example, circHIPK3, CDR1as, and circular RNAs derived from introns of the insulin gene can affect β-cell survival, proliferation, or insulin secretion. [4,7] These studies suggest that specific pancreatic islet circular RNAs are not merely transcriptional byproducts, but may be involved in β-cell adaptation, compensation, and functional maintenance. However, the origin, backsplicing sites, tissue distribution, and functional orientation of different circular RNAs are highly specific and cannot be directly inferred from the known functions of other circular RNAs.

[0006] For therapeutic applications, circular RNA-related technologies still face challenges such as target cell delivery, tissue-biased expression, circularization efficiency, and in vivo functional validation. Existing research has shown that combining the insulin gene-derived β-cell-biased promoter with an AAV vector can be used to achieve pancreatic β-cell-biased exogenous nucleic acid expression. [8] Therefore, when expressing the target circular RNA in pancreatic β cells, it can be further combined with flanking sequences that promote circularization to enhance the formation and expression of the target circular RNA.

[0007] The BCKDHB gene encodes the E1β subunit of the branched-chain α-keto acid dehydrogenase complex, which catalyzes a key rate-limiting reaction in the catabolism of branched-chain amino acids. Abnormalities in branched-chain amino acids and their metabolic intermediates are associated with obesity, insulin resistance, and type 2 diabetes. [9] Therefore, the non-coding transcripts generated by the BCKDHB locus may be related to pancreatic metabolic adaptation and glucose homeostasis, but the known metabolic functions of the parental gene cannot replace direct verification of the structure, expression, and function of its circular transcripts.

[0008] While existing databases include hsa_circ_0077164 and mmu_circ_0001822, these databases typically only provide sequence or backsplicing site information and do not reveal whether increasing the expression of this circular RNA can improve hyperglycemia or type 2 diabetes-related glucose metabolism abnormalities. There are currently no systematic reports on the disease-related expression characteristics, islet enrichment characteristics, and the effect of circBCKDHB on improving glucose metabolism through β-cell-preferred expression vectors.

[0009] The references related to the above background technology content are as follows:

[0010] [1] Chen LL, Yang L. Regulation of circRNA biogenesis. RNA Biology, 2015, 12(4):381-388.

[0011] [2] Kristensen LS, Andersen MS, Stagsted LVW, et al. The biogenesis,biology and characterization of circular RNAs. Nature Reviews Genetics, 2019,20(11):675-691.

[0012] [3] Tehrani SS, Goodarzi G, Panahi G, et al. Multiple novel functionsof circular RNAs in diabetes mellitus. Archives of Physiology andBiochemistry, 2023, 129(6):1235-1249.

[0013] [4] Stoll L, Sobel J, Rodriguez-Trejo A, et al. Circular RNAs asnovel regulators of beta-cell functions in normal and disease conditions.Molecular Metabolism, 2018, 9:69-83.

[0014] [5] Kaur S, Mirza AH, Pociot F. Cell type-selective expression ofcircular RNAs in human pancreatic islets. Non-Coding RNA, 2018, 4(4):38.

[0015] [6] Haque S, Ames RM, Moore K, et al. Islet-expressed circular RNAsare associated with type 2 diabetes status in human primary islets and inperipheral blood. BMC Medical Genomics, 2020, 13:64.

[0016] [7] Stoll L, Rodriguez-Trejo A, Guay C, et al. A circular RNAgenerated from an intron of the insulin gene controls insulin secretion.Nature Communications, 2020, 11:5611.

[0017] [8] Mulder NL, Havinga R, Kluiver J, Groen AK, Kruit JK. AAV8-mediated gene transfer of microRNA-132 improves beta cell function in mice fed a high-fat diet. Journal of Endocrinology, 2019, 240(2):123-132.

[0018] [9] Lynch CJ, Adams SH. Branched-chain amino acids in metabolic signaling and insulin resistance. Nature Reviews Endocrinology, 2014, 10(12):723-736. Summary of the Invention

[0019] The main objective of this invention is to address the problems existing in the prior art by providing an application of a circular RNA derived from the BCKDHB locus and its expression vector in the treatment of hyperglycemia or type 2 diabetes. This vector is used to prepare nucleic acid drugs for the treatment of type 2 diabetes and / or hyperglycemia, and can improve the expression of circular RNA derived from the BCKDHB locus in the pancreatic islets and improve hyperglycemia and glucose intolerance.

[0020] The technical solution of this invention to solve its technical problem is as follows:

[0021] The use of a circular RNA for the preparation of a medicament for the treatment of type 2 diabetes and / or hyperglycemia, wherein the circular RNA is circBckdhb as shown in SEQ ID NO.1 or circBCKDHB as shown in SEQ ID NO.2.

[0022] The present invention also proposes an expression construct having an expression cassette, the expression cassette comprising a pancreatic β-cell preferred promoter, a nucleic acid sequence for transcribing circular RNA, and flanking sequences located on both sides of the nucleic acid sequence and promoting circularization; the circular RNA is circBckdhb shown in SEQ ID NO.1 or circBCKDHB shown in SEQ ID NO.2.

[0023] Preferably, the pancreatic β-cell preferred promoter is the RIP2 promoter shown in SEQ ID NO.8; the flanking sequences are the 5′ Circ-frame sequence shown in SEQ ID NO.9 and the 3′ Circ-frame sequence shown in SEQ ID NO.10, wherein the 5′ Circ-frame sequence is located at the 5′ end of the nucleic acid sequence and the 3′ Circ-frame sequence is located at the 3′ end of the nucleic acid sequence.

[0024] More preferably, the sequence of the expression box is SEQ ID NO.11 or SEQ ID NO.13.

[0025] This expression construct is able to express circular RNA derived from the BCKDHB locus in cells.

[0026] The present invention also proposes an expression vector containing the above-mentioned expression construct.

[0027] Preferably, the expression vector is a plasmid vector or a recombinant adeno-associated virus vector.

[0028] More preferably, the recombinant adeno-associated virus vector is AAV8-RIP2-circBckdhb or AAV8-RIP2-circBCKDHB, which uses an AAV8 capsid and is expressed by mouse circBckdhb or human circBCKDHB driven by the rat Ins2 gene RIP2 promoter.

[0029] More preferably, the recombinant adeno-associated virus vector uses the pAAV-MCS vector backbone shown in SEQ ID NO.14, and the CMV / β-globin intron / MCS region at positions 150-1394 of the viral vector backbone is replaced with the expression cassette shown in SEQ ID NO.11 or SEQ ID NO.13.

[0030] The present invention also proposes a pharmaceutical composition comprising the above-described expression construct and / or the above-described expression vector.

[0031] Preferably, the pharmaceutical composition further includes at least one of a pharmaceutically acceptable carrier, a diluent, and an excipient.

[0032] The present invention also proposes the use of the above-described expression construct, the above-described expression vector, or the above-described pharmaceutical composition in the preparation of a medicament for treating type 2 diabetes and / or hyperglycemia.

[0033] Preferably, the functions of the drug include increasing the expression of circBCKDHB and / or circBckdhb in pancreatic islet tissue, reducing fasting blood glucose, and / or improving glucose tolerance.

[0034] Preferably, the specific function of the drug includes at least one of the following: treating hyperglycemia induced by obesity or a high-fat diet, impaired glucose tolerance, or type 2 diabetes-like glucose metabolism disorder.

[0035] Compared with existing technologies, the circular RNA of this invention has a well-defined circular structure and RNase R tolerance, and is relatively enriched in pancreatic islets. Human circBCKDHB expression is reduced in the serum of type 2 diabetic patients and in the islets of type 2 diabetic donors, providing a disease-related basis for selecting therapeutic targets. Using pancreatic β-cell-preferred AAV8-RIP2-circBckdhb significantly increases circBckdhb expression in mouse islets, while expression in the heart, liver, fat, skeletal muscle, and kidneys shows no statistically significant difference compared to the control group. Increasing circBckdhb expression in mouse islets reduces fasting blood glucose and improves glucose tolerance in model animals. Therefore, this invention provides a nucleic acid intervention protocol to increase the expression of BCKDHB locus-derived circular RNA in islets and improve hyperglycemia and glucose intolerance. Attached Figure Description

[0036] Figure 1 This is a schematic diagram showing the source, circular structure, and primer positions of mouse circBckdhb in Example 1 of the present invention.

[0037] Figure 2 This is a nucleic acid gel electrophoresis image of PCR performed using cDNA and gDNA templates with the divergent and convergent primers of Example 1 of the present invention.

[0038] Figure 3 This is a sequence conservation analysis diagram of mouse mmu_circ_0001822 and human hsa_circ_0077164 in Example 1 of the present invention.

[0039] Figure 4 This is a graph showing the relative changes in the expression of circBckdhb, linear Bckdhb, and β-Actin in mice after RNase R treatment in Example 1 of this invention.

[0040] Figure 5 This is a Sanger sequencing peak diagram of the mouse circBckdhb amplification product across the inverse splicing site in Example 1 of this invention.

[0041] Figure 6 This is a diagram showing the relative expression of circBckdhb in the pancreas, islets, and pancreatic exocrine glands in Example 2 of the present invention.

[0042] Figure 7The graph shows the tissue expression, fasting blood glucose, body weight, glucose tolerance, and area under the curve results after AAV8-RIP2-circBckdhb treatment in Example 3 of this invention.

[0043] Figure 8 The images show the transfer plasmids pAAV-MCS_RIP2_circBckdhb_hGHpA_mouse in Examples 3 and 4 of this invention.

[0044] Figure 9 This image shows the difference in human circBCKDHB expression in the serum of normal glucose tolerance individuals and type 2 diabetic patients in Example 5 of the present invention, as well as the difference in circBCKDHB expression in the islets of pancreas of non-diabetic control donors and type 2 diabetic donors. Detailed Implementation

[0045] The circular RNAs involved in this invention are human circBCKDHB and mouse circBckdhb. Human circBCKDHB is a circular RNA formed by backsplicing of the BCKDHB gene-related exons, corresponding to hsa_circ_0077164, with a length of 608 nt, and its sequence is shown in SEQ ID NO.2. Mouse circBckdhb corresponds to mmu_circ_0001822, with a length of 608 nt, and its sequence is shown in SEQ ID NO.1. The sequence identity between the two is 88.49%, but species differences exist on both sides of the backsplicing site. In the research process of this invention, human circBCKDHB is used to define the intended therapeutic target, and mouse circBckdhb, as its homolog, is used for in vivo therapeutic function verification.

[0046] In one specific embodiment, the expression construct of the present invention, having an expression cassette, is capable of expressing circular RNA derived from the BCKDHB locus. The expression cassette includes a pancreatic β-cell-preferred promoter (e.g., the RIP2 promoter shown in SEQ ID NO. 8), a nucleic acid sequence capable of transcribing human circBCKDHB shown in SEQ ID NO. 2 or mouse homologous circBckdhb shown in SEQ ID NO. 1, and flanking sequences located on either side of the nucleic acid sequence that pair with each other and promote backsplicing and circularization. The flanking sequences are the 5′ Circ-frame sequence shown in SEQ ID NO. 9 and the 3′ Circ-frame sequence shown in SEQ ID NO. 10, wherein the 5′ Circ-frame sequence is located at the 5′ end of the nucleic acid sequence, and the 3′ Circ-frame sequence is located at the 3′ end of the nucleic acid sequence. The circularization-promoting function of the flanking sequences is verified by amplifying products across the backsplicing site using divergent primers, and the circular structure can be further confirmed by RNase R tolerance experiments. The sequences of the above expression cassette are shown in SEQ ID NO. 11 or SEQ ID NO. 13. The above expression constructs are able to produce circular RNA in cells.

[0047] In one specific embodiment, the expression vector of the present invention includes the above-described expression construct. The expression vector is a plasmid vector or a recombinant adeno-associated virus (AAV) vector. The recombinant AAV vector preferably uses an AAV8 capsid and is expressed as mouse circBckdhb or human circBCKDHB driven by the rat Ins2 gene RIP2 promoter, denoted as AAV8-RIP2-circBckdhb or AAV8-RIP2-circBCKDHB. The recombinant AAV vector preferably uses the pAAV-MCS vector backbone shown in SEQ ID NO. 14, specifically replacing the CMV / β-globin intron / MCS region at positions 150-1394 of the viral vector backbone with the expression cassette shown in SEQ ID NO. 11 or SEQ ID NO. 13.

[0048] In one specific embodiment, the pharmaceutical composition of the present invention comprises the above-described expression construct and / or the above-described expression vector. The pharmaceutical composition may also optionally include a pharmaceutically acceptable carrier, diluent, or excipient.

[0049] In one specific application, the circular RNA described above is used to prepare a drug for treating type 2 diabetes and / or hyperglycemia.

[0050] In one specific application, the above-described expression construct of the present invention is used to prepare a drug for treating type 2 diabetes and / or hyperglycemia.

[0051] In one specific application, the expression vector of the present invention is used to prepare a drug for treating type 2 diabetes and / or hyperglycemia.

[0052] In one specific application, the pharmaceutical composition of the present invention is used to prepare a medicament for treating type 2 diabetes and / or hyperglycemia.

[0053] In the above-mentioned application regimens, the drug functions to increase the expression of circBCKDHB and / or circBckdhb in pancreatic islet tissue, reduce fasting blood glucose, and / or improve glucose tolerance.

[0054] In the above-mentioned application schemes, the specific functions of the drug include at least the treatment of one of the following: hyperglycemia induced by obesity or a high-fat diet, impaired glucose tolerance, or type 2 diabetes-like glucose metabolism disorders.

[0055] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. However, the present invention is not limited to the examples given. Unless otherwise specified, experimental procedures described below shall be performed under conventional conditions or as recommended by the manufacturer. Unless otherwise specified, all experimental materials and reagents described below are commercially available products.

[0056] Example 1

[0057] This example demonstrates the sequence origin and cyclization structure identification of circBckdhb.

[0058] The specific details of this embodiment are as follows.

[0059] I. Main Experimental Materials

[0060] Experimental samples included MIN6 mouse pancreatic β cells and isolated primary mouse islets. Major reagents included TRIzol lysis buffer (Cisco Biotech), chloroform (Shanghai Lingfeng Chemical Reagent), isopropanol (Nanjing Chemical Reagent), RNase R and its accompanying buffer (Gise Biotech), 5×All-in-one reverse transcription reagent (Airico), SYBR real-time PCR reagent (Airico), Phanta Max high-fidelity PCR reagent (Novazan), agarose and nucleic acid dyes (Lambolid), and DEPC water (Shanghai Sangon Biotech).

[0061] The mouse circBckdhb sequence corresponds to mmu_circ_0001822, with a length of 608 nt, and is shown in SEQ ID NO.1. The sequences flanking the backsplicing site of mouse circBckdhb are shown in SEQ ID NO.3. The divergent primers for mouse circBckdhb are SEQ ID NO.4 and SEQ ID NO.5, and the convergent primers for linear Bckdhb are SEQ ID NO.6 and SEQ ID NO.7.

[0062] II. Experimental Methods

[0063] 1. Total RNA extraction from MIN6 cells and islets: 1 mL of pre-chilled TRIzol was added to each tube containing approximately 50 primary islets. MIN6 cells were collected and lysed using the same method. 200 μL of pre-chilled chloroform was added to each 1 mL of TRIzol, vortexed for 10 s, incubated on ice for 5 min, and centrifuged at 12000 r / min for 10 min at 4 °C. The supernatant was collected, and an equal volume of pre-chilled isopropanol was added. After mixing, the mixture was incubated at -20 °C for 20 min; centrifuged at 12000 r / min for 10 min at 4 °C. The resulting RNA precipitate was washed twice with pre-chilled 75% ethanol, dried, dissolved in 20 μL of DEPC water, and the concentration was determined.

[0064] 2. RNase R tolerance assay: Take 10 μg of total RNA, prepare a 20 μL reaction system according to RNase R 4 U / μg RNA and 10×Buffer 2 μL, and make up the volume with DEPC water; incubate at 37℃ for 15 min to digest linear RNA, and incubate at 70℃ for 2 min to inactivate residual enzyme. Take an equal amount of total RNA that has not been treated with RNase R as a mock control.

[0065] 3. Reverse transcription: Take 2 μg of RNase R-treated RNA and 2 μg of mock total RNA, add 4 μL of 5×All-in-one Master Mix Buffer, and make up to 20 μL with DEPC water. The reverse transcription program is 25℃ for 10 min, 42℃ for 45 min, and 85℃ for 5 min; the products can be stored at 4℃ for short-term storage or -20℃ for long-term storage. Genomic DNA (i.e., gDNA) is not reverse transcribed and is used directly for conventional PCR.

[0066] 4. cDNA and gDNA amplification: PCR was performed using cDNA and gDNA as templates, respectively, with circBckdhb divergent primers and Bckdhb convergent primers. A 20 μL system consisted of 2 μL template, 0.6 μL each of 10 μM forward and reverse primers, 0.2 μL DNA Polymerase, 10 μL 2×PhantaMax Buffer, 0.2 μL 10 mM dNTPs, and 6.4 μL DEPC water. The amplification program was 94℃ for 3 min; 94℃ for 15 s, 60℃ for 15 s, and 72℃ for 15 s / kb, for a total of 40 cycles; followed by a 5 min extension at 72℃.

[0067] 5. Nucleic acid gel electrophoresis: Prepare a gel using 0.25 g agarose and 25 mL 1×TAE, and add nucleic acid dyes. After adding loading buffer to the PCR products, perform electrophoresis at a constant voltage of 90 V and image the gel. Specific bands obtained from divergent primers are recovered for Sanger sequencing.

[0068] 6. Sanger sequencing: The specific bands amplified by the divergent primers were excised and recovered, purified, and then sent for Sanger sequencing. The sequencing reads were compared with SEQ ID NO.1 and SEQ ID NO.3 to confirm that the reads continuously spanned the circBckdhb backsplicing site.

[0069] 7. qRT-PCR: The expression of circBckdhb, linear Bckdhb, and β-Actin in the Mock and RNase R groups was detected using the SYBR method. A 10 μL system consisted of 1 μL cDNA, 0.3 μL each of forward and reverse primers, 5 μL of 2×SYBR Green Pro Taq HS premixed qPCR reagent, and 3.4 μL of DEPC water. The program was 95℃ pre-denaturation for 30 s, followed by 95℃ for 10 s and 60℃ for 30 s, for a total of 40 cycles. After amplification, melting curve analysis was performed at 60-95℃. Relative expression levels were calculated using the 2^-ΔCt or 2^-ΔΔCt method.

[0070] III. Experimental Results and Analysis

[0071] Database and gene structure analysis showed that the mouse mmu_circ_0001822 gene was formed by backsplicing of exons related to the Bckdhb gene, with a total length of 608 nt. Its structure and primer positions are as follows: Figure 1 As shown. PCR was performed using cDNA and gDNA as templates, and the results are as follows. Figure 2As shown, the divergent primers obtained specific bands in the cDNA template, but no corresponding bands were observed in the gDNA template. The convergent primers obtained amplified bands in both the cDNA and gDNA templates, which is consistent with the expected structure of circular RNA reverse splicing.

[0072] Human circBCKDHB is a circular RNA formed by backsplicing of the BCKDHB gene-related exons, corresponding to hsa_circ_0077164, with a length of 608 nt, and its sequence is shown in SEQ ID NO.2. The human circBCKDHB sequence shares 88.49% identity with the mouse circBckdhb sequence, as shown in the alignment results below. Figure 3 As shown.

[0073] For MIN6 cells and pancreatic islets, RNase R treatment significantly decreased the expression of linear Bckdhb and β-Actin, while circBckdhb remained relatively stable. The results are as follows: Figure 4 As shown. The Sanger sequencing reads continuously cross the backsplicing site, with the connection position being ATGTGGATACAGTTTGCAAG|GAAAAGATAGAGTGTTTAAC, consistent with SEQ ID NO.3. The results are as follows. Figure 5 As shown in the figure. The above results collectively support that circBckdhb is a circular transcript formed by backsplicing.

[0074] Example 2

[0075] This example illustrates the islet-enriched expression of circBckdhb.

[0076] I. Main Experimental Materials

[0077] Eight-week-old male C57BL / 6J mice were used as experimental animals. The animal experiments were approved by the Animal Ethics Committee of China Pharmaceutical University, license number 2162326. The main reagents included type V collagenase (Sigma), HBSS buffer (Beyotime), fetal bovine serum (Gibco), TRIzol lysis buffer (Cisco Biotech), 5×All-in-one reverse transcription reagent (Airico), and SYBR fluorescent quantitative PCR reagent (Airico).

[0078] II. Experimental Methods

[0079] 1. Islet Isolation: Prepare 1 mg / mL type V collagenase using HBSS. Ligate the junction of the bile duct, hepatic duct, and pancreatic duct. Slowly inject 2 mL of collagenase working solution into the pancreatic duct through the major duodenal papilla to fully inflate the pancreatic tail. Completely dissect the pancreas and place it in a centrifuge tube containing 1 mL of collagenase working solution. Digest at 37°C in a water bath with shaker at 85 rpm for 28 min. After digestion, briefly vortex, and terminate the reaction with 5 mL of HBSS containing 2% fetal bovine serum.

[0080] 2. Islet purification and tissue grouping: After centrifugation of the digestion product, it was resuspended in 10 mL of HBSS containing 2% fetal bovine serum and transferred to a culture dish. Islets were manually picked under a stereomicroscope and transferred sequentially to fresh Hanks' solution for further selection to remove as much exocrine glands and connective tissue as possible. The whole pancreas tissue and pancreatic exocrine gland tissue were preserved simultaneously.

[0081] 3. RNA Extraction and Detection: Whole pancreatic tissue, purified islet tissue, and exocrine gland tissue were collected separately. Total RNA was extracted and reverse transcribed using the same TRIzol method as in Example 1. circBckdhb was detected using the divergent primers shown in SEQ ID NO.4 and SEQ ID NO.5, and normalized using a validated internal reference gene. Three technical replicates were set for each sample.

[0082] 4. Statistical Analysis: Data from each group are expressed as mean ± standard error. One-way ANOVA was used for comparisons among the three groups. Tukey multiple comparisons were performed when homogeneity of variance was satisfied; the Kruskal-Wallis test was used when normality was not satisfied. P < 0.05 indicated statistical significance.

[0083] III. Experimental Results and Analysis

[0084] like Figure 6 As shown in the qRT-PCR results, the relative expression of circBckdhb in purified islets was significantly higher than that in whole pancreatic tissue and pancreatic exocrine gland tissue, with the lowest expression in exocrine gland tissue.

[0085] These results indicate that circBckdhb exhibits significant islet enrichment characteristics, providing a basis for further evaluation of its glucose metabolism function based on tissue expression.

[0086] Example 3

[0087] This example demonstrates a study on how AAV-circBckdhb improves glucose metabolism phenotypes in a diabetic model animal.

[0088] I. Main Experimental Materials

[0089] The experimental animals were 8-week-old male C57BL / 6J mice (Hangzhou Ziyuan Experimental Animal Technology Co., Ltd.). From 8 weeks of age, they were fed a high-fat diet with 60% fat as an energy source for a cumulative 20 weeks to establish an obesity-hyperglycemic model. The animal experiments were approved by the Animal Ethics Committee of China Pharmaceutical University, license number 2162326. AAV8-RIP2-circBckdhb is a recombinant adeno-associated virus vector containing the circBckdhb expression construct, using an AAV8 capsid; its expression cassette contains the rat Ins2 gene RIP2 promoter, a nucleic acid sequence capable of transcribing circBckdhb as shown in SEQ ID NO.1, and flanking sequences located on either side of it that promote circularization.

[0090] This embodiment uses the pAAV-MCS_RIP2_circBckdhb_hGHpA_mouse transfer plasmid (5116 bp), and its plasmid map is shown below. Figure 8 As shown in the figure. The plasmid retains bilateral AAV2 ITRs (i.e., Left AAV2 ITR and Right AAV2ITR in the figure) and hGH poly(A) signals; AAV8 indicates the capsid serotype used for viral packaging. The rat Ins2 gene RIP2 promoter sequence is shown in SEQ ID NO.8; the circular expression region is located between KpnI and NotI, and includes, in sequence: the 5′ Circ-frame sequence shown in SEQ ID NO.9, the mouse circBckdhb sequence shown in SEQ ID NO.1, and the 3′ Circ-frame sequence shown in SEQ ID NO.10, where the 5′ Circ-frame and 3′ Circ-frame sequences are flanking sequences that promote circularization; the complete mouse expression cassette sequence containing restriction endonuclease sites is shown in SEQ ID NO.11, which includes, in sequence: RIP2 promoter sequence, KpnI site, 5′ Circ-frame sequence, mouse circBckdhb sequence, 3′ Circ-frame sequence, and NotI site. In this embodiment, the insertion region and the linker region are verified by covering the Sanger sequencing reads at both ends of the vector.

[0091] The control vector retains the same vector backbone and promoter, but does not contain the circBckdhb expression sequence. The positive control drug is semaglutide (MCE).

[0092] II. Experimental Grouping and Drug Administration

[0093] Mice that successfully developed the model were randomly divided into a model control group, a semaglutide group, and an AAV8-RIP2-circBckdhb group, with 7 mice in each group, based on their body weight and baseline fasting blood glucose. The AAV8-RIP2-circBckdhb group received a total viral genome dose of 1×10^10 vg / mouse, with the virus diluted in physiological saline and infused via a bile duct cannula at a rate of 1 μL / min. The model control group received the same dose of AAV8-RIP2 empty vector in the same manner. The semaglutide group received a subcutaneous injection of 0.861 mg / kg once weekly for 5 weeks.

[0094] Mice in each group were allowed free access to food and water under the same temperature, light cycle, and feeding conditions.

[0095] III. Experimental Methods

[0096] 1. Weight and fasting blood glucose monitoring: Baseline weight and fasting blood glucose were recorded before the intervention, and thereafter measured weekly at fixed times under a uniform 6-hour fasting condition. Weight was measured using a calibrated electronic balance; fasting blood glucose was measured using tail prick blood sampling and a portable blood glucose meter.

[0097] 2. Glucose tolerance test: After the intervention, mice were fasted for 16 h but allowed free access to water. A glucose solution of 1.5 g / kg body weight was injected intraperitoneally. Blood glucose levels were measured by collecting blood samples from the tail tip at 0 min before injection and at 15, 30, 60, 90, and 120 min after injection. The area under the blood glucose curve from 0 to 120 min was calculated using the trapezoidal method.

[0098] 3. Tissue sampling and vector expression detection: Mice were euthanized after the experiment, and the heart, liver, white adipose tissue, brown adipose tissue, skeletal muscle, kidney, and pancreas were rapidly isolated, flash-frozen in liquid nitrogen, and stored at -80℃. Total RNA was extracted from each tissue and qRT-PCR was performed to detect the relative expression of circBckdhb and evaluate the tissue expression bias of the AAV8-RIP2-circBckdhb recombinant vector.

[0099] 4. Statistical Analysis: Repeated measures two-way ANOVA was used to analyze the body weight, fasting blood glucose, and glucose tolerance curves. Two-tailed unpaired t-tests were used to compare AUC between groups, and multiple comparisons were performed when necessary. P < 0.05 indicated statistical significance.

[0100] IV. Experimental Results and Analysis

[0101] like Figure 7As shown in Figure A, tissue expression detection revealed that circBckdhb in the AAV8-RIP2-circBckdhb group was mainly elevated in the pancreas by about 40-fold, while no significant increase was observed in the heart, liver, fat, skeletal muscle, and kidney, indicating that the recombinant adeno-associated virus vector using the rat Ins2 gene RIP2 promoter has a pancreatic expression bias.

[0102] Monitoring results over five consecutive weeks showed that, Figure 7 As shown in Figure B, the fasting blood glucose level remained high in the model control group, while it decreased week by week in the AAV8-RIP2-circBckdhb group, with a trend similar to that of the smegglutinin group; Figure 7 As shown in Figure C, the body weight of the AAV8-RIP2-circBckdhb group and the smegglutinin group decreased over the intervention period.

[0103] like Figure 7 As shown in Figures D and E, the glucose tolerance test showed that the blood glucose curve of the AAV8-RIP2-circBckdhb group after glucose loading was lower than that of the model control group, and its 0-120 min AUC was significantly reduced.

[0104] These results indicate that increasing the expression of circBckdhb in mouse pancreatic islets can reduce fasting blood glucose and improve glucose tolerance.

[0105] Example 4

[0106] This embodiment describes the design and vector preparation of the circBCKDHB / circBckdhb expression construct.

[0107] I. Main Materials

[0108] The expression construct includes a pancreatic β-cell-preferred promoter, a nucleic acid sequence capable of transcribing the target circular RNA, and flanking sequences located on either side of the target sequence that can pair with each other and promote backsplicing and circularization. The pancreatic β-cell-preferred promoter is preferably the rat Ins2 gene RIP2 promoter, corresponding to the 704 nucleotide sequence in GenBank record J00748.1 from −695 to +8 relative to the transcription start site, as shown in SEQ ID NO. 8. For the nucleic acid sequence used to transcribe the target circular RNA, the human protocol uses the circBCKDHB sequence shown in SEQ ID NO. 2, and the mouse in vivo functional validation protocol uses the circBckdhb sequence shown in SEQ ID NO. 1. The flanking sequences are functionally determined based on their ability to cause the transcription product to form circular RNA across the corresponding backsplicing site.

[0109] II. Construction Method

[0110] 1. Expression cassette design: The target circRNA's corresponding nucleic acid sequence is placed downstream of the pancreatic β-cell-preferred promoter, with mutually pairable flanking sequences on both sides to promote backsplicing and circularization of the target transcript. The mouse protocol uses the sequence shown in SEQ ID NO.1, with its backsplicing ligation sequence shown in SEQ ID NO.3; the human protocol uses the sequence shown in SEQ ID NO.2, with its backsplicing ligation sequence shown in SEQ ID NO.12.

[0111] According to the actual vector cloning boundary, the flanking sequences are 5′ Circ-frame and 3′ Circ-frame sequences, where the 5′ Circ-frame sequence is shown in SEQ ID NO.9 and the 3′ Circ-frame sequence is shown in SEQ ID NO.10; the complete mouse expression cassette formed by sequentially connecting the RIP2 promoter, KpnI site, 5′ Circ-frame, mouse circBckdhb, 3′ Circ-frame and NotI site is shown in SEQ ID NO.11; the complete human expression cassette obtained by replacing mouse circBckdhb with human circBCKDHB is shown in SEQ ID NO.13.

[0112] 2. Vector construction: The above expression cassette is cloned into the viral vector backbone to obtain the expression construct.

[0113] The mouse protocol places the expression cassette shown in SEQ ID NO. 11 into the pAAV-MCS vector backbone shown in SEQ ID NO. 14; the human protocol uses the same substitution for the expression cassette shown in SEQ ID NO. 13. The CMV / β-globinintron / MCS region at positions 150-1394 is replaced with the corresponding 1711 bp expression cassette. The plasmid map includes bilateral AAV2 ITR, RIP2, 5′ Circ-frame, target insertion region, 3′ Circ-frame, hGH poly(A), f1 origin of replication, ColE1 origin of replication, and the Amp resistance gene. The plasmid map for the mouse protocol is shown below. Figure 8 As shown.

[0114] As a preferred specific implementation, in vivo validation in mice was performed using the rat Ins2 gene RIP2 promoter to drive circBckdhb expression and package it as AAV8-RIP2-circBckdhb.

[0115] The control vector retains the same backbone and promoter, but does not contain the circBckdhb expression sequence.

[0116] 3. Quality Control: Sequencing was used to confirm the target insert and key linker regions of the vector. Following transfection or infection, in the mouse protocol, the product across the backsplicing site shown in SEQ ID NO. 4 and SEQ ID NO. 5 was detected using divergent primers; in the human protocol, the product across the backsplicing site shown in SEQ ID NO. 12 was detected using divergent primers shown in SEQ ID NO. 15 and SEQ ID NO. 16. If necessary, an RNase R tolerance assay was performed to confirm the circular structure of the formed RNA.

[0117] III. Results

[0118] The above expression constructs were successfully obtained. These constructs can be used to enhance the expression of circBCKDHB and / or circBckdhb in target cells. An optimized approach using the AAV8 capsid and the rat Ins2 gene RIP2 promoter can enhance pancreatic circBckdhb expression in animals and provide a vector basis for subsequent improvement of hyperglycemia and glucose tolerance.

[0119] Example 5

[0120] This embodiment studies the expression of human circBCKDHB in the serum of patients with type 2 diabetes and in human islets.

[0121] I. Research Subjects and Samples

[0122] Serum samples were collected from 35 individuals with normal glucose tolerance and 80 patients with type 2 diabetes. Islet samples from non-diabetic control donors and type 2 diabetic donors were used for tissue expression validation. The human serum samples and clinicopathological data used in this embodiment were collected from Yifu Hospital Affiliated to Nanjing Medical University (Nanjing, China). All human subjects provided written informed consent, and all human studies were conducted in accordance with the principles of the Declaration of Helsinki and approved by the Ethics Committee of Zhongda Hospital, Southeast University (Nanjing, China, Approval No.: 2018ZDSYLL132-P01). This embodiment is used to illustrate the correlation between circBCKDHB and the pathological state of type 2 diabetes and to provide a basis for the selection and translational application of therapeutic targets.

[0123] II. Experimental Methods

[0124] 1. Serum and human islet samples: Clinically isolated serum was used, aliquoted according to number, and stored at -80℃. Repeated freeze-thaw cycles were avoided before testing. Human islet samples were divided into a non-diabetic control group and a type 2 diabetic group based on the donor's clinical status.

[0125] 2. Cell-free RNA extraction from serum: A serum / plasma cell-free RNA extraction kit (TIANGEN) was used. 200 μL of serum was collected from each sample, and RNA carrier, lysis buffer, and digestion solution were added. Lysis, adsorption, washing, and elution were performed according to the kit instructions to obtain cell-free RNA from serum.

[0126] 3. Reverse transcription and qRT-PCR: Serum free RNA and total human pancreatic islet RNA were reverse transcribed separately. circBCKDHB expression was detected using the human circBCKDHB divergent primers shown in SEQ ID NO. 15 and SEQ ID NO. 16, and normalization was performed using a validated human internal control or exogenous reference. Technical replicates were set for each sample, and a template-free control was included.

[0127] 4. Statistical Analysis: Two-tailed unpaired t-tests or Mann-Whitney U tests were used based on the data distribution. Normally distributed data are expressed as mean ± standard deviation, and non-normally distributed data are expressed as median (interquartile range). P < 0.05 indicates statistical significance.

[0128] III. Experimental Results and Analysis

[0129] like Figure 9 As shown in Figure A, the results of serum sample testing revealed that the relative expression level of circBCKDHB in the serum of patients with type 2 diabetes was significantly lower than that in individuals with normal glucose tolerance. Figure 9 As shown in Figure B, the results of human islet detection showed that the relative expression of circBCKDHB in the islets of type 2 diabetic donors was also lower than that in non-diabetic control donors, and the direction of change was consistent with the results of human serum.

[0130] The above results indicate that human circBCKDHB expression is reduced in the serum and under pathological conditions of pancreatic islets in patients with type 2 diabetes. This is consistent with the results in animal experiments showing that increasing pancreatic circBckdhb expression can improve glucose metabolism phenotype, suggesting that circBCKDHB / circBckdhb may be involved in maintaining pancreatic β-cell function and could serve as a therapeutic intervention target.

[0131] In addition to the embodiments described above, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.

Claims

1. The use of a circular RNA in the preparation of a medicament for treating type 2 diabetes and / or hyperglycemia, said circular RNA being circBckdhb as shown in SEQ ID NO.1 or circBCKDHB as shown in SEQ ID NO.

2.

2. An expression construct having an expression box, characterized in that, The expression cassette includes a pancreatic β-cell preferred promoter, a nucleic acid sequence for transcribing circular RNA, and flanking sequences located on both sides of the nucleic acid sequence that promote circularization; the circular RNA is circBckdhb shown in SEQ ID NO.1 or circBCKDHB shown in SEQ ID NO.

2.

3. The expression construct according to claim 2, characterized in that, The pancreatic β-cell preferred promoter is the RIP2 promoter shown in SEQ ID NO.8; the flanking sequences are the 5′ Circ-frame sequence shown in SEQ ID NO.9 and the 3′ Circ-frame sequence shown in SEQ ID NO.10, wherein the 5′ Circ-frame sequence is located at the 5′ end of the nucleic acid sequence and the 3′ Circ-frame sequence is located at the 3′ end of the nucleic acid sequence.

4. The expression construct according to claim 3, characterized in that, The sequence of the expression box is SEQ ID NO.11 or SEQ ID NO.

13.

5. An expression vector containing the expression construct according to any one of claims 2 to 4.

6. The expression vector according to claim 5, characterized in that, The expression vector is a plasmid vector or a recombinant adeno-associated virus vector.

7. The expression vector according to claim 6, characterized in that, The recombinant adeno-associated virus vector is AAV8-RIP2-circBckdhb or AAV8-RIP2-circBCKDHB, which uses an AAV8 capsid and is expressed by mouse circBckdhb or human circBCKDHB driven by the rat Ins2 gene RIP2 promoter.

8. The expression vector according to claim 6, characterized in that, The recombinant adeno-associated virus vector uses the pAAV-MCS vector backbone shown in SEQ ID NO.14, and the CMV / β-globin intron / MCS region at positions 150-1394 of the viral vector backbone is replaced with the expression cassette shown in SEQ ID NO.11 or SEQ ID NO.

13.

9. A pharmaceutical composition comprising the expression construct according to any one of claims 2 to 4 and / or the expression vector according to any one of claims 5 to 8.

10. The pharmaceutical composition according to claim 9, characterized in that, The pharmaceutical composition further includes at least one of a pharmaceutically acceptable carrier, a diluent, and an excipient.

11. The use of the expression construct of any one of claims 2 to 4, the expression vector of any one of claims 5 to 8, or the pharmaceutical composition of claim 9 or 10 for the preparation of a medicament for treating type 2 diabetes and / or hyperglycemia.

12. The application according to claim 1 or 11, characterized in that, The functions of the drug include increasing the expression of circBCKDHB and / or circBckdhb in pancreatic islet tissue, reducing fasting blood glucose, and / or improving glucose tolerance.

13. The application according to claim 1 or 11, characterized in that, The specific functions of the drug include at least the treatment of one of the following: hyperglycemia induced by obesity or a high-fat diet, impaired glucose tolerance, or type 2 diabetes-like glucose metabolism disorders.

Images